Unexpected complexity in the interference activity of a cloned influenza defective interfering RNA

The plasmids encoding the 8 gene segments of the A/WSN strain of A/WS/33 (H1N1) and plasmids expressing the polymerase proteins and NP [45], and the construct expressing 1/244 DI RNA (1/244), derived from a naturally occurring DI virus, were as previously described [46]. 1/244 RNA comprises 395 nt with 151 nt from the 5′ end and 244 nt from the 3′ end of the positive-sense cognate RNA and was derived naturally from segment 1 of A/Puerto Rico/8/34 (H1N1) (Fig. 1). The segment 1 target, segment 1-GFP, expressing the green fluorescent protein (GFP), was created by amplifying the GFP open reading frame by PCR from pEGFP-N1 (Clontech) using primers 5’ATGGTCTCTACTGATGGTGAGCAAGGGCGAG and 5’ATGAAGACAATCTCTTACTTGTACAGCTCGTCCA. The product was inserted between the BpiI and Eco31I sites of pPolI-220 [47] such that the GFP ORF is in-frame with the PB2 ORF, giving plasmid seg 1-GFP which expresses segment 1-GFP RNA (Fig. 1). The GFP reporter retains the exact 5′ (220 nt) and 3′ (48 nt) terminus of segment 1 and is cognate for 1/244 DI RNA. A naturally occurring segment 2 DI (2/265; comprising 452 nt in total with 265 nt from the 3′ end and 187 nt from the 5′ end of the positive-sense cognate RNA) was isolated from a DI A/equine/Newmarket/7339/79 (H3N8) virus preparation (Fig. 1) [48] by RT-PCR amplification, and subsequently cloned into a pPolI-SapIT expression vector [49]. A further naturally occurring segment 3 DI RNA (3/262; comprising 469 nt in total with 262 nt from the 3′ end and 207 nt from 5′ end of the positive-sense cognate RNA) was isolated from a DI A/WSN preparation, and was amplified and cloned as above (Fig. 1). The DI RNAs encoded by the various plasmids retain the exact nucleotide sequences from the termini of the genome segments of the viruses from which they were derived and do not contain any mutations in positions known to have an effect on replication or packaging. Two sequential steps of site-directed mutagenesis were carried out to mutate the start codons in the 1/244 DI RNA. A pair of primers (GTTCTTTTATTCTTTCgATATTGAATATAATTG and CAATTATATTCAATATcGAAAGAATAAAAGAAC) was used for site-directed mutagenesis to convert the first AUG to AUC using a pPolI-244 plasmid as template and Pfu DNA polymerase (Promega). The lower case letters indicate the position of the mutations. The second round of site-directed mutagenesis used primers that altered the second and third start codons to AUC using the construct produced from the first round of mutagenesis (CTTCTTGATTATGGCcATATGGTCCACGGTGGTTTTTGTGAGTATCTCGCGGGTGCGAGACTGCGAcATTAGATTTCTTAGT and ACTAAGAAATCTAATgTCGCAGTCTCGCACCCGCGAGATACTCACAAAAACCACCGTGGACCATATgGCCATAATCAAGAAG). All constructs were confirmed by sequencing.

Human 293T cells (American Type Culture Collection) were transfected as previously described. Briefly, for northern blot analysis, a well of 70% confluent 293T cells in a 12-well plate was transfected using TransIT LT1 transfection reagent (Mirus) with 8 PolI expression plasmids encoding virion sense RNA, and cDNA plasmids for expression of PB2, PB1, PA and NP proteins, with or without pPolI-244. The transfected cells were then incubated at 37 °C overnight before co-culture with MDCK cells (obtained from the American Type Culture Collection) in a 25 cm² flask. Total cellular RNA was extracted with 2 ml Trizol reagent per sample (Invitrogen) on days 1, 2 and 3 after co-culture while tissue culture fluid was collected for virus titration and RNA extraction. Virions were purified by ultracentrifugation. RNA was extracted with phenol/chloroform, and then ethanol precipitated.

