Background
Gastric cancer was the third leading cause of global cancer deaths, causing a major health issue [
1]. In recent years, with the development of tumor molecular biology techniques and understanding of pathogenesis, the molecular targeted therapies have been developed according to the reveal of oncogenic pathways [
2‐
4]. Hence, there is a need to increase the efficacy of treatment and to reduce the side effects in gastric cancer therapy. Approximately ten percent of gastric cancer was infected with Epstein-Barr virus (EBV) [
5]. EBV is a member of the γ‑herpesvirus family which infects 90 % of the world population [
6]. The EBV life cycle includes latent and lytic form [
7]. EBV persists in EBV positive malignancies as latent form; when the lytic cycle of EBV was activated, larger numbers of lytic proteins are expressed at high levels [
27]. Lytic EBV replication damages the host cancer cells, which provides a potential therapeutic target for EBV associated cancers [
28,
29]. The switch from latent to lytic EBV infection is mediated by expression of the two EBV immediate-early viral proteins, BZLF1 and BRLF1, which could activate the complete cascade of lytic viral gene expression [
8,
9]. These proteins activate the viral early genes, resulting in a cascade of events that lead to the activation of lytic replication. For the lytic form of EBV infection, the host immune responses were triggered against EBV and the host cancer cell may be killed [
10]. EBV-associated malignancies generally have only a very low level of lytic EBV gene expression without chemotherapy [
11]. Several therapeutic strategies could induce the lytic form of EBV infection by activating EBV lytic genes for tumor cells killing have been reported [
12,
13]. For example,Romidepsin showed the ability to activate the lytic cycle of EBV and lead to cell death in EBV positive gastric cancer cells [
14]. Taking together, these findings suggested that EBV itself could serve as a target for the killing of tumor cells.
Plants with various curative properties have received attentions in the area of pharmacology [
15] Medicinal plants have played important roles in anti-cancer drug discovery [
24]. Natural products have been involved in the development of approximately 75 % of anticancer agents from 1981 to 2010 [
16]. Therefore, exploring the possible mechanism of bioactivities of traditional used plants could promote the development of pharmaceutical products.
Incarvillea belongs to the family Bignoniaceae, genus Incarvillea.
Incarvillea compacta Maxim. is a perennial herb mainly distributed in Tibet, which has been traditionally used for treating dyspepsia and gastralgia for centuries [
17]. So far, there have been studies on the chemical composition of other species of genus Incarvillea [
18‐
21], which show antioxidant activities and life span prolonging, inhibitory effects on multiple kinase targets and their downstream pathways activated by solar UV in vitro and in vivo [
25,
26]. However, no pharmacological studies in stomach disorder treatment are available so far. Besides, the potential value of the herb in treating gastric cancer should not be ignored. Our previous phytochemical investigations on the species disclosed the presence of phenylethanoid glycosides in n-butyl alcohol fraction exhibiting hepatoprotective activity [
22]. Thus, the present study was initiated to investigate anticancer effects of
I. compacta.
In this study, we analyzed the cytotoxic effects of various fractions of I. compacta in stomach (AGS, AGS-EBV, BGC-823), EBV-transformed B-cell lines (lymphoblastoid cell lines, LCL), liver (HepG-2), leukemia (K562), cervix (HeLa), lung (A549) and prostate (PC3 and DU145) cancer cells. The most effective fraction (trichloromethane fraction, IC-TCL, R2) in AGS-EBV cells growth inhibition was further evaluated for the induction of apoptosis, EBV lytic, and cell cycle arrest. We confirmed that R2 induce the expressions of EBV lytic genes in AGS-EBV cells and EBV-transformed B-cell lines (LCL), resulting in EBV-positive cells death in vitro. These findings indicated that R2 may be used as a novel agent in treating EBV-positive tumors.
Methods
Plant materials
I. compacta roots were collected in Huzhu County, Qinghai Province, China in July 2013, and identified by Prof. Xiao-Feng Zhang of the Department of Tibetan medicines, Northwest Institute of Plateau Biology, Chinese Academy of Sciences. A voucher specimen (NO. 130718) was deposited at the Key Laboratory of Bioactive Substances and Resource Utilization of Chinese Herbal Medicine, Ministry of Education, Institute of Medicinal Plant Development, Peking Union Medical College and Chinese Academy of Medical Sciences.
