Background
Cervical cancer is the third most commonly diagnosed gynecologic cancer and the fourth major cause of death-related cancer in females worldwide, accounting for 9 % of the total new diagnoses and 8 % of the total cancer-associated deaths among females in 2008 [
1]. In China, there were 87,982 new patients diagnosed as cervical cancer and 23,375 deaths in 2011, and this disease has become one of the heaviest health burdens among Chinese women [
2]. The major cause of cervical cancer refers to persistent human papillomavirus (HPV) infection, which is detected in 99 % of patients with cervical tumors [
3]. Interestingly, cervical cancer develops in a multi-step process that implicates the transformation of normal cervical epithelium into preneoplastic cervical intraepithelial neoplasia (CIN) that ultimately progress to invasive cervical cancer cells [
4]. Accounting for 70 ~ 80 % of cervical cancers, cervical squamous cell carcinoma (CSCC) consists of cells which are recognizably squamous but different from each other in term of growth pattern or cytological morphology [
3]. The latest study reported there is no apparent symptom of early cervical cancer, while locally advanced disease may result in abnormal vaginal bleeding, pelvic pain, and dyspareunia [
3]. Clearly, an improved understanding of the gene or molecular mechanisms via which pre-invasive lesions have the capability of invading the cervical stroma and eventually metastasis would exert significantly clinical influence.
UHRF1 [ubiquitin-like, containing plant homeodomain (PHD) and really interesting new gene (RING) finger domains 1], also known as ICBP90 or Np95, is a member of UHRF family and encode a 95-kDa nuclear protein of 793 amino acids, with a single open reading frame (ORF) [
5]. It contains an N-terminal ubiquitylation-like domain, PHD, a SRA (SET and RING-associated) domain and a RING finger motif domain [
6]. During the recent years, UHRF1 has received great concerns as a novel diagnostic marker of cancer [
7]. UHRF1 is featured by a SRA domain (Set and Ring Associated) only found in the UHRF family, and up-regulation of UHRF1 has been observed in a variety of cancers, such as lung cancer and bladder cancer [
8,
9]. Also, previous studies demonstrated that the expression level of UHRF1 is closely associated with clinical stage, metastatic and prognostic of bladder cancer and lung cancer [
7,
9]. Furthermore, over-expression of UHRF1 is shown to contribute to worse survival of laryngeal squamous cell carcinoma (LSCC) and serve as an independent prognostic factor of LSCC [
10]. Therefore, the present study aims at exploring the effects of silent
UHRF1 on proliferation and apoptosis of human CSCC Caski cells and to further study the related mechanism of cell apoptosis.
Methods
Tissue collection and cell culture
A total of 47 cases of CSCC tissues and 40 cases of normal cervical tissues resected from benign tumors were collected from Harbin Medical University Cancer Hospital from June 2013 to December 2015. The normal tissues were classified as the Control group and the CSCC tissues were as the CSCC group. The CSCC cell lines CaSki were obtained from cell bank of Chinese Academy of Sciences. The cells were cultured in 90 % RPMI1640 (Gibco BRL Co. Led., New York, USA) and 10 % Fetal bovine serum (FBS) (Gibco BRL Life Technologies Inc., Grand Island, New York, USA). UHRF1 siRNA and control siRNA were purchased from Santa Cruz (sc-76805, Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA). When the cells merged to 50 %, lentivirus diluted by medium solution were added for transfection. After 24 h, the virus was aspirated and normal solution was replaced. The cells were classified into 3 groups: the Blank group (CaSki cells untransfected), the negative control (NC) group (CaSki cells transfected with control siRNA) and the UHRF1 Silence group (CaSki cells transfected with UHRF1 siRNA).