For preparation of virus stocks containing DI 1/244 and 1/244 KO DI RNA, virus in tissue culture fluids produced by transfection was passaged once in embryonated chicken’s eggs and allantoic fluids were harvested to produce a stock of virus. The virus produced in embryonated chicken’s eggs is a mixture of 1/244 DI virus or 1/244 AUG KO DI virus packaged in A/WSN virion proteins and infectious helper A/WSN strain of A/WS/33 (H1N1) virus. These were purified by differential centrifugation through sucrose, and resuspended in PBS. Stocks were standardized according to their haemagglutination titre and stored in liquid nitrogen. The DI virus stock was UV-irradiated to remove helper virus infectivity using a short burst (40 s) of UV irradiation at 253.7 nm (0.64 mW/cm²). This is ‘active DI virus’. Longer UV irradiation (8 min) inactivates the protective activity in mice, but does not affect haemagglutinin or neuraminidase activities, and so controls for any immune system-stimulating or receptor-blocking effects of 1/244 DI virus particles (‘inactivated DI virus’).

MDCK cell monolayers in 96-well plates were infected with supernatant containing rescued A/WSN as described previously [44]. After 1 h for attachment of virus, the monolayer was washed with PBS, and incubated in maintenance medium overnight at 33 °C. Cells were then fixed with 4% (v/v) formaldehyde, washed and blocked with 5% (w/v) milk powder in PBS. The infected cells were probed with a monoclonal antibody specific for the HA of A/WSN in PBS containing 0.1% Tween 20. After washing, goat anti-mouse IgG–alkaline phosphatase conjugate (Sigma) in TBS containing 0.1% Tween 20 was added, and infected cells were detected with nitrotetrazolium blue chloride/BCIP (Sigma) in Tris-buffered magnesium chloride and sodium chloride (0.1 M, pH 9.5). The infectivity titre was determined by counting at least 50 positively stained cells (foci) at an appropriate dilution in each of the triplicate wells. The mean number of counts was determined to give a titre in focus-forming units (f.f.u.) ml⁻¹.

To assess the degree of in vivo protection afforded by DI virus, groups of 5 C3H/He-mg mice were each inoculated intranasally under light ether anaesthesia with A/WSN alone (10 LD₅₀ or 1000 f.f.u.), active DI virus alone, a mixture of A/WSN + active DI virus, or A/WSN + inactivated DI virus. The amounts of DI 1/244 used was the same as used in previous studies of protection from disease and mice were subsequently monitored for clinical disease according to our standard protocol [43, 44]. The severity of disease was scored using the standard scoring system with a score of 1 indicating a healthy animal and a score of 5 indicating death with a range of severity of cinical signs for intervening scores as described previously [43, 44]. Animals were assessed daily and data are expressed as the mean score for each group. Surviving mice were challenged 3 weeks after infection with a high dose of A/WSN (10,000 LD₅₀) to determine their immune status. All work with animals was governed by a licence approved by the UK Home Office and complied with national regulations. Animal work was approved by the University of Warwick Animal Welfare and Ethical Review Board as required by the Animals (Scientific Procedures) Act (1986) governing animal experimentation in the UK. Animals culled for humane reasons were subjected to an approved procedure to minimise suffering.

For primer extensions, each well of a 6 well plate containing 70% confluent 293T cells was transfected with 1 μg each of the PB2, PB1, PA and NP cDNA expression plasmids plus various amounts of either a DI plasmid, pPolI-PB2, or pPolI-NA together with 1 μg of target plasmid. Cells were incubated at 37 °C and total cellular RNA was extracted from cells with Trizol at 48 h post-transfection.

