TTBK2 circular RNA promotes glioma malignancy by regulating miR-217/HNF1β/Derlin-1 pathway

By scanning TTBK2 genome and circBase, we found that circ-TTBK2 contained only exons and was generated from exon 3, exon 4, exon 5, and exon 6 from TTBK2 gene (Fig. 1d). The expression of circ-TTBK2 in glioma tissues and cells was determined by fluorescence in situ hybridization (FISH) and quantitative real-time PCR (qRT-PCR). Circ-TTBK2 was located in the cytoplasm and was significantly upregulated in glioma tissues compared with normal brain tissues (Fig. 1a). Circ-TTBK2 expression was significantly increased in glioma tissues and cells (Fig. 1b, c). And the expression of circ-TTBK2 was positively correlated with the pathological grades of glioma. However, linear TTBK2 expression was not changed in glioma tissues and cells (Additional file 1: Figure S1a, b). Furthermore, RNase R was used to confirm the circular form RNA was detected. As expected, circ-TTBK2 was resistant to RNase R treatment, while linear TTBK2 was significantly reduced in cells treated with RNase R (Additional file 1: Figure S1c, d). These results showed that circ-TTBK2 dysregulation might contribute to the malignant progression of glioma cells. Stable circ-TTBK2 overexpression and inhibition in glioma cells were established to investigate the role of circ-TTBK2. To confirm the circular form of TTBK2 was force-expressed instead of the linear form, we examined transfection efficiency and the TTBK2 expression after transfection of circ-TTBK2. As expected, circ-TTBK2 expression was significantly higher in the circ-TTBK2 (+) group, while its expression was significantly lower in the circ-TTBK2 (−) group (Additional file 1: Figure S1e). Also, no significant change of TTBK2 neither in the circ-TTBK2 (+) group nor circ-TTBK2 (−) group (Additional file 2: Figure S2a). We also examined circ-TTBK2 expression in cells treated with sh-TTBK2 (transfection efficiency of sh-TTBK2 data was shown in Additional file 1: Figure S1f). The results showed that sh-TTBK2 did not influence circ-TTBK2 expression (Additional file 2: Figure S2b). Inhibition of circ-TTBK2 led to a significant decrease in the proliferation compared with the circ-TTBK2 (−)-NC group (Fig. 1e). Transwell assay was used to measure whether circ-TTBK2 dysregulation could affect the migration and invasion of glioma cells. Cell number in the circ-TTBK2 (+) group was obviously increased compared with that in the circ-TTBK2 (+)-NC group (Fig. 1f). Moreover, overexpressed circ-TTBK2 hindered apoptosis of glioma cells compared with the circ-TTBK2 (+)-NC group (Fig. 1g).

MiR-217 expression levels in glioma tissues and cells were analyzed by FISH and qRT-PCR. MiR-217 expression was negatively correlated with the pathological grades of glioma, and similarly with circ-TTBK2, miR-217 was also located in the cytoplasm (Fig. 2a, b). Meanwhile, the expression of miR-217 was lower in U87 and U251 glioma cells than that in normal human astrocytes (Fig. 2c). After transfection, we first examined the transfection efficiency (Additional file 1: Figure S1g). Restoration of miR-217 significantly inhibited glioma cell proliferation compared with the pre-NC group (Fig. 2d). Also, overexpressed miR-217 decreased migrating and invading cell numbers compared with that in the pre-NC group (Fig. 2e). MiR-217 overexpression promoted apoptosis of glioma cells compared with the pre-NC group (Fig. 2f). This inferred that miR-217 might function as a tumor-suppressor in glioma cells.

As previously mentioned, circRNAs could function as miRNAs sponge, and miRNAs could target circRNAs in a sequence-specific manner. We assumed that circ-TTBK2 might harbor a binding site of miR-217 using bioinformatics database (Starbase). To verify our prediction, dual-luciferase gene reporter assay was conducted. The luciferase activity in the circ-TTBK2-Wt+miR-217 group was significantly decreased than that in the circ-TTBK2-Wt+miR-217-NC group (Fig. 3b), while the luciferase activity in the circ-TTBK2-Mut+miR-217 group was not changed. Two putative binding sites were identified in linear TTBK2. However, the luciferase assays TTBK2-Wt+miR-217 did not influence the luciferase activity, while TTBK2-Wt1+miR-217 decreased the luciferase activity (Additional file 2: Figure S2e, f). Further, we measured miR-217 expression in the circ-TTBK2 (+) and circ-TTBK2 (−) groups by qRT-PCR. MiR-217 expression was significantly decreased in the circ-TTBK2 (+) group, while miR-217 expression was significantly increased in the circ-TTBK2 (-) group (Fig. 3c). Similarly, the expression of circ-TTBK2 was significantly restored in anti-miR-217 group (Fig. 3d). Also, we found that overexpression or downregulation of miR-217 did not affect the expression of TTBK2 (Additional file 2: Figure S2c).