Quantificational real-time polymerase chain reaction (qRT-PCR)
qRT-PCR was used for the detection of
UHRF1 expression level in 47 cases of CSCC tissues, 40 normal cervical tissues and differenttransfected CaSki cells (Blank group, NC group, and UHRF1 Silence group). The tissues were washed 3 times with phosphate buffered saline (PBS). After 72-h culture, the cells were washed again with PBS for 3 times. The total RNA extraction was according to RNAiso Plus reagent kit (Takara Bio Inc., Dalian, China) and reverse transcription was operated in conformity with PrimeScript RT reagent kit (Takara Bio Inc., Dalian, China). The SteponePlus PCR (Applied Biosystem, Foster City, CA, USA) system applied for fluorescence quantitative test was following: cDNA solution 1.6 ul, 2X SYBR GREEN Taq PCR MIX (Takara Bio Inc., Dalian, China) 5 ul, PCR upstream and downstream primers (10 uM, each 0.2 ul) and deuterium depleted water (DDW) 3 ul. Reaction condition was initial denaturation at 95 °C for 5 min, 95 °C 10 s, 58 °C 10 s, and 72 °C for 10 s, 60 cycles and extension at 72 °C for 10 min. The detection gene was
UHRF1 (Gene ID 29128) and internal reference gene was β-actin (Gene ID 11461). The primers (Invitrogen Biotechnology Co. Shanghai, China) were listed in Table
1. The experiment was repeated 3 times, and the average values were obtained.
Table 1
PCR primer sequences
UHRF1 | Forward: 5’- ACCAAGGTGGAGCCCTACAG -3’ |
Reverse: 5’- CACTTTACTCAGGAACAACTGGAAC -3’ |
β-actin | Forward: 5’-CATCACGTACCAAACTTCAA-3’ |
Reverse: 5’-CATCACAGTACCGGATTGC-3’ |
Western blot assay
After transfection of 3 days, the cells were washed, added with Radio immunoprecipitation assay (RIPA) lysis buffer and protease inhibitor (Sigma, St. Louis, USA) for homogenate, and centrifuged at 12,000 × g at 4 °C for 10 min. After bicinchoninic acid (BCA) (Boi-rad Laboratories, Inc, Hercules, California, USA) detection of the protein concentration, the supernatant was reserved at −80 °C. Western blot applied 10 % sodium dodecyl sulfate polyacrylamide gel electropheresis (SDS-PAGE) gel. Each well was added with 20 ug protein samples. The primary anti-bodies were Rabbit anti-human-UHRF1, Caspase3, Caspase8, Caspase9, Bax and Bcl-2 (Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) and the cells were kept overnight at 4 °C. The secondary anti-body was POD-conjugated goat anti-rabbit (1:5000) and the cells were maintained at room temperature for 30 min, which was added with horseradish peroxidase (HRP) (Boi-rad Laboratories, Inc, Hercules, California, USA). Image Quant 350 and Image Quant TL-1 (GE Healthcare, Fairfield, CT, USA) were applied to analyze the results. The reference gene was β-actin. The experiment was repeated 3 times, and the average values were obtained.
CCK-8 for cell proliferation
The CaSki cells were cultured in 96-hole plate at density of 1 × 105 cells. Each group was designed with 4 duplicated wells. After 24-h culture, the cell proliferation was examined with Cell Counting Kit-8 (Thermo, USA) at 24, 48, 72 and 96 h. The procedures were as follows: After the aspiration of the original medium, the cells were added with CCK-8 solution. The medium was detected at 450 nm absorbance after 2-h culture. The experiment was repeated 3 times, and the average values were obtained.
Flow cytometer
Propidium iodide (PI) was applied to analyze cell cycle, and Annexin V-FITC and PI (Abcam Co., Cambridge, MA, USA) were used for analysis of cell apoptosis rate. The CaSki cells were washed twice with PBS and added with 0.25 % pancreatin for digestion. After adjusting the density to 105/ml, the cells were incubated with fluorescent antibody at room temperature for 30 min. The cells were precipitated and suspended after 200 × g centrifuging. Finally, the flow cytometer (BD Bioscience, San Jose, CA, USA) was applied for analysis. The experiment was repeated 3 times, and the average values were obtained.