Primer extension analysis was carried out as previously described [50], using primer mixes in order to detect vRNA, cRNA, mRNA and 5S rRNA simultaneously from individual samples. Total RNA (2 μg) was mixed with [³²P]5′-end labelled primers and dNTP in a total volume of 13 μl. The mixture was heated at 65 °C for 5 min and placed on ice for 1 min. 2X first Strand Buffer, 20 mM DTT, and 100 U SuperScript III reverse transcriptase (Invitrogen) were added and further incubated at 55 °C for 1 h. The reaction was terminated by heating at 95 °C for 5 min with gel loading dye II (Ambion). The transcription products were resolved on a 6% (w/v) polyacrylamide gel containing 7 M urea in TBE buffer and detected by phosphor imaging. The primers used, and the expected product sizes, are shown in Table 1 and the positions of these on the various target RNAs are demonstrated in Fig. 1a.

Ten μg of total cellular RNA or 50% of the yield of purified virion RNA from each sample was analysed by glyoxal-agarose gel electrophoresis. Poly A-containing mRNA was selected using a GenElute Direct mRNA preparation kit (Sigma) according to the manufacturer’s instructions. Non-polyadenylated RNA that did not bind to the column during mRNA preparation, and therefore contained the viral cRNA, was retained for further study. The RNA was transferred onto Hybond-N membrane (GE Healthcare) overnight using 20× SSC. The membrane was then baked at 80 °C for 2 h and hybridized with digoxigenin (DIG)-labelled probes overnight. The full-length positive-sense DIG-labelled segment 1, segment 2 and segment 7 probes were transcribed in vitro in the presence of DIG-UTP (Roche) from PCR products containing a T7 promoter. The Roche system with a digoxigenin-specific FAb antibody fragment conjugated to alkaline phosphatase and the chemiluminescent CSPD substrate was used for detection. Blots were exposed to Fuji X-ray film until the desired density was achieved and bands were quantified by densitometry using ImageJ (NIH).

Human 293T cells were transfected with the segment 1-GFP RNA expressing plasmid, plasmids expressing PB1, PB2, PA and NP proteins, and increasing amounts of an additional PolI plasmid expressing a DI RNA (1/244, 2/265 and 3/262) or a full-length RNA (segment 1, 4 or 6). At 2 days post-transfection, the cultures were examined for GFP expression. Each dataset was replicated several times and all data were included in the calculations. Digital images of the cell monolayers were taken by phase-contrast and epifluorescence microscopy. Five field fluorescence images were randomly selected and analysed for the proportion of the visualised area expressing GFP using the HCImage software (Hamamatsu). The visualisation detects cells expressing a range of GFP levels to include those that may have been transfected with different levels of the reporter plasmids. A mean was calculated to give the percentage of the GFP positive area per monolayer.

It has been shown that a truncated form of the flu A PB2 protein is capable of inducing type I interferon and an antiviral state [15]. DI 1/244 RNA contains the 3′ terminal 244 nt of the segment 1 vRNA that may direct mRNA synthesis and would consequently have the potential to encode a truncated protein containing the amino terminus of PB2 (Fig. 1a, b). We therefore investigated if the synthesis of the potential truncated protein from 1/244 DI RNA had a role in interference or protection against influenza in vivo. First, we determined if 1/244 DI RNA could direct the synthesis of mRNA by analysing the viral RNAs present in cells infected with 1/244 DI virus and infectious helper virus. As with all DI viruses 1/244 DI virus is replication incompetent, in this case due to the lack of a functional genome segment 1. To study the viral RNAs synthesised from 1/244 we therefore co-infected cells with 1/244 virus and infectious A/WSN (H1/N1) as helper virus to provide the segment 1 encoded PB2 protein needed to generate 1/244 RNAs. Both viruses were generated entirely from molecular clones by reverse genetics as described previously [51] to avoid the presence of other DI RNAs. Northern blot analysis using a segment 1 specific probe detected two polyadenylated virus mRNAs, of approximately 2.3 and 0.5 kb, in infected cells (Fig. 2a). These sizes are consistent with mRNAs predicted to be derived from the full-length genome segment 1 provided by the helper virus and by 1/244 DI RNA, respectively. The positive-sense RNA seen in the non-polyadenylated RNA fraction is cRNA and, as expected, was slightly smaller than the 1/244 DI-derived mRNA. These data indicate that the 1/244 DI RNA is replicated by the infectious helper virus and acts as a template for both replication and transcription from a fully functional RNP complex equivalent to those found with the genomic RNA segments [23].

