Unveiling the hidden threat: prevalence of Enterocytozoon bieneusi and other intestinal parasitic infections among organ transplant recipients in Southern Iran
- Open Access
- 01.12.2025
- Brief Report
Erschienen in:
Abstract
Background
Parasitic diseases in transplant recipients represent a significant clinical challenge, with serious implications for patient morbidity and mortality [1‐3]. Transplant recipients are particularly susceptible to these infections due to the immunosuppressive therapy necessary to prevent graft rejection. This immunosuppression compromises the body’s natural defense mechanisms, making patient vulnerable to a wide range of opportunistic infections, including parasitic diseases. These infections in transplant recipients fall into two categories: donor-derived and post-transplant infections. Donor-derived infections occur when a transplanted organ carries a parasitic infection, transmitting it to the recipient.
Post-transplant parasitic infections, on the other hand may result from exposure to environmental sources of parasites, reactivation of latent infections, or, less commonly, nosocomial transmission [4]. The spectrum of these infections in transplant recipients is broad, varying based on geographical location, the type of organ transplanted, and the individual’s exposure history.
Anzeige
Protozoan infections, such as those caused by Toxoplasma gondii, Enterocytozoon bieneusi, and Cryptosporidium spp., are among the most frequently reported in this population [2, 3, 5‐7]. E. bieneusi, a microsporidian parasite, is a significant pathogen among immunocompromised individuals, especially organ transplant recipients [8‐13]. As cell-mediated immunity is impaired by immunosuppressive therapy, these patients are vulnerable to opportunistic infections, including intestinal microsporidiosis. It can lead to chronic non-bloody diarrhea, malnutrition, weight loss, and systemic complications that threaten graft survival and prolong hospitalization [14]. E. bieneusi has been linked to significant morbidity in renal and hepatic transplant patients as well as hematopoietic stem cell transplant recipients [11, 15].
In Iran, several studies investigated the prevalence of parasitic infections in immunocompromised patients including transplant recipients [1‐4, 6, 16]. For instance, a study on 190 patients with immunodeficiency, cancer, and transplantation in Tehran, revealed high rates of Blastocystis hominis infection in cancer patients and Cryptosporidium infections in transplant recipients [2]. Another study conducted in 2013 on 44 pediatric liver transplant recipients in Shiraz, southern Iran, reported infections with Coccidia and microsporidia as significant causes of persistent diarrhea. Similarly, a study on 71 kidney transplant patients in Mashhad, northeast Iran, identified the infections caused by Enteromonas, Giardia, Blastocystis, and Cyclospora [17]. Moreover, a study involving 73 transplant patients (kidney and pancreas) in France, found that Cryptosporidium and microsporidia were key contributors to diarrhea in these recipients [18].
As organ transplant recipients are immunocompromised, making them highly susceptible to opportunistic infections like E. bieneusi and other intestinal parasites, understanding the prevalence of these infections is crucial. Given the clinical importance of parasitic diseases in transplant patients, the present study was conducted to investigate the prevalence of such infections in transplant recipients at a comprehensive transplant center in Fars Province, Southern Iran.
Methods
Sampling and subjects
This study was conducted on 150 organ transplant patients at the Organ Transplantation Hospital (Abu Ali Sina) in Shiraz the capital of Fars province. The hospital is one of Iran’s largest, most equipped, and advanced transplant centers. The study conducted from July 2022 to February 2023. It included organ transplant recipients who were at least 18 years old and had undergone organ transplantation at least two months prior to the study. Demographic information such as gender, age, type of transplant, number of transplants, type of organ donor, date of transplant, history of rejection, underlying diseases (main cause of transplant), other concomitant diseases, history of diarrhea, and use of immunosuppressive drugs, was collected through a questionnaire (supplementary file 1). Kidney, liver, intestine, and SPK (simultaneous pancreas and kidney) transplant patients were included. Patients younger than 18 years, those who had their transplant less than two months before the study, individuals who did not undergo the specified types of transplants, and those unwilling or unable to provide the required information were excluded. All individuals participating in this study provided their full, informed consent.
Anzeige
A stool sample in a screw-capped container was taken from each patient and transferred to the Parasitology Department at Shiraz University of Medical Sciences, Shiraz, Iran, while maintaining the cold chain using a cold box.
Stool examination
The stool samples underwent parasitological examination, including direct examination, zinc sulfate flotation, formalin-ethyl acetate sedimentation, trichrome staining, acid-fast staining, and trichrome-acid fast staining (for the detection of microsporidia) to identify protozoan and helminthic infections. Moreover, a portion of each sample was placed in a 2 ml microtube containing normal saline with a unique code for each patient before being stored in a -20 °C freezer for molecular tests. Experienced technicians performed the microscopy, and all positive and suspicious cases were reviewed and confirmed by the project’s principal investigator.