Dried and coarsely powered plant roots material of I. compacta (1.1 kg) was extracted three times with 90 % ethanol (3 × 3 L) at room temperature. Removal of the ethanol under reduced pressure yielded the I. compacta ethanolic extract (IC-ET). The practical yield of IC-ET was 8.90 %. The IC-ET (90 g) was suspended in distilled water (1 L) and then the suspension was partitioned with trichloromethane and n-BuOH, successively, yielding the trichloromethane fraction (IC-TCL), the n-BuOH fraction (IC-BT), and the H2O fraction (IC-R). Each fraction was concentrated using rotary evaporator in vacuum, and completely dried. The yield of IC-TCL, IC-BT, and IC-R was 24.4 %, 36.7 %, and 33.3 %, respectively. For biological assays, IC-TCL, IC-BT, and IC-R were dissolved in pure dimethyl sulfoxide and subjected to serial dilution so that the final concentration of DMSO in solution was less than 1 %.
Instrumentations and analytical conditions
Chromatography was performed on a Dionex UltiMate 3000 U-HPLC system consisted of an auto-sampler, a quaternary pump, and a column oven (Thermo, Markham, Ontario, Canada). The chromatographic separation was performed on a Waters Acquity BEH C18 column (2.1 mm × 100 mm, 1.7 μm, Waters Corporation, Milford, MA). The mobile phase was comprised of 5 mM ammonium formate in water (solvent A) and 5 mM ammonium formate in methanol (solvent B) at a flow rate of 0.3 mL/min. The gradient elution program was as follows: 5 % B – 25 % B at 0–2 min; 25 % B – 100 % B at 2–30 min; 100 % B – 100 % B at 30–35 min. The column oven temperature and the auto-sampler temperature were maintained at 30 °C and 4 °C, respectively. The sample injection volume was 5 μL.
Mass spectrometer
QExactive Orbitrap FTMS mass spectrometer equipped with an electrospray ionization (ESI) source (Thermo, Markham, Ontario, Canada) was connected to the UHPLC system via an electro spray ionization source (ESI) interface. The ESI source was operated in a positive ionization mode at a capillary voltage of 3.5 kV. Nitrogen was used as the desolvation gas (600 L/h) and cone gas (50 L/h). The temperatures of the source and desolvation were set at 150 and 400 °C, respectively. Nitrogen was used as the collision gas, and the collision energy was 14 eV.
Reagents and antibodies
Dulbecco’s Modified Eagle’s Medium (DMEM), Ham’s F12 medium, trypsin, penicillin, streptomycin, fetal bovine serum (FBS) were purchased from Gibco (CA, USA), and 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT), DMSO, Hoechst 33342, DIOC6, RNase A, propidium iodide (PI), Trizol and trypan blue were purchased from Sigma-Aldrich (MO, USA). Dihydroethidium was bought from Beyotime Biotech (Jiangsu, China). The Annexin V-PE/7-AAD apoptosis detection kit was obtained from KeyGEN Biotech (Jiangsu, China). Antibodies against Bax, Bcl-2, Cyclin D1, BZLF1 and BMRF1 were obtained from Santa Cruz Biotechnology (CA, USA). Bax ((6A7) sc-23959) is a mouse monoclonal antibody raised against the N-terminal residues 12–24 common to human, mouse and rat Bax protein. Bcl-2 ((C-2) sc-7382) is a mouse monoclonal antibody raised against amino acids 1–205 of Bcl-2 of human origin. Cyclin D1 ((H-295) sc-753) is a rabbit polyclonal antibody raised against amino acids 1–295 representing full length cyclin D1 of human origin. EBV Ea-D ((1108-1) BMRF1, sc-69679) is a mouse monoclonal antibody raised against affinity purified early antigen polypeptides from induced Raji cells precipitated with African Burkitt’s lymphoma sera. EBV ZEBRA ((BZ1) BZLF1, sc-53904) is amousemonoclonal antibodyraised against full-length recombinant EBV ZEBRA protein. Antibodies against Rb, and β-actin were purchased from Cell Signaling Technology (MA, USA). Rb (4H1) Mouse mAb #9309 is produced by immunizing animals with a Rb-C fusion protein containing residues 701–928 of human Rb. β-actin (8H10D10) Mouse mAb #3700 is produced by immunizing animals with a synthetic peptide corresponding to amino-terminal residues of human β-actin The cECL Western Blot Kit and SYBR Green Premix detection system were obtained from CoWin Biotech (Beijing, China). All the chemical reagents used were of the highest grade.