The mRNA transcribed from 1/244 DI RNA contains the translation start codon of the PB2 open reading frame 1 (ORF-1). This has the potential to encode a protein comprising the first 41 amino acid residues of PB2 fused to 21 amino acid residues translated from a different reading frame generated as a result of the deletion, making a protein of 62 residues in total (Fig. 1b). This putative protein contains the entire PB1-binding domain of residues 1–35 [33] and the mitochondrial localisation domain of residues 1–22 [52]. We investigated whether the putative protein was required for the previously reported protection from infection by 1/244 DI RNA by mutating the sequence to remove the translation initiation codons. The PB2 ORF has three possible AUG start codons and to be sure there could be no translation initiation all three possible start codons were mutated (to AUC). The new RNA is referred to as 1/244 AUG KO DI RNA.

RNAs were harvested 48 h after transfection of 293T cells with plasmid encoding either the 1/244 DI RNA or the 1/244 AUG KO DI RNA together with plasmids expressing the PB2, PB1, PA and NP proteins. Primer extension analysis, using a mixture of primers to detect both positive- and negative-sense RNAs simultaneously (Table 1), showed that 1/244 and 1/244 AUG KO synthesised both types of RNA with the predicted sizes, confirming that both genomes acted as templates for RNA synthesis in transfected cells. Densitometric analysis followed by normalisation against the 5S rRNA loading control showed that the levels of mRNA synthesized by 1/244 and 1/244 AUG KO DI RNAs were similar (mRNA/5S ratios of 0.87 and 0.9, respectively) confirming that transcription was unaffected by the mutations in the 1/244 AUG KO DI RNA (Fig. 2b).

In our experience all stocks of influenza virus contain some level of a complex population of DI viruses, which makes examination of the activity of any individual transfected DI RNA in a cell culture infection model technically impossible. In such experiments it is necessary to use a high level of infectious virus which results in a prominent signal from the naturally occurring DI RNAs that obscures the signal from the transfected plasmid expressing 1/244 DI RNA (unpublished data). We have therefore used an established in vitro RNP reconstitution approach [53‐55] to examine the ability of DI RNAs to interfere with the expression of green fluorescent protein (GFP) from a Seg 1-GFP construct. Here the coding region of GFP is inserted in-frame into a deleted influenza segment 1 RNA (Fig. 1a). This system also distinguishes effects of DI RNA on RNA synthesis from any effect on RNA packaging as plasmids encoding key structural proteins (HA, NA, M1 and M2) are not included [56]. The interfering ability of 1/244 and 1/244 AUG KO RNAs were determined by transfecting 293T cells with the relevant plasmids and plasmids expressing Seg 1-GFP and PB1, PB2, PA and NP proteins. 1/244 and 1/244 AUG KO RNAs both strongly inhibited fluorescence in a dose-dependent manner (Fig. 3a) with over 90% inhibition at the dose of 0.5 μg for both 1/244 or 1/244 AUG KO plasmids (Fig. 3b).