Acid-fast trichrome staining for the detection of intestinal microsporidia
Acid-Fast Trichrome staining was applied to analyze stool samples for the presence of microsporidia [19]. The samples, filtered through four layers of gauze, yielded sediments which were spread onto glass slides and air-dried. The slides were initially immersed in methanol for fixation before being treated with a carbol-fuchsin solution for 10 min, containing phenol, distilled water, and an alcoholic fuchsin mixture. Following a thorough rinse, the slides underwent destaining using hydrochloric acid-alcohol and were washed again with tap water.
To achieve the final staining, a trichrome solution was employed—made of Chromotrope 2R, aniline blue, phosphotungstic acid, and acetic acid, adjusted to a pH of 2.5. The slides were stained at 37 °C for 30 min, followed by a washing process involving acid alcohol and ethanol. The slides were then examined using oil immersion at a magnification of 1000x.
Molecular evaluation of the stool samples
A DNA extraction kit (Viragen, Iran), was used to extract DNA from the stool samples, following the manufacturer’s instructions. The PCR method used in this study was a one-step protocol. To detect Blastocystis sp., the 600 bp SSU rDNA gene was targeted using RD5 (5´-ATCTGGTTGATCCTGCCAGT–3´) and BhRDr (5´-GAGCTTTTTAACTGCAACAACG–3´) primers as previously described by Sharifi et al. [20] The PCR protocol consisted of an initial denaturation phase at 95 °C for 4 min, followed by 30 cycles of 95 °C for 15 s, 60 °C for 15 s (annealing), and 72 °C for 30 s (elongation). This process concluded with a final extension phase at 72 °C for 5 min. The PCR products were analyzed using electrophoresis on a 1.5% agarose gel, stained with GelRed and loading dye.
The detection of Cryptosporidium spp. was performed using PCR as described by Khalil et al., targeting the 18S rRNA gene. The primers used for this process were CPB-DIAGF (5’-AAGCTCGTAGTTGGATTTCTG-3´) and CPB-DIAGR (5´-TAAGGTGCTGAAGGAGTAAGG-3´) [21].
A two-step nested PCR was employed for the detection of microsporidia. The PCR protocol and primers used were based on the methodology outlined by MirJalali et al. [22] In the first step of nested PCR, PMicF and PMicR primers targeted the ssu rRNA gene. In the second step EnbF and EnbR primers were used for the detection of Enterocytozoon bieneusi, while EncepF and EncepR primers were used for the detection of Encephalitozoon species. Table 1 presents the sequences of primers used in the Nested-PCR for the detection of microsporidia.
Table 1
Sequences of primers used in the Nested-PCR for the detection of microsporidia
Target gene | Primers | Sequences |
|---|---|---|
ssu rRNA | PMicF | 5´- GGTTGATTCTGCCTGACG - 3´ |
PMicR | 5´ - CTTGCGAGC(G/A)TACTATCC − 3´ | |
EnbF | 5´- GGTAATTTGGTCTCTGTGTG - 3´ | |
EnbR | 5´- CTACACTCCCTATCCGTTC -3´ | |
EncepF | 5´- AGTACGATGATTTGGTTG- 3´ | |
EncepR | 5´- ACAACACTATATAGTCCCGTC- 3´ |
Anzeige
Table 2
The program used for the first step of nested-PCR for the detection of the Ssu rRNA gene of microsporidia
Step | Time | Temperature | No. of cycles | Product |
|---|---|---|---|---|
Denaturation | 5 min | C ° 95 | 35 Cycles | 779 bp |
40 s | C ° 94 | |||
Annealing | 45 s | C ° 55 | ||
Extension | 45 s | C ° 72 | ||
3 Min | C ° 72 |
Table 3
The program used for the second step of nested-PCR for the detection of microsporidia
Step | Time | Temperature | No. of cycles | Products |
|---|---|---|---|---|
Denaturation | 5 Min | C ° 95 | 25 Cycles | 440 bp for E. bieneusi and 629 bp for Encephalitozoon spp. |
35 s | C ° 94 | |||
Annealing | 35 s | C ° 57 | ||
Extension | 40 s | C ° 72 | ||
3 Min | C ° 72 |
DNA sequencing and phylogenetic analysis
Bidirectional sequencing was performed on the PCR products obtained from 10 Blastocystis samples. The resulting sequences were subsequently edited using BioEdit software (version 7.0.5.3). These refined sequences were compared to reference sequences in GenBank using BLAST queries. Additionally, the sequences were submitted to the Blastocystis 18 S database for GenBank sequence queries. The phylogenetic tree was constructed using the Neighbor-Joining method and the Kimura 2-parameter model, as implemented in MEGA X software. The reliability of the nodes was assessed through 10,000 bootstrap replications. The 18SrRNA sequence of Proteromonas laceratae served as the outgroup for the phylogenetic analysis.