RNA-binding protein immunoprecipitation (RIP) assay was conducted to investigate whether circ-TTBK2 and miR-217 were involved in the expected RNA-induced silencing complex (RISC) complex. RNA levels in immunoprecipitates were detected by qRT-PCR. The relative enrichment levels of circ-TTBK2 and miR-217 were both increased in the anti-Ago2 group than those in the anti-normal group. In the anti-miR-217 group, the relative enrichment levels of circ-TTBK2 and miR-217 immunoprecipitated with Ago2 were lower than those in the control group, respectively (Fig. 3e–h). In summary, these results indicated that circ-TTBK2 reduced miR-217 expression in RISC manner, and there might be a reciprocal repression feedback loop between circ-TTBK2 and miR-217.

Having confirmed that miR-217 expression was negatively regulated by circ-TTBK2 expression, we further investigated whether miR-217 reversed circ-TTBK2-mediated promotion of glioma cells progression. The proliferation of glioma cells in the circ-TTBK2 (+)+miR-217 (−) group was significantly increased than that in the circ-TTBK2 (+)+miR-217 (+) group (Fig. 3i). Further, circ-TTBK2 introduction combined with miR-217 inhibition led to an increased cell number compared with circ-TTBK2 (+)+miR-217 (+) (Fig. 3j). Moreover, glioma cells treated with circ-TTBK2 (−)+miR-217 (+) exhibited higher ratio of apoptosis compared with cells treated with circ-TTBK2 (−)+miR-217 (−) (Fig. 3k). These results clarified that circ-TTBK2 promoted glioma cells malignant progression via reducing miR-217 expression.

Using bioinformatics databases (TargetScan, miRanda, and RNAhybrid), HNF1β was identified as a direct target of miR-217. The luciferase activity in the HNF1β-Wt+miR-217 group was significantly attenuated than that in the HNF1β-Wt+miR-217-NC group, while the luciferase activity in the HNF1β-Mut+miR-217 group was not affected (Fig. 4b). Accumulated evidence showed that HNF1β was upregulated in various tumors and exerted key roles in molecular events in cells. HNF1β was located to the nucleus and was positively correlated with the progression of glioma pathological grades (Fig. 4c). Furthermore, protein levels of HNF1β were significantly higher in low- and high-grade glioma tissues than those in normal brain tissues (Fig. 4d). In addition, HNF1β protein levels were upregulated in U87 and U251 cells compared with normal human astrocytes. Moreover, qRT-PCR and western blot were used to determine the expressions of HNF1β mRNA and protein in glioma cells treated with circ-TTBK2 inhibition and/or miR-217 overexpression. mRNA and protein expressions of HNF1β were robustly reduced than that in the circ-TTBK2 (−)-NC group (Fig. 4e). While mRNA and protein expressions of HNF1β were significantly decreased in the pre-miR-217 group compared with those in the pre-NC group (Fig. 4f). Moreover, mRNA and protein expressions of HNF1β were obviously upregulated in the circ-TTBK2 (+)+miR-217 (−) group than those in the circ-TTBK2 (+)+miR-217 (+) group (Fig. 4g).

Having confirmed that HNF1β was upregulated in glioma tissues and cells, effects of HNF1β overexpression or downregulation on glioma cells were investigated. The transfection efficiency of HNF1β was confirmed (Additional fie 3: Figure S1h). Cell proliferation in the HNF1β (+) group was significantly upregulated versus that in HNF1β (+)-NC group (Fig. 5a). Moreover, transwell assays showed that the migrating and invading cell numbers in the HNF1β (−) group were reduced compared with those in the HNF1β (-)-NC group (Fig. 5b). Flow cytometry analysis was used to measure whether HNF1β affected the apoptosis of glioma cells. Cells treated with HNF1β (+) exhibited lower apoptosis ratio than that in the HNF1β (+)-NC group (Fig. 5c).