To determine whether the in vitro interference is also reflected in an infection model, we compared the abilities of 1/244 DI and 1/244 AUG KO DI RNA to protect mice from disease that normally follows challenge with influenza A/WSN (H1N1). Virus stocks containing either 1/244 DI or 1/244 AUG KO DI RNA were produced using reverse genetics as before [51] and mice were infected intranasally with either A/WSN alone, A/WSN and 1/244 DI virus, or A/WSN and 1/244 AUG KO DI virus. Additional infected groups received DI virus which had been UV-irradiated for 8 min to destroy DI protecting activity and to control for any non-specific effects of the DI virus inoculum [43, 44]. Mice were monitored for clinical disease. Figure 2c shows that the A/WSN virus-infected control mice all became seriously ill, and had to be culled. In contrast, none of the infected mice also receiving 1/244 DI virus or 1/244 AUG KO DI virus developed any sign of clinical disease. All mice treated with A/WSN + 1/244 DI virus or 1/244 KO DI virus alone were also healthy throughout and these data points are obscured by those of the A/WSN + 1/244 KO DI virus. As expected from earlier data mice treated with UV-inactivated DI virus were not protected [43, 44]. We have shown previously that animals treated simultaneously with 1/244 DI virus and infectious virus generate protective immunity that prevents disease following subsequent challenge with a high dose of the same virus in the absence of further treatment with DI virus. Animals treated here with 1/244 AUG KO DI virus were solidly immune to further challenge with a high dose of A/WSN showing that they had been infected during the first virus challenge even though they developed no sign of clinical disease (Fig. 2d). These data show that interference in vitro or protection in vivo by 1/244 DI virus does not require expression of a protein product and is a purely RNA-mediated phenomenon.

It was reported previously that the interference mediated by a DI virus occured at the level of packaging [57], and we investigated whether this was also the case for DI 1/244. Human 293T cells were transfected with various amounts of the 1/244 DI plasmid and a constant amount of the plasmids needed for the production of infectious A/WSN virus. These cells were then co-cultivated with MDCK cells, and at days 1–3 post co-culture the levels of segments 1, 2 and 7 vRNAs in infected cells and in purified virus particles were determined. Previously we showed that influenza vRNAs were only detectable when all of the virus RNA polymerase components were present, demonstrating that the vRNAs are generated by the virus polymerase [46]. 1/244 DI RNA was observed only in cultures transfected with the 1/244 plasmid, confirming that no other segment 1 DI RNA sequences were generated following transfection (Fig. 4a). We determined the effect of 1/244 DI RNA on the packaging efficiency of full-length segment 1 by measuring the ratio of segment 1 to segment 7 in cells and in virions over time in the absence, or presence of increasing levels, of 1/244 DI RNA. Packaging of segment 7 in virions is expected to be unaffected by a segment 1-derived RNA. Therefore, an alteration in the ratio of intracellular versus packaged RNA segments indicated whether full-length segment 1 was affected by the presence of the DI RNA. Measuring the ratio of segment 1 to segment 7 also controls for any overall reduction in production of infectious virus particles due to the presence of the DI RNA. As the amount of transfected 1/244 DI plasmid DNA was increased there was a progressive reduction of segment 1 in cells (Fig. 4a upper panel) and a corresponding reduction in virus infectivity on each of the days examined (Fig. 4c). This confirmed that 1/244 DI RNA-mediated interference was taking place. The reduction in infectious particle production was mirrored by a reduction in virion RNA levels, with no segment 1, 2 or 7 vRNAs detected in the presence of 1 μg of 1/244 DI plasmid DNA (Fig 4a, b, lower panels). Quantitation showed that in the presence of 1/244 DI RNA, the ratio of full-length segment 1 vRNA: segment 7 vRNA was considerably lower in virions than in cell extracts (Fig. 4d). This established that 1/244 DI RNA acts, at least in part, by selectively excluding full-length cognate segment 1 vRNA from progeny virus particles. The segment 2 vRNA content of virions was not reduced in the presence of increasing amounts of 1/244 plasmid (Fig. 4b, d), confirming that inhibition of packaging of segment 1 by 1/244 DI RNA was specific, and did not extend to other polymerase component-encoding RNA segments. The origin of the band in the total cellular RNA underneath the segment 2 signal is not known, but is likely arise from a non-specific interaction of the probe with cellular RNA.