Establishment of tumor-bearing nude mice model
A total of 24 female nude mice of 4–6 weeks were (purchased from Shanghai Biomodel Organism Science & Technology Development Co., Ltd.) fed under sun protection factor (SPF) environment. The nude mice were injected with the CaSki cells in aseptic condition, and then were assigned into 3 groups (each group with 8 mice): the Blank group (injected with untransfected CaSki cell), the NC group (injected with CaSki cells transfecting control siRNA) and the UHRF1 Silence group (injected with CaSki cells transfecting UHRF1 siRNA). The cell number injected was 1 × 106 and the volume was 100 ul. Ten days later, the maximum and minimum diameter of the tumor was measured with vernier caliper every 5 days. The tumor size = maximum diameter × minimum diameter2. Thirty days later, the tumor tissue on the back of nude mice were taken out and measured the weight. The tissues were fixed with 10 % formaldehyde. After dehydration, the tissues were embedded with paraffin for staining analysis.
Immunohistochemical staining
The tissues were washed with PBS for 3 times and fixed with 4 % paraformaldehyde. After embedding with paraffin and slicing, the tissues were performed immunohistochemical analysis. Firstly, the paraffin sections were dewaxed and rehydrated and treated with 3 % hydrogen peroxide for 15 min to block endogenous peroxidase activity. Then the tissues were heated with vapor for 30 min to restore antigen. The tissues were later blocked in PBS chamber containing 1 % bovine serum albumin (BSA). The primary anti-body was added for incubation at room temperature for 30 min and then maintained overnight at 4 °C. The primary antibody was rabbit polyclonal anti-proliferating cell nuclear antigen (PCNA) and UHRF1 (Abcam Co., Cambridge, MA, USA) and the slicess were kept overnight at 4 °C. The secondary antibody was POD-conjugated goat anti-rabbit (1 : 5000) and the slices were maintained at room temperature for 30 min, which was added with horseradish peroxidase (HRP) (Boi-rad Laboratories, Inc, Hercules, California, USA). The stained slices were pictured at 400 × amplification.
Statistical methods
Data analysis was based upon the statistical package for the social sciences (SPSS) version 20.0 (SPSS Inc.; Chicago, IL, USA). Continuous data were displayed as mean ± standard deviation, and differences between two groups were examined by t test. And the differences among multiple groups were analyzed with repeated measurement of analysis of variance (ANOVA). Significance was illustrated by P < 0.05.
Discussion
As a leading cause of mortality in women, cervical cancer still exhibits unclear molecular mechanisms [
4]. Despite of the significant advances including surgical techniques, radiotherapy and chemotherapy, there are still nearly 30 % of patients diagnosed with invasive cervical carcinoma that passes away due to residual or recurrent disease [
11]. However, increasing evidence indicates that the expression or overexpression of UHRF1 is associated with a poor prognosis in a variety of cancer types [
7,
9]. Therefore, the aim of the current study was to evaluate the potential association between UHRF1 and CSCC. Consequently, UHRF1 is over-expressed in CSCC and silencing UHRF1 inhibits proliferation and promotes apopyosis of the CSCC CaSKi cells.