Cell culture
AGS (human gastric carcinoma cells), wild-type EBV positive AGS cell line (AGS-EBV) and wild-type EBV-transformed B-cell lines (lymphoblastoid cell lines, LCL) were obtained from Professor Wenhai Feng (College of Biological Sciences, China Agricultural University, China). GES-1 cell line was purchased from Cancer Institute & Hospital, Chinese Academy of Medical Sciences (China). Other cell lines used were from Chinese Academy of Sciences (China). Cells were cultured in Ham’s F-12 medium (AGS and AGS-EBV cell lines), RPMI 1640 medium (LCL, K562) and DMEM medium (other cell lines) containing 10 % fetal bovine serum, 100 U/ml penicillin and 100 μg/ml streptomycin at 37 °C with 5 % CO2. Medium contain DMSO were used as vehicle control.
Cell viability and cytotoxicity assay
MTT assay was used to determine the cell viabilities after the treatment of tested fractions. AGS, AGS-EBV, HeLa, BGC-823, GES-1 cells (6 × 103 cells/well); WPMY, SV-HUC-1, DU145, PC3 cells (7 × 103 cells/well); A549, HepG-2 cells (8 × 103 cells/well); LCL, K562 cells (9 × 103 cells/well) were seeded in triplicate in 96-well plates and cultured at 37 °C for 24 h. Cells were treated by different fractions in various concentrations (DMSO, 2.5, 5, 10, 20, 40 μg/mL). After 24 h treatments, MTT (5 mg/mL) was added to each well for another 4 h. The medium were then removed and 150 μL DMSO was added. The absorbance was measured at 570 nm using the Microplate Reader (Bio Tek, America). Cell viability was expressed as the ratio of surviving cells in each group to control group.
Trypan blue exclusion was used to examine the numbers of dead cells in each group. AGS cells and AGS-EBV cells (1 × 106 cells/well) were plated in 6-well plates for 24 h and then treated with various concentrations of R2 (DMSO, 2.5, 5, 10, 20 and 40 μg/mL) for 24 h, 48 h and 72 h. After harvesting, the cells were suspended in PBS and mixed with 0.4 % trypan blue solution. The number of viable cells and dead cells were counted under the light microscope.
Detection of apoptotic cells
Apoptotic cells were detected by Hoechst 33342 staining and Annexin V-PE/7-AAD detection. AGS-EBV cells were cultured in 96-well plates and treated with R2 (DMSO, 5, 10, and 20 μg/mL) for 24 h. After washed with PBS, cells were stained with Hoechst 33342 (10 μg/mL) for 10 min. Morphology changes in nuclear were observed using Image Xpress Micro imaging system (Molecular Devices, USA).
AGS-EBV cells (1 × 106 cells/well) were seeded in 6-well plates for 24 h and then treated with various concentrations of R2 (DMSO, 5, 10 and 20 μg/mL) for 24 h. After washing twice with PBS, the cells were stained by an Annexin V-PE/7-AAD apoptosis kit (KeyGEN Biotech, Nanjing, China) according to the manufacturer’s instructions. Stained cells were detected and analyzed using flow cytometry (Becton Dickinson, USA).
Detection of mitochondrial membrane potential
Changes in the mitochondrial membrane potential after R2 treatment were measured by flow cytometry using DIOC6. Cells were treated with R2 (DMSO, 5, 10, and 20 μg/mL) for 24 h. Cells were then harvested and incubated with DIOC6 (5 μM) for 30 min in the dark at 37 °C. After washing with PBS, cells were analyzed by flow cytometry.
Cell cycle analysis
Cell cycle phase distributions were measured by staining DNA with Propidium Iodide. AGS-EBV cells were seeded in 6-well plates and treated with R2 (DMSO, 5, 10, and 20 μg/mL) for 24, 48 and 72 h. Then harvested the cell and fixed in 70 % ethanol overnight at -20 °C. After washing 3 times with PBS, incubated the cells with RNase A (Amresco, USA) for 20 min. Then the cells were stained with 50 μg/mL PI for 10 min in the dark at room temperature. DNA contents were detected by flow cytometry and analyzed by ModFit LT 4.0.
Western blot
AGS-EBV and LCL cells were exposed to R2 (DMSO, 5, 10, and 20 μg/mL) for 24 h. After collection, cells were lysed in lysis buffer and protein concentrations were determined by BCA method. Protein samples (40 μg) were separated by SDS–PAGE gel electrophoresis and electrically transferred onto PVDF membranes. After blocking with 5 % non-fat milk solution for 1 h, the membranes were incubated with primary antibody at 4 °C overnight. Later, washed away the primary antibody with TBST and incubated with the HRP-conjugated secondary antibody at room temperature for 1 h. The protein bands were visualized by cECL. The level of β-actin for each sample was used as a control.
RT-PCR detected the expression of specific mRNA related with EBV lytic replication
The changes of mRNA expression after R2 treatment in AGS-EBV cells were quantified by real-time polymerase chain reaction (RT-PCR). AGS-EBV cells were exposed to R2 (DMSO, 5, 10, and 20 μg/mL) for 24 h. Trizol was used to lysis cells. After RNAs were extracted, we used Nanodrop 2000 (Thermo scientific) to quantity RNA. The sequences of primers were AAATTTAAGAGATCCTCGTGTAAAACATC (sense) and CGCCTCCTGTTGAAGCAGAT (anti-sense) for BZLF1; ATGGAACATGCGTCGTTG (sense) and AATGGCCACGCTCAACAT (anti-sense) for BRLF1; CAACACCGCACTGGAGAG (sense) GCCTGCTTCACTTTCTTGG (anti-sense) for BMRF1, TTGCCATCAATGACCCCTTCA (sense) and CGCCCCACTTGATTTTGGA (anti-sense) for β-Actin. β-Actin was served as an internal reference. The mRNA expression levels were measured by SYBR Green Premix detection system (Cwbio, China). The PCR conditions were 95 °C 20 s;95 °C 3 s、60 °C 30 s (40 cycles).
Statistical analysis
All data were analyzed by IBM SPSS statistics 19. The differences in the means between groups were compared by t-tests. The statistically significant between groups was defined as **p < 0.01 or *P < 0.05. Results were expressed as mean ± SD.
Discussion
Medicinal plants have played important roles in anti-cancer drug discovery [
24].
Incarvillea compacta Maxim. is a perennial herb mainly distributed in Tibet and has been for treating stomach disorder for centuries. In the current study, we investigated the anti-cancer effects of
I. compacta extracts in stomach (AGS, AGS-EBV, BGC-823), LCL, liver (HepG2), leukemia (K562), cervix (HeLa), lung (A549) and prostate (PC3 and DU145) cancer cells. Cytotoxicity studies showed that trichloromethane fraction (R2) possess cell viability inhibition effects in EBV positive cancer cells (AGS-EBV) and wild-type EBV-transformed B-cell lines (LCL) among all the other fractions and other cancer cell lines.
Since R2 showed different inhibition effects on AGS cells and EBV positive AGS cells, we take further investigations on R2. Gastric cancer has been reported to be associated with EBV [
31]. EBV persists in EBV positive malignancies as latent form. Entry into the viral lytic cycle is initiated by the expression of two immediate early EBV proteins and one early protein: Zta encoded by BZLF1, and Rta encoded by BRLF1, EAD encoded by BMRF1 [
6,
30]. In this study, we explored the ability of R2 inducing EBV lytic cycle in EBV-positive AGS cell lines and critically examined the relationship between viral lytic cycle activation and the induction of apoptosis in AGS-EBV. R2 could potently induce EBV lytic cycle in AGS-EBV and LCL cells. The mRNA expression levels of immediate early (BZLF1 and BRLF1) and early (BMRF1) lytic genes increased in AGS-EBV cells. Western blot and immunofluorescent staining assays showed the BZLF1 and BMRF1 lytic proteins were increased after R2 treatment in both AGS-EBV and LCL cells. These results indicated that R2 was capable of inducing EBV lytic replication in EBV-positive cancer cells.
Our results were consisting with others that the induction of EBV lytic cycle could mediate additional killing of EBV-positive cancer cells [
32,
33] We also observed similar phenomenon in AGS-EBV cells after R2 treatment. Hoechst 33342 staining, mitochondrial membrane potential assay and Annexin V-PE/7-AAD assay for apoptosis revealed that R2 could induce apoptosis in AGS-EBV cells. Western blot results showed the expression of Bax increased, while Bcl-2 decreased. Cell cycle arrest is associated with cell death; however which is not the only factor related to cell death. As in our observations, 10 μg/ml of R2 could induce G0/G1 cell cycle arrest, which may be at least partly related to the cell death of AGS-EBV. Other treatments like suberoylanilide hydroxamic acid could induce G2/M arrest and enhanced cell death in EBV positive AGS cells had also been reported [
32]. We found that cell cycle related proteins cyclin D1 decreased, while the expression of Rb increased after R2 treatment. Our results also suggested that R2 treatment exhibit less cytotoxic effects on normal cells and other kinds of cancer cells. Further studies of R2 in other EBV positive cancer cell lines such as SNU-719 are required to explore the mechanism and find the molecular target during this process.
Acknowledgments
We would like to thank Professor Wenhai Feng (College of Biological Sciences, China Agricultural University, China) for providing AGS, wild-type EBV positive AGS (AGS-EBV) and wild-type EBV-transformed B-cell lines (lymphoblastoid cell lines, LCL).