To distinguish between the effects of DI RNA on viral RNA synthesis and RNA packaging, GFP expression from the Seg 1-GFP construct was determined as described above. Human 293T cells were transfected with Seg 1-GFP and plasmids expressing PB1, PB2, PA and NP proteins, and GFP fluorescence determined 2 days post-transfection. In addition, increasing amounts of a PolI plasmid expressing either DI 1/244 or an alternative DI RNA (2/265 or 3/262, containing 244, 265 and 262 nt from the 3′ end of the cognate vRNAs, respectively: Fig 1a) or a full-length vRNA not expressing a polymerase component (segment 4 or 6) were transfected. In control experiments, increasing amounts of a PolI plasmid encoding full-length vRNA for segment 1 were added to determine whether the presence of segment 1 sequences in general inhibited GFP expression. In the absence of the expression plasmid encoding the PB2 protein no GFP expression was detected confirming the requirement for formation of a functional vRNP complex (data not shown). Figure 3a shows substantial expression of fluorescence in the absence of any DI RNA, while increasing levels of 1/244 DI led to significantly diminished GFP expression. In contrast, inhibition was far less marked when cells were transfected with plasmids that synthesised full-length segments 1, 4 or 6 vRNAs. The inhibitory effect of 1/244 DI RNA was highly significantly different to that of segment 6 RNA, with 0.1 μg of 1/244 DI plasmid required to inhibit GFP fluorescence by 70%, whereas 10-fold more of the segment 6 plasmid was needed to produce a similar level of inhibition (61–69%) (Fig. 3b). The presence of 1 μg of segment 4 plasmid DNA reduced segment 1-derived gene expression by only 25% (Fig. 3c). Thus 1/244 DI RNA strongly inhibits gene expression from a segment 1 target RNA. Addition of full-length segment 1 had only a relatively small effect with 1 μg plasmid DNA reducing GFP fluorescence by 57%, demonstrating that the effect of the DI plasmids was due to their unique sequences and not to a general effect of segment 1 terminal sequences. Further assays showed that the segment 2- and segment 3-derived DI RNAs (2/265 and 3/262, respectively) also strongly inhibited GFP fluorescence from the segment 1-derived target (Fig. 3a-c), with 1 μg of the 2/265 and 3/262 DI plasmid DNAs reducing expression to 2% and 6% of the control, respectively.

Expression of GFP from the Seg 1-GFP PolI plasmid is dependent on transcription of the negative-sense vRNA into mRNA. However, vRNA is also template for cRNA, which in turn acts as template for the production of more vRNA. Influenza virus mRNA has a 5′-extension of approximately 12 nt cleaved from host mRNA [10] and is polyadenylatedso the mRNA and cRNA products are distinguishable by size. Using Seg 1-GFP plasmid with the transfection protocol described above, and a primer extension assay that detects vRNA, mRNA and cRNA, we investigated 1/244 DI RNA mediated interference of RNA synthesis (Fig. 5). Viral RNAs were all of the predicted sizes indicating that the templates generated the correct products. RNA levels were normalised to the 5S loading control levels before quantitation and the levels of vRNA were also adjusted to account for basal transcription from the target plasmids. Basal transcription was calculated as a percentage of the vRNA:5S RNA ratio in the absence of both the plasmid pcDNA-PB2 (which encodes a critical component of the virus polymerase), and of any interfering RNA (see Fig. 7e, lane 1). This value (0.93%) was subtracted from the vRNA levels. Values of zero indicate that no vRNA was detected above the basal level.

Quantitation of the primer extension products showed that mRNA and cRNA levels were considerably more reduced than was vRNA in the presence of 0.1 μg to 0.5 μg of 1/244 plasmid DNA (Fig. 5a, b). Addition of 0.1 μg of 1/244 plasmid DNA reduced mRNA and cRNA levels to 13% and 10% of the control, respectively, while the level of vRNA was reduced to only 54% of the control (vRNA:mRNA p = 0.0052, vRNA:cRNA p = 0.016). However, 0.5 μg and 1 μg of 1/244 reduced the levels of mRNA and cRNA synthesised from segment 1 by >99% while levels of vRNA remained at 14%. Thus 1/244 DI RNA has a profound effect on all RNAs synthesised from the segment 1 target, but differentially targets positive-sense RNAs. To control for the specificity of action of the inhibiting RNA, either a segment1 (encoding the intact PB2 gene) or a segment 6 (encoding the NA gene) plasmid was transfected in the place of the DI RNA plasmid. Fig. 5c-f show that segment 1 and 6 RNAs were significantly less effective at inhibiting mRNA, cRNA and vRNA expression from the segment 1 target than was 1/244 DI RNA. This is consistent with the lower level of fluorescence inhibition achieved by the segments 1 and 6 RNA (Fig. 3a). The reduction in the level of segment 1-GFP encoded mRNA and the reduction in GFP fluorescence (Figs. 3 and 5) were strongly positively correlated (R² = 0.90; data not shown), confirming that fluorescence was a faithful marker of mRNA synthesis.