Anzeige
Statistical analysis
The collected data were statistically analyzed using SPSS software (version 20). Descriptive statistics were used to determine the prevalence of infections. The Chi-squared test was applied to identify potential associations between variables and the occurrence of intestinal parasites. The threshold for statistical significance was set at a 5%.
Results
Features of the study subjects
In this study, stool samples were collected from a total of 150 transplant recipient patients. Of these subjects, 96 (64%) were men, and 54 (36%) were women. The mean age of the participants was 46.24 years (± 15.13), ranging from 18 to 85 years old. The majority of the patients (22.66%) fell within the 41–50-year age group. Kidney transplantation accounted for 79 cases (52.66%), followed by 69 (46%) liver transplants, 1 (0.66%) intestinal transplant, and 1 (0.66%) SPK transplant. The studied subjects originated from various provinces of Iran, mostly (61.33%) from Fars province. Table 4 shows the characteristics of the study subjects.
Table 4
Characteristics of the organ transplant recipients in the current study
Features | Frequency | |
|---|---|---|
No. | Percentage | |
Age (years) | ||
≤ 20 | 9 | 6 |
21–30 | 20 | 13.3 |
31–40 | 25 | 16.7 |
41–50 | 34 | 22.7 |
51–60 | 29 | 19.3 |
61–70 | 29 | 19.3 |
≥ 71 | 4 | 2.7 |
Sex | ||
Male | 96 | 64 |
Female | 54 | 36 |
Transplant type | ||
Kidney | 79 | 52.7 |
Liver | 69 | 46 |
Intestine | 1 | 0.7 |
SPK* | 1 | 0.7 |
Rejection | ||
Yes | 14 | 9.3 |
No | 132 | 90.7 |
Parasitological and molecular findings
Intestinal protozoa were detected in stool samples from 63(42%) cases using parasitological methods. Among these, 58 (38.66%) cases were infected with Blastocystis sp., 2 (1.33%) with Entamoeba coli, and 2 (1.33%) with Iodamoeba buetschlii. Infection with E. bieneusi was identified in one patient. No cases of helminth infection were observed in the studied subjects. Figures 1 present examples of the intestinal protozoa identified in this study.
Anzeige
Fig. 1
Photomicrography of intestinal protozoa detected in organ transplant patients (40x magnification and 100x optical microscope). A: Vacuolar form of Blastocystis hominis, B: E. coli trophozoite, C: Iodamoeba buetschlii cyst (trichrome staining), D: Blastocystis hominis cyst (trichrome staining), E: Microsporidia spp. spores, stained with acid-fast trichrome staining (magnification 1000x)
The occurrence of intestinal protozoa was slightly higher in males (45.83%) compared to females (35.18%), although this difference was not statistically significant. The age group of 51–60 years exhibited the highest prevalence of intestinal parasite infection (55.17%), but this difference was also not statistically significant. Kidney transplant patients exhibited the highest rate of parasitic infection (43.03%). However, statistical analysis revealed no significant correlation between the type of transplant and the incidence of parasitic infection.
Among the 58 stool samples positive for Blastocystis species by parasitological methods, 10 samples were randomly selected and analyzed using molecular methods. Figure 2 displays the gel electrophoresis of PCR products showing the 600 bp bands corresponding to the SSU rDNA gene of Blastocystis sp. The sample tested positive for microsporidia by parasitological methods was further evaluated using a molecular nested-PCR method, employing EnbF and EnbR primers (for the detection of E. bieneusi) or EncepF and EncepR primers (for the detection of Encephalitozoon species). In the second step of Nested-PCR a 440 bp product, corresponding to E. bieneusi was detected in the sample, which previously tested positive for microsporidia infection by parasitological methods (Fig. 3). The patient infected with E. bieneusi was a 55 years old man, had liver transplantation with history of diarrhea.
Fig. 2
Electrophoresis of PCR products of SSU rDNA gene on 2% agarose gel for detection of Blastocystis sp. Lane 1: 100 bp molecular marker, Lane 2: negative control, Lane 3: positive control, Lane 4, 6, 7, 9, 11–15, negative samples, Lane 5, 8, 10 positive cases
Anzeige
Fig. 3
Electrophoresis of the second step products of nested-PCR of microsporidia spp. on 2% agarose gel for the detection of Enterocytozoon bieneusi, using EnbF and EnbR primers. Lane 1: 100 bp molecular marker, Lane 2: negative control, Lane 3: positive control, Lane 4, 5, 6, 8, 9–14, negative samples, Lane 7: shows 440 bp band corresponding to Enterocytozoon bieneusi
In the electrophoresis analysis of the second-step product from nested-PCR targeting Encephalitozoon, no bands were detected, indicating that all samples tested negative. Additionally, molecular examination of 23 diarrheal samples for the presence of Cryptosporidium spp. (intestinal coccidia) yielded no positive results.
