TWIST1, A novel androgen-regulated gene, is a target for NKX3-1 in prostate cancer cells

The expression of TWIST1 mRNA increased 4-fold in LNCaP cells incubated with 0.5 nM R1881 for 72 hours relative to untreated cells (ctr.) and reached more than a 10-fold induction at 10 nM R1881 (Figure1A). Corresponding regulation of TWIST1 mRNA was also demonstrated in RWPE-1, a benign prostate cell line (data not shown). Up-regulation of TWIST1 expression was also observed at the protein level in LNCaP cells stimulated with increasing concentrations of R1881 (Figure1B).

To determine if AR mediates the effect of androgens on TWIST1 expression, LNCaP cells were transfected with a siRNA targeting AR (AR) or a non-silencing siRNA as control (ctr.). Down-regulation of AR expression (Figure2, lower panel) reduced the mRNA level of TWIST1 by 80% relative to control (Figure2A, upper panel) supporting the concept that TWIST1 is an AR target gene in LNCaP cells. Down-regulation of AR also reduced the level of NKX3-1 (Figure2, lower panel).

In an effort to find binding sites for AR (ARE) or androgen-regulated transcription factors, we examined the human TWIST1 genomic sequence using MatInspector[11]. Three putative binding sites for NKX3-1 designated BS1, BS2 and BS3 (Figure3A) were identified. In addition we observed several potential AREs. Chromatin immunopreciptation analyses (ChIP) using chromatin isolated from LNCaP cells stimulate with 10 nM R1881 (+R1881) for 24 hours or unstimulated cells as control (−R1881) resulted in amplification of BS3. We were not able to detect binding to either BS1 or BS2 (data not shown, n=3). A 5-fold increase in NKX3-1 binding activity to the TWIST1 promoter upon R1881 stimulation was observed (Figure3B). Additionally, PCR amplification of non-targeted DNA (genomic contig of chromosome 12) was used as negative control (data not shown).

Next, a reporter construct containing 5kb of the mouse TWIST1 promoter (pGL3-TWIST-Luc) was co-transfected with an NKX3-1 expression vector. Over-expression of NKX3-1 reduced the promoter activity of TWIST1 by 50%, indicating that NKX3-1 represses the TWIST1 promoter activity (Figure3C). No effect of NKX3-1 over-expression was observed on cells transfected with pGL3 lacking the TWIST1 promoter (pGL3).

Finally, the effect of NKX3-1 on endogenous TWIST1 mRNA level was studied by transfecting LNCaP cells with siRNA targeting NKX3-1. A 5-fold increase in TWIST1 mRNA level was observed when NKX3-1 expression was down-regulated (Figure3D). The impact of R1881 stimulation, NKX3-1 overexpression and siRNA on NKX3-1 expression in LNCaP cells are summarized in Figure3E. Both R1881 stimulation as well as overexpression of NKX3-1 led to a significant increase in NKX3-1 expression, while siRNA against NKX3-1 reduced the expression markedly.

LNCaP and RWPE-1 cells were purchased from ATCC (Rockville, MD) and cultured in RPMI 1640 medium containing 10% fetal calf serum (FCS) or Keratinocyte-SFM medium from Invitrogen (Carlsbad, CA, USA) supplemented with 2.5 μg Epidermal Growth Factor (EGF) and 25 mg Bovine Pituitary Extract (BPE), respectively, and stimulation with synthetic androgen R1881 was performed as previously described[19].

Total RNA was isolated using Trizol™ from Invitrogen (Carlsbad, CA), and 100 ng of total RNA was used in a one-step RT-PCR reaction (QIAGEN Quantitect SYBR Green RT-PCR kit) that was performed using an MJ Research DNA Engine Opticon Continuous Fluorescence Detection System (MJ Research Inc., Waltham, MA). RT-PCR cycles were performed as previously described by Ramberg et al.[20]. G6PD was used for normalization. The ΔΔCt formula was used as described in the protocol from Applied Biosystems (Foster City, CA). All the PCR-products were verified by sequencing.

G6PD (NM_000402); Left: tgcatgagccagataggc and right: acagggaggagatgtggttg, NKX3-1 (NM_006167); Left: gagacgctggcagagacc and right: ttctgcggctgcttaggg, AR (NM_000044); Left: gcgatccttcaccaatgtca and right: cattcggacacactggctgt, TWIST1 (NM_000474); Left: cttctcggtctggaggatgg and right: ctccttctctggaaacaatgaca.

Protein extraction followed by Western blot analysis was performed as previously described by Kvissel et al.[19]. Primary antibodies used were the following: anti-TWIST1 (H-81, sc-15393), anti-AR (N-20, sc-816), both from Santa Cruz Biotechnology (Santa Cruz, CA). The anti-NKX3-1 antibody was kindly provided by Professor Fahri Saatcioglu at Department of Molecular Biosciences, University of Oslo, Norway. For loading control we used anti-PRKAR1A (610609, BD Transduction Laboratories) or anti-α-tubulin antibody from Sigma (St. Louis, MO).

LNCaP cells were cultured at 300.000 cells per 6-well dish and transfected with a luciferase reporter plasmid including 5 kb of the mouse TWIST1 promoter- pGL3-TWIST (kindly provided by Steven Kendall and Carlotta Glackin, Beckman Research Institute, City of Hope, USA) or pGL3 as negative control using Lipofectamine 2000 (INVT11668019, Invitrogen) according to the manufactures protocol. For overexpression of NKX3-1, a commercial transfection-ready TRUE clone (sc116287, ORIGENE, Rockville, MD, USA) was purchased. Cells were co-transfected with pCMV β-gal (Clontech) to monitor the transfection efficiency. After 72 hours, luciferase and β-galactosidase activity were measured as previously described[20].

ChIP assays were carried out according to the QuickChIP protocol (Imgenex, San Diego, CA) with a crosslinking time of 10 minutes using 1% formaldehyde for the LNCaP cells and using an anti human NKX3-1 monoclonal antibody (cat.no 35–9700, Zymed Laboratories Inc., San Fransisco, CA). Following DNA purification (QuickChIP DNA Purification kit), sqPCR was performed using QIAGEN Quantitect SYBR Green RT-PCR kit with the following primers:

NKX3-1 BS3; Left: cccagttacacttggatgcagta and right: tcccctggtgagatcatacatac. Negative control primers from human chromosome 12 genomic contig; Left: atggttgccactggggatct and right: tgccaaagcctaggggaaga. Chromatin immunoprecipitated with IgG was used as a negative control. The ΔΔCt formula was used as described in the protocol from Applied Biosystems (Foster City, CA).