To determine if 1/244 DI RNA-mediated inhibition of RNA synthesis is segment specific, the segment 1 target (Seg1-GFP) was replaced with a plasmid directing the synthesis of either full-length segment 2, segment 3 or segment 6 vRNAs. Fig. 6a-d shows that 1/244 DI RNA reduced the levels of all three RNAs synthesized by segment 2 or segment 3, whereas segment 6 mRNA production was unaffected even at the highest amount of 1/244 DI plasmid transfected (1 μg), cRNA and vRNA levels were reduced to 12% and 23% of the control value, respectively. Although inhibition of segment 2-derived RNAs by 1/244 DI RNA (Fig. 6a, b) more closely resembled that seen for Seg1-GFP (Fig. 5a, b) than for segment 3 or 6 target RNAs (Fig. 6c-f), four-fold more 1/244 plasmid DNA was required to reduce segment 2 mRNA levels to 13% of the control than was needed for Seg 1-GFP. The trend of reduction of mRNA, cRNA and vRNA levels with the segment 3 target in duplicate samples was similar though slightly less pronounced (Fig. 7c, d). Overall, the data are consistent with a mechanism whereby 1/244 DI RNA reduces levels of mRNA synthesized from segments 1, 2 and 3, but not from segment 6.

In light of the ability of 1/244 DI RNA to differentially reduce the level of segment 1-encoded RNAs, we investigated whether the levels of positive- and negative-sense RNAs synthesised from the 1/244 DI RNA itself were also affected. RNA was extracted from 293T cells transfected with increasing levels of 1/244 DI RNA, and plasmids expressing PB1, PB2, PA and NP proteins, in the presence or absence of Seg1-GFP DNA (Fig. 7a, c). Although we found previously that we could detect vRNA, cRNA and mRNA using primer extension, in these experiments the gel electrophoresis could not distinguish the positive-sense cRNA and mRNA. However, Fig. 7a, b show that in the presence of the Seg 1-GFP target, 1/244 DI positive-sense RNA levels increased in proportion to the amount of transfected 1/244 DI plasmid. Thus these were maximal at the same time as the Seg 1-GFP mRNA and cRNA levels were at a minimum as shown in Fig. 5a, b. This shows that 1/244 DI RNA does not inhibit all influenza polymerase-directed transcription. However, the level of 1/244 DI-specific vRNA was reproducibly maximal with 0.1 μg 1/244 plasmid DNA, but decreased to 12% of the maximum value with 0.5 μg plasmid (vRNA: positive-sense RNA p = 0.0002), and to 4% with 1 μg plasmid (Fig. 7b) demonstrating that a high concentration of 1/244 DI RNA reduces the level of its own de novo produced vRNA. When the 1/244 plasmid DNA was titrated in cells in the absence of any target RNA the resulting levels of 1/244 positive-sense RNA and vRNA were similar to those in the presence of segment 1 target RNA (Fig. 7c, d). The effects of 1/244 DI RNA on RNA synthesis were entirely dependent on transcription of the target RNA carried out by the virus polymerase as omission of the expression plasmid that provides the PB2 protein that forms part of the virus RNA polymerase, and which is encoded by segment 1, resulted in no expression of Seg1-GFP mRNA or cRNA, although low levels of vRNA transcribed directly from the input plasmid DNA were detected as expected (Fig. 7e).