DNA sequencing and phylogenetic analysis
Ten PCR products of Blastocystis samples were sequenced, and analysis of the 18 S rRNA gene sequences using BioEdit revealed 100% homology with Blastocystis subtype 3 (ST3). The nucleotide sequence data were submitted to the GenBank database under the accession numbers; OR397834-42. The phylogenetic tree was constructed utilizing the Neighbor-Joining method and the Kimura 2-parameter model, as implemented in MEGA X software (Fig. 4).
Fig. 4
Neighbor-joining phylogenetic tree showing the Blastocystis sp. subtypes infecting transplant patients belonging to the subtypes 3. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (10000 replicates) are shown next to the branches
Anzeige
Discussion
Intestinal parasites, including protozoa and worms, are significant disease-causing agents in humans. The type and prevalence of these parasites vary among individuals based on factors such as immune system status, hygiene levels, and the characteristics of residential area [4, 7, 22‐24]. The current study was conducted to investigate parasitic infections in transplant patients analyzing 150 stool samples using various parasitological and molecular approaches. One of the commonly studied protozoa in humans is B. hominis, whose pathogenicity remains a topic of debate. It is often referred to as a commensal or opportunistic protozoan, particularly in cases of immune system weakness. Numerous studies on organ transplant patients and other individuals with compromised immune systems have demonstrated the prevalence of infections caused by B. hominis [20, 24‐29].
Blastocystis infections can cause various gastrointestinal symptoms, particularly in immunocompromised individuals such as organ transplant recipients [25‐29]. The clinical manifestations of Blastocystis infection range from asymptomatic carriage to acute or chronic diarrhea, abdominal pain, and other gastrointestinal disturbances. In organ transplant recipients, the immunosuppressive therapy necessary to prevent graft rejection can impair the host’s ability to control and clear infections, including Blastocystis. This can lead to more severe and persistent infections compared to immunocompetent individuals. A high index of suspicion, appropriate diagnostic methods, and a comprehensive management approach are essential for addressing this challenging infection in this vulnerable patient population.
Various subtypes of this parasite have been identified, with ST1-ST4 being the most common among humans. In the present study, the highest prevalence of infection was observed with the protozoan parasite B. hominis. Due to the high infection rate among the study subjects molecular analysis and sequencing were performed to identify the parasite’s subtypes, and subtype 3 (ST3) was identified in the samples. In our previous study on the genomic diversity of Blastocystis in patients from southern Iran, where the current study was conducted, the predominant isolates were I and II, accounting for 60% of the total. However, the Blastocystis subtype was not determined through sequencing in the previous study [30].
Phylogenetic analysis of our data revealed that all Blastocystis sp. subtype 3 sequences obtained here belonged to a single haplotype, identical to those previously reported in Iran (NCBI references: Op270197, MG011642). The lack of genetic diversity within our dataset precluded further allele identification for this subtype.
Other findings of this study, with lower prevalence, include E. coli, I. butschlii, and E. bieneusi. E. bieneusi is a type of microsporidia known to cause diarrhea, particularly in individuals with weakened immune systems (e.g. AIDS patients, transplant recipients). Infections with this protozoan have been reported worldwide [1, 22, 31, 32].
In this study, molecular approaches targeted the SSU rRNA gene for detecting Cryptosporidium and microsporidia, and the SSU rDNA gene for detecting Blastocystis. The 18 S rRNA gene, also known as the SSU rRNA gene, is a highly conserved genetic marker across eukaryotes, making it a reliable target for molecular diagnostics. Its conserved regions facilitate broad detection through universal primers, while variable regions enable species-specific identification. For Microsporidium and microsporidia, this gene ensures sensitive and accurate detection across species. Similarly, the SSU rDNA gene, equivalent to the 18 S rRNA gene, is targeted for Blastocystis due to its high copy number and variability among subtypes, which supports effective detection and subtype identification essential for understanding its epidemiology and pathogenicity.
In this study, one case of E. bieneusi infection was confirmed by both molecular and parasitological methods. E. bieneusi, although rare, poses a significant yet often overlooked threat to organ transplant recipients. Our study, conducted in a comprehensive transplant center in southern Iran, highlