Background
Despite significance advances in therapeutic strategies against congestive heart failure (CHF) during the past few decades, CHF remains one of the most serious diseases, contributing to substantial mortality and morbidity throughout the world [
1,
2]. Ventricular hypertrophy and cardiac remodeling have been well established as important pathologic events that play fundamental roles during the pathogenesis of CHF [
3,
4]. Indeed, various stimuli of cardiac injury lead to impairment of cardiac function and subsequently activation of neurohormonal factors, which in the long-term, causes apoptosis of cardiomyocytes, fibrosis and eventually hypertrophy of the myocardium, finally leading to a vicious cycle of cardiac function deterioration [
5]. This pathogenetic process has been known as ventricular remodeling, and inhibitors of neurohormonal factors that are involved in the activation of ventricular remodeling have been recognized as important therapeutic medications against CHF [
6]. More importantly, subsequent studies have highlighted the role of myocardial metabolic dysfunction as a potential pivotal process before ventricular remodeling begins during the pathogenesis of CHF [
7]. Hypertrophied myocardium has been shown to be characterized by the disturbance of homeostasis of energy metabolism [
8‐
11]. Moreover, an interesting genomic study found that early and acute changes in the expression of genes related to energy metabolism can be detected before evidence of cardiac remodeling [
12], which indicates that disturbance of myocardial biogenesis may be an initial process and important contributor to cardiac remodeling. However, to the best of our knowledge, the acute changes in energy status during the early phase of cardiac pressure overload, a conventional stimulus of cardiac remodeling, have not been systematically studied.
Neuropeptide Y (NPY) has been recognized as a key regulator of energy metabolism via its binding and signaling with its receptors (NPY-R) [
13]. Previous studies in human patients and animal models of CHF have suggested that NPY may participate in the pathogenesis of myocardial hypertrophy and subsequent CHF [
14‐
16]. However, whether the NPY system is involved in the metabolism disturbance during the early phase of cardiac pressure overload still needs to be determined. Trimetazidine (TMZ) is used clinically as an anti-angina medication, because it can improve energy metabolism during the process of myocardial ischemia [
17,
18]. Upon application of TMZ, the utilization of free fatty acids for energy production is decreased in myocardium due to its inhibitory effect on mitochondrial 3-ketoacyl CoA thiolase (3-KAT) in beta-oxidation, and subsequently, the consumption of non-lipid substrates, mainly glucose, is increased [
19]. Recent studies suggested that TMZ may inhibit pressure overload-induced cardiac fibrosis and myocardial remodeling [
20]. Therefore, it is reasonable to speculate that TMZ, as a medication capable of optimizing myocardial metabolism, may attenuate the disturbance of myocardial energy metabolism during the acute phase of pressure overload-induced myocardial remodeling.
Based on the evidence presented above, we hypothesized that myocardial metabolic disturbance may be an early event before the morphological changes of myocardial hypertrophy, and changes in the NPY system may be involved. Moreover, pretreatment with TMZ may attenuate the metabolic disturbance of the myocardium before the morphological changes of ventricular hypertrophy can be detected, and these metabolic benefits of TMZ may involve the regulation of serum and myocardial NPY system. Therefore, in this study, we applied a rat model of short-term (within 7 days) abdominal aortic constriction (ACC)-related cardiac pressure overload but without significant morphological changes of myocardial hypertrophy, to systematically observe the changes of myocardial energy metabolism, potential benefits of TMZ pretreatment, and the roles of the NPY system involved.
Methods
The current study was performed in accordance with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996). The experiments protocols were approved ahead of performance by the Committee on Ethics of Animal Experiments of Guangzhou Medical University.
Animal models of cardiac pressure overload
Thirty-eight male Wistar rats, weighing 60 ± 10 g, were purchased from the Animal Experimental Center of the Southern Medical University. Rats were given free access to food and water as needed, housed in a stable space with the room temperature at 22 °C, and maintained on a 12-h light/dark cycle for 7 days before the ACC procedure.
These rats were randomized to three groups: (1) the sham group (
n =12), in which the surgical procedure of ACC was performed in the same way except for ligation of the abdominal aorta; (2) the AAC group (
n = 13), in which AAC was performed by ligation of the abdominal aorta 5 mm above the branching of the left renal artery to induce pressure overload of the heart, as described previously [
21,
22]; and (3) the TMZ group (
n = 13), in which the oral administration of TMZ (40 mg/kg/d, for 5 days) was performed before the surgical procedure for AAC-induced cardiac pressure overload. Briefly, all surgical procedures were performed after the rats were well anesthetized with intraperitoneal sodium pentobarbital (45 ml/kg). The abdominal aorta, proximal to the left renal artery was exposed and separated from the vena cava. A 2-0 silk suture was tied beside the aorta between the branches of the celiac and the anterior mesenteric arteries, using a blunt 24 G probe with the external diameter of 0.55 mm. After the above procedure, 1 ml saline was administered in the peritoneal cavity of each rat to replenish of the loss of the fluid during the procedure. Then, the abdominal wall was closed and the skin was sutured. The rats in the sham group received the same procedure expect that the silk suture around the aorta was pulled through and not tied. Ampicillin (50 mg/kg, i.m.) was injected once daily for 3 days after surgery to prevent infection, and all rats were placed on a warm pad for recovery after the surgery. Overall, one rat from the AAC group and one rat from the TMZ group died from acute heart failure after the surgical procedure. Twelve rats in each group survived the surgical procedures, and these rats within each group were further divided in to two groups (6 rats in each for the different observation periods of 2 and 7 days).
Echocardiographic examination
The cardiac systolic function and dimensions of the heart chambers were measured 2 and 7 days after surgery, according to the different observation groups, by two-dimensional echocardiography (Philips IE 33,) by an experienced investigator who was blinded to the treatment groups. Measurements were recorded as the mean of at least three consecutive cardiac cycles. The parameters recorded included interventricular septal thickness at end diastole (IVSd), left ventricular posterior wall thickness at end diastole (LVPWd), left ventricular end-diastolic dimension (LVEDD), left ventricular end-systolic dimension (LVESD), left ventricular factional shortening (LVFS), and left ventricular ejection fraction (LVEF).
Blood sampling and measurements of serum levels of NPY, MDA, and SOD activity
After echocardiologic examination, blood samples of rats from each group were obtained via intubation of the carotid artery. Immediately, blood samples were centrifuged at 12,000 g for 10 min at 4 °C, and then the supernatant was collected for measurement at −20 °C. Serum levels of NPY were measured using a commercially available enzyme immunoassay (EIA) kit (Bachem Laboratories, S-1145), and the experimental procedures were performed according to the manufacturers’ procedures. Similarly, the serum level of malonaldehyde (MDA) and serum superoxide dismutase (SOD) activity were evaluated using a suite of commercial kits, in accordance with the manufacturer’s instructions (Beyotime Institute of Biotechnology, Nanjing, China).
Determining the ratio of heart to body weight
After blood sampling, the rats were sacrificed, and hearts from rats in each group were excised. The heart weight (HW) was obtained as well as the weight of the left ventricle (LVW). Subsequently, the ratio of HW to body weight (BW) (HW/BW) was calculated. After measurement, the left ventricle sample was excised, rinsed with ice-cold saline, and dried with blotting paper. Next, the myocardial sample was placed in a microtube, flash frozen in liquid nitrogen, and finally stored at −80 °C for use in subsequent molecular biological experiments.
Measurement of cell surface area
Some myocardial tissue samples were fixed in 4% formaldehyde and embedded in paraffin. These tissues were then sectioned at 5 μm and stained with hematoxylin and eosin (HE). The cell surface area (CAS) of cardiomyocytes was then measured and analyzed with IPP6.0 Software (Leica, Germany). At least 100 cells were selected for analysis from each section of the myocardial tissue.
ADP/ATP ratio assay
To assess the energy status of the myocardial tissue, an ADP/ATP ratio assay was performed using the ApoSENSOR™ ADP/ATP Ratio Assay Kit (MBL, Nagoya, Japan) according to the manufacturer’s instructions.
Quantitative real-time PCR
Total RNA from myocardial tissue samples of rats in each group were extracted using Trizol reagent (Invitrogen Life Technologies, Thermo Fisher Scientific) and reverse transcribed into cDNA (Advantage RT-for-PCR kit; Clontech, Palo Alto, CA, USA) for subsequent analysis of the mRNA levels of myocardial hypertrophy-related genes including atrial natriuretic factor (ANF) and β myosin heavy chain (MHC-β), as well as NPY-1R, 2R, and 5R. Briefly, 1 μg of total RNA was reverse transcribed using 2 μg of random primers and Moloney murine leukemia virus reverse transcriptase according to the manufacturer’s protocol (Advantage RT-for-PCR kit). We used a One-Step system (Applied Biosystems, Thermo Fisher Scientific) to perform the real-time PCR analysis. The sequences of the primers for the genes analyzed are listed in Table
1. We applied the relative quantitation method to measure the expression levels of the genes of interest and analyzed the results of two independent experiments with triplicate sampling. For each experimental sample, a gene was considered as not expressed if amplification was not detected by threshold cycle Ct = 40. The results were expressed in arbitrary units of ΔCt, which represented targeted mRNA transcripts.
Table 1
Sequences of primers used for real-time RT-PCR analysis
NPY-1R-F | 5′GCTGTGGAACGTCATCAGCTA3′ |
NPY-1R-R | 5′TTGATAGATCACGAAGGGCAG3′ |
NPY-2R-F | 5′CCCGGATCTGGAGTAAGCTAAA3′ |
NPY-2R-R | 5′GTGGAGCACATCGCAATAATGT3′ |
NPY-5R-F | 5′CAATACAGCTGCTGCTCGGA3′ |
NPY-5R-R | 5′AAATCGTCTACGCTGCCTCTG3′ |
ANF-F | 5′GGGGGTAGGATTGACAGGAT3′ |
ANF-R | 5′CTCCAGGAGGGTATTCACCA3′ |
β-MHC-F | 5′CCTCGCAATATCAAGGGAAA3′ |
β-MHC-R | 5′TACAGGTGCATCAGCTCCAG3′ |
β-actin-F | 5′GACAGGATGCAGAAGGAGATTACT3′ |
β-actin-R | 5′TGATCCACATCTGCTGGAAGGT3′ |
Western blot analyses
Total proteins in myocardial tissue samples were ground and homogenized with a protein lysis solution (KeyGen BioTech, China). Briefly, myocardium form the LV was frozen in liquid nitrogen and then homogenized in phosphate-buffered saline (PBS) with a protease inhibitor cocktail (Roche, South San Francisco, CA, USA) using a tissue grinder. Homogenates were centrifuged at 14,000 rpm for 15 min at 4 °C. Nuclear and cytoplasmic proteins were separated according to the protocol described in the Nuclear and Cytoplasmic Extraction Kit (Thermo Scientific, USA). Supernatants were collected and assayed for total protein using the BCA method (KeyGen BioTech, China). Equal amounts of protein (125 μg) were resolved on 10% Tris-glycine sodium dodecyl sulphate (SDS) polyacrylamide gels. Protein bands were blotted onto nitrocellulose membranes. After blocking in 5% dried milk in Tris-buffered saline containing Tween-20 for 1 h at room temperature, membranes were incubated for 24 h at 4 °C with one of the following antibodies: anti-NPY-1R polyclonal antibody (Abnova, Taiwan, China), anti-NPY-2R (D42) pAb (Bioworld, USA), anti-NPY-5R (M264) pAb (Bioworld), and anti GAPDH (14C10) Rabbit mAb (Cell Signaling Technology, USA) to detect the proteins levels. Membranes were incubated for 1 h at room temperature with horseradish peroxidase-conjugated donkey anti-rabbit immunoglobulin (1:10,000; Santa Cruz Biotechnology). Peroxidase labeling was detected using the enhanced chemiluminescence Western blotting detection system (Amersham Pharmacia Biotech, Piscataway, NJ, USA) and analyzed by densitometry. The optical density values were normalized to that of GAPDH.
Statistical analyses
Statistical analyses were performed using SPSS 11.0 (SPSS Inc., Chicago, IL, USA). The results are reported as mean ± standard deviation (SD). Differences were analyzed for significance by one-way or two-way analysis of variance (ANOVA), and p < 0.05 was considered to be statistically significant.
Discussion
Our study in a rat model of AAC-induced cardiac pressure overload revealed that myocardial energy metabolic disorder was acutely induced within 1 week after AAC, which was before the typical morphologic changes of ventricular hypertrophy occurred. Moreover, disturbance of myocardial energy metabolism was accompanied by up-regulation of serum levels of oxidative stress markers and expression of myocardial fetal genes related to ventricular hypertrophy. Interestingly, the serum level of NPY and myocardial mRNA and protein levels of NPY-1R, 2R, and 5R also were increased within the acute phase of AAC-induced cardiac pressure overload. More importantly, pretreatment with TMZ could partly attenuate myocardial energy metabolic disturbance, decrease serum levels of oxidative stress markers, attenuate the induction of hypertrophy-related myocardial fetal genes, inhibit the up-regulation of serum NPY levels, and further increase the myocardial expression of NPY receptors. These results confirmed previous findings that energy metabolic disorders may occur prior to typical morphological changes of ventricular hypertrophy following cardiac pressure overload, suggesting a potential pathophysiologic process of metabolic remodeling before myocardial remodeling begins. Moreover, our results for the first time suggest that pretreatment with TMZ, a medication known for its benefits in cardiac energy metabolism, may attenuate the early energy metabolic disturbance of the myocardium during the acute phase of AAC-induced cardiac pressure overload. With respect to the mechanisms underlying the energy remodeling following AAC, we found that changes in serum NPY and myocardial NPY receptor levels may be involved, and TMZ may exert its beneficial effect via regulation of the NPY system. These results highlight the importance of cardiac metabolic remodeling as an early change in the myocardium before the presence of typical morphological ventricular remodeling and suggest that early treatment with TMZ may attenuate the disturbance.
Early studies revealed that disturbance of myocardial energy metabolism, which typically presents as an increased ratio of cellular ADP/ATP, plays important roles in the pathogenesis of CHF [
7,
9]. Although this has been proposed in early observations, whether metabolism remodeling occurs before or after the structural changes of myocardial hypertrophy has not been determined until recent years. A genomic study of pressure overload-induced cardiac hypertrophy in mice found early changes in the expression of metabolic genes before the hypertrophic phase of the myocardium [
12]. A later study with the same animal model using the quantitative positron emission tomography (PET) imaging also indicated that metabolic maladaptation precedes the onset of severe contractile dysfunction [
26]. A recent study in patients with hypertension provided more direct evidence supporting that metabolic remodeling is an early event that occurs before the onset of cardiac hypertrophy. With PET imaging, the investigators found that glucose metabolic remodeling is detectable in hypertensive patients before the development of ventricular hypertrophy [
26]. Our study, using an acute model of AAC-induced cardiac pressure overload generated before the presence of typical morphologic changes of ventricular hypertrophy (usually occurring at least 2 weeks after AAC), found that the ADP/ATP was significantly increased, suggesting an occurrence of energy metabolic disturbance before myocardial hypertrophy. Further studies are needed to determine whether strategies targeting early metabolic remodeling could prevent subsequent myocardial structural remodeling.
In view of the fact that TMZ may function to optimize myocardial energy metabolism, we further evaluated whether pretreatment with TMZ could attenuate the metabolism dysfunction during the acute phase of AAC. We found that TMZ not only significantly reversed the changes in myocardial ADP/ATP, but also reduced the serum levels of oxidative stress markers and the myocardial expression of up-regulated fetal genes related to hypertrophy. These results suggest that TMZ may effectively attenuate the metabolic disorder and therefore subsequently inhibit myocardial hypertrophy. Our results are supported by the findings of Liu et al., which showed that TMZ can inhibit myocardial fibrosis, a characterized feature of ventricular remodeling [
6], as well as the fact that application of TMZ in patients with CHF is associated with a significantly reduced LVEDD (−6.05 mm) and improved prognosis on the basis of optimized medical treatments for CHF [
27].
Previous studies have suggested that NPY is a potential regulator of energy homeostasis, but whether it is an important regulator of metabolic remodeling during the acute phase of AAC-induced cardiac pressure overload has not been determined. In this study, we found that serum NPY was immediately induced by 2 days after AAC, as was myocardial expression of the NPY receptors, suggesting that the NPY system may be involved in the process of early energy disturbance of the myocardium. Previous studies in patients with end stage renal disease indicated that elevated NPY is independently associated with LV concentric hypertrophy and systolic dysfunction [
14]. Moreover, an NPY-Y2R polymorphism may interact and influence such an association [
28], suggesting a potential role for the NPY system in the pathogenesis of ventricular hypertrophy. Similarly, a study in a rat model of CHF induced by aortocaval fistula indicated that increased NPY and its interactions with NPY receptors are involved in cardiac remodeling [
16]. A recent in vitro study found that NPY may damage the integrity of mitochondrial structure and therefore disrupts energy metabolism in cultured cardiomyocytes [
29]. The results of the above studies, in combination with ours, suggest that NPY and its receptors in the myocardium may mediate the early metabolic dysfunction in the acute phase of AAC-induced cardiac pressure overload, and TMZ may benefit the myocardium during this process by modulating the NPY system. As for the potential mechanisms underlying the potential regulatory effect of TMZ on the NPY system seen in our study, some previously published studies may provide some evidence. A previous study indicated that TMZ effectively inhibits myocardial fibrosis via attenuation of reactive oxygen species (ROS)-related myocardial injury [
20]. Interestingly, ROS have been suggested to be an upstream stimulator of the systematic NPY system in the neural tissue [
30,
31]. Therefore, TMZ may regulate the NPY system via its inhibitory effect of ROS. Specifically, the exact molecular mechanisms underlying the role of the NPY system in the pathogenesis of pressure overload-induced acute metabolic remodeling and the potential functions of different NPY receptors warrant further investigation.
Our study has limitations that should be considered when interpreting the results. First, because our study was designed to explore the temporal changes in myocardial metabolism remodeling following pressure-overload induced ventricular hypertrophy and the potential favorable effect of TMZ on myocardial metabolism remodeling, we are most interested in the changes in metabolism-related parameters before significant morphological myocardial hypertrophy. Therefore, we chose 7 days of AAC as the main exposure factor. The changes in myocardial metabolism remodeling and potential effects of TMZ after 7 days of AAC should be evaluated in further studies. Moreover, myocardial ADP/ATP, although an important index of myocardial energy status, was not sufficient to reflect the metabolic status of the myocardium following acute pressure overload. Changes in many other parameters related to myocardial energy metabolism, such as myocardial expression of fatty acid or glucose oxidation genes and insulin signaling genes, should be investigated. Finally, the serum level of NPY may not be necessarily correlated with their levels in myocardium. This is important, because we did observe that although NPY expression in the serum decreases with TMZ treatment, the expression of NPY-Rs in the myocardium actually increases, which in our point of view, may be a feedback response of myocardium to the decreased serum NPY. The results of our study could only provide associations between changes of NPY system and TMZ treatment, and the physiological influence and subsequent signaling pathways of changes of NPY system deserve further investigation.
Acknowledgements
ShiMing Liu, He provided the lab to complete this study, Guangzhou key laboratary of cardiovascular disease, Guangzhou Institute of Cardiovascular Disease. Luning Zhao, who supplied the service for the lab. Qicai Liu, who supplied the advice for our experiment technique.