In this study, we firstly assessed the expression level of UHRF1 in the CSCC tissues. We found that UHRF1 mRNA and protein were highly regulated in CSCC tissues in comparison to the normal cervical tissue, suggesting that UHRF1 participates in the development and evolvement of CSCC. Similarly, Yan et al. supported that UHRF1 has been considered to be an oncogene which is involved in tumorigenesis in ovarian cancer [
6]. To our knowledge, UHRF1 can form a complex with DNA methyltransferase 1 (DNMT1) as well as histone deacetylase 1 (HDAC1) and can restrict the expression of some tumor suppressor genes through its SRA domain, such as p16 INK4A, hMLH1, BRCA1 and RB1 [
8]. According to former studies, high expression of UHRF1 was also detected in lung cancer cells, particularly in prostate cancer and breast cancer and it seem that the intensity of its over-expression was linked to the clinical stage of the cancer [
12,
13]. UHRF1 has recently been shown to play an important role in DNA methylation maintenance [
14]. It has the ability to trigger the collection of DNMT and histone deacetylace-1 by binding hemimethylated DNA via its SET- and RING-associated domain [
15‐
17]. Krifa et al. and Alhosin et al. have proved that UHRF1, as an oncogene protein, has the potential to suppress tumor suppressor gene expression such as p16INK4A, hMLH1, BRCA1 along with RB1 through binding to methylated DNA and recruiting the DNMT1 [
8,
18]. Also, several studies indicate that over-expression of UHRF1 plays a part in the changed DNA methylation patterns and the establishment of aberrant histone code [
19,
20].
Importantly, UHRF1 is essential for cell proliferation, and depleting UHRF1 may inhibit cell proliferation and lead to cell death. The results indicated that silencing UHRF1 leads to a decrease in the proliferation of CaSki cells and the apoptosis of CaSKi increases (the activity of Caspase3, Caspase8, Caspase9, Bax apoptosis-related protein increase). This is consistent with previous studies showing that down-regulation of UHRF1 leads to cell growth inhibition [
19,
20]. According to the research of Li et al., up-regulated UHRF1 might increase cyclin D1 activityand Bax downregulation, resulting in G1 shortage and inhibition of apoptosis and subsequent promotion of cell proliferation respectively [
5]. As it was reported, the
UHRF1 gene, its expression is associated with increased cell proliferation, is a target for the transcriptional activator E2F1 [
21]. The results of nude mouse experiment indicated that tumor grow more slowly in UHRF1 silence group, implying that silencing UHRF1 can suppress the tumorigenesis of CaSKi cells in nude mouse. Moreover, UHRF1-knockout mouse embryonic stem cells exhibit significant loss of genomic methylation [
14].
Furthermore, in our study, the proliferation of CaSKi was prohibited when UHRF1 was down-regulating and cells are stay at G0/G1 stage. Alteration in UHRF1 expression is correlated with the degree of the lung cancer aggressiveness and it was detected in 50 % of the patients in an early clinical stage [
7]. Daskalos and his colleagues reported that UHRF1 is a prominent epigenetic switch that controls cell cycle in lung carcinoma due to its ability to smiantain the transcriptional silencing of tumor suppressor genes through sustaining their promoters in a hypermethylated condition [
21]. UHRF1 mRNA and protein fluctuate with the cell cycle [
22,
23], inactivation or loss of
UHRF1 blocks S-phase entry [
24], and zebrafish with a depletion-of-function mutation in
UHRF1 have reduced cell proliferation and promoted cell apoptosis in hepatocyte [
25]. These data suggests that up-regulating cancer cells of
UHRF1 may result in cell death.
Abbreviations
ANOVA, analysis of variance; BCA, bicinchoninic acid; BSA, bovine serum albumin; CIN, cervical intraepithelial neoplasia; CSCC, cervical squamous cell carcinoma; DDW, deuterium depleted water; DNMT1, DNA methyltransferase 1; FBS, fetal bovine serum; HDAC1, histone deacetylase 1; HPV, human papillomavirus; HRP, horseradish peroxidase; LSCC, laryngeal squamous cell carcinoma; NC, negative control; ORF, open reading frame; PBS, phosphate buffered saline; PCNA, proliferating cell nuclear antigen; PI, propidium iodide; qRT-PCR, quantificational real-time polymerase chain reaction; RIPA, radio immunoprecipitation assay; SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electropheresis; SPF, sun protection factor; SPSS, statistical package for the social sciences; SRA, Set and Ring-associated; UHRF1, ubiquitin-like, containing plant homeodomain and really interesting new gene finger domains 1
Acknowledgements
We would like to give our sincere gratitude to the reviewers for their comments.