HNF1β specifically binds to the “GTTAAT box” which is presented in promoters of target genes [28]. According to DBTSS HOME database, promoter sequence of Derlin-1 was set. By scanning the DNA sequence in the 2000 bp region upstream and 200 bp region downstream of the transcription start site (TSS), two putative HNF1β binding sites were identified. Chromatin immunoprecipitation (ChIP) assays were performed to determine whether HNF1β was directly associated with Derlin-1 promoters in U87 and U251 cells. As a negative control, 1000 bp upstream region of the putative HNF1β binding site was amplied using PCR, which was not expected to associate with HNF1β. There was a direct association of HNF1β with putative binding site 2 of Derlin-1 (Fig. 5d). And there were no interactions of HNF1β with the control region or putative binding site 1.

Further, Derlin-1 protein expression was detected in U87 and U251 cells treated with HNF1β (+) or HNF1β (-). Overexpressed HNF1β significantly increased Derlin-1 protein expression than that in the HNF1β (+)-NC group (Fig. 5e). These results demonstrated that HNF1β acted as an oncogene in glioma cells and could upregulate Derlin-1 expression by directly activating promoter of Derlin-1.

Since Derlin-1 could be upregulated by HNF1β, we first examined the expression and function of Derlin-1 in glioma tissues and cells. Immunohistochemistry (IHC) results showed that Derlin-1 protein was located in cytoplasm and was positively correlated with the progression of glioma pathological grades (Fig. 6a). Moreover, Derlin-1 expression levels were obviously higher in low- and high-grade glioma tissues than in normal brain tissues. Similarly, Derlin-1 had a higher expression levels in U87 and U251 cells than those in human normal astrocytes (Fig. 6b). Further, effects of Derlin-1 on glioma cell biological behavior were determined. The transfection efficiency of Derlin-1 was determined by western blot (Additional file 1: Figure S1i). Overexpression of Derlin-1 led to an increased cell proliferation than that in the Derlin-1 (+)-NC group (Fig. 6c). Migrating and invading cells in the Derlin-1 (+) group were obviously increased compared with the Derlin-1 (+)-NC group (Fig. 6d). The apoptosis of cells treated with Derlin-1 (+) was impaired versus Derlin-1 (+)-NC group (Fig. 6e). These results showed that Derlin-1 functioned as an oncogene in glioma cells.

The above results showed that circ-TTBK2 modulated HNF1β expression via regulating miR-217 expression, and HNF1β increased Derlin-1 expression by activating the promoter of Derlin-1. To clarify whether HNF1β reversed miR-217-induced impairment of malignant progression of glioma cells, we measured the biological behavior of glioma cells that stably expressed miR-217+HNF1β (non-3′UTR). Proliferation of glioma cells in the miR-217+HNF1β (non-3′UTR) group was significantly restored than that in the miR-217+HNF1β group (Fig. 7a). Furthermore, numbers of migrating and invading cells in the miR-217+HNF1β (non-3′UTR) group were increased versus those in the miR-217+HNF1β group (Fig. 7b). Moreover, glioma cells treated with miR-217+HNF1β (non-3′UTR) showed a lower apoptosis ratio than cells treated with miR-217+HNF1β (Fig. 7c).

As previously reported, Derlin-1 exerted oncogenic function by activating PI3K/AKT and ERK pathways; we next examined the expression of proteins involved in these signaling pathways. Derlin-1, p-PI3K, p-AKT, p-ERK, and p-MEK1/2 expression levels were significantly restored in the miR-217+HNF1β (non-3′UTR) group than those in the miR-217+HNF1β group (Fig. 7d).

The in vivo experiment showed downregulated circ-TTBK2 or overexpressed miR-217 (Fig. 8b). Remarkably, knockdown of circ-TTBK2 combined with miR-217 overexpression resulted in the smallest tumor volume (Fig. 8b). The survival analysis demonstrated that in circ-TTBK2 inhibition, miR-217 reintroduction led to longer survival than the control group. And circ-TTBK2 inhibition combined with miR-217 overexpression produced the longest survival period (Fig. 8b).

For determination of circ-TTBK2 and miR-217, clinical specimens were divided into five group: NBTs (normal brain tissues) (n = 11), grade I (n = 19), grade II (n = 19), grade III (n = 19), and grade IV (n = 19). For determination of HNF1β and Derlin-1, clinical specimens were divided into three groups: NBTs (n = 8), grade I–II glioma group (low-grade glioma tissues) (n = 16), and grade III–IV glioma group (high-grade glioma tissues) (n = 16) based on the WHO 2007 classification of tumors by two experienced neuropathologists. Normal brain tissues (NBTs) were collected from patients’ fresh autopsy material (donation from individuals who died in traffic accident and confirmed to be free of any prior pathologically detectable conditions) were used as negative control.

Human U87 and U251 glioma cell lines and human embryonic kidney (HEK) 293T cells were purchased from the Shanghai Institutes for Biological Sciences Cell Resource Center. Primary normal human astrocytes (NHA) were purchased from the Sciencell Research Laboratories (Carlsbad, CA, USA). For details, see Additional file 3.

For identification of circ-TTBK2 and miR-217 rearrangement in glioma tissues, circ-TTBK2 probe (green-labeled, Biosense, Guangzhou, China) (5′ CAATCTTTCTCAATGGTCTGACGTCA 3′) and miR-217 probe (red-labeled, Exiqon, Copenhagen, Denmark) were used. In brief, slides were treated with PCR-grade proteinase-K (Roche Diagnostics, Mannheim, Germany) blocked after with prehybridization buffer (3% BSA in 4 × saline-sodium citrate, SSC). The hybridization mix was prepared with circ-TTBK2 probe or miR-217 probe in hybridization solution. Then the slides was washed with washing buffer; the sections were stained with anti-digoxin rhodamine conjugate (1:100, Exon Biotech Inc, Guangzhou, China) at 37 °C for 1 h away from light. The sections were stained with 4′,6-diamidino-2-phenylindole (DAPI, Beyotime, China) for nuclear staining subsequently. All fluorescence images (100×) were captured using a fluorescence microscope (Leica, Germany).

Trizol reagent (Life Technologies Corporation, Carlsbad, CA, USA) was used to extract total RNA from the clinical tissues and NHA, U87, and U251 cells. See also Additional file 3.

Western blot was performed as previously described [48]. See Additional file 3 for details and antibodies used.

Cell transfections were performed as previously described [48]. See also Additional file 3.

Cell Counting Kit-8 assay (CCK-8, Dojin, Japan) was used to investigate glioma cell proliferation. Also, see Additional file 3.

Twenty-four-well chambers with 8-μm pore size (Corning, USA) was used for migration and invasion determination of U87 and U251 cells in vitro. For details, see Additional file 3.

Cell apoptosis was determined by Annexin V-PE/7AAD staining (Southern Biotech, Birmingham, AL, USA). See also Additional file 3.

Dual-luciferase assays were performed as previously described [48]. See Additional file 3.

RNA immunoprecipitation was performed as previously described [48]. In brief, glioma cells were lysed by a complete RNA lysis buffer from an EZ-Magna RIP kit (Millipore, Billerica, MA) according to the manufacturer’s protocol. See also Additional file 3.

The slides of human glioma tissue samples (4 μm thick) were dewaxed, rehydrated, and incubated in 0.3% H₂O₂ for 10 min to inhibit endogenous peroxidase activity before blocking with 10% normal goat serum (MXB, Fuzhou, China) for 30 min and incubating overnight at 4 °C with rabbit polyclonal antibody against HNF1β (1:150, SAB, Chicago, IL). Slides were washed with PBS three times and then incubated with biotinylated rabbit anti-rabbit IgG for 1 h at room temperature. After incubation with avidinbiotin-peroxidase complex for 10 min, samples were stained with 3, 3′-diaminobenzidine. Slides were imaged under a light microscope (Olympus, Japan) at 100× magnification.

ChIP assay was conducted with Simple ChIP Enzymatic Chromatin IP Kit (Cell signaling Technology, Danvers, Massachusetts, USA) according to the manufacturer’s instruction as previously described [49]. In brief, glioma cells were fixed with 1% formaldehyde and collected in lysis buffer. Two percent aliquots of lysates were used as an input control and the remaining lysates were immunoprecipitated with normal rabbit IgG or HNF1β antibody. Immunoprecipitated DNA was amplified by PCR using their specific primers (as Additional file 4).

The tumor xenograft experiment was performed as previously described [48]. Stable expression U87 and U251 cells were used for in vivo study. For details, see also Additional file 3.

Data are presented as mean + standard deviation (SD). All statistical analyses were evaluated by SPSS 18.0 statistical software with the Student’s t test or one-way analysis of variance ANOVA. Differences were considered to be significant when P < 0.05. Corresponding significance levels were indicated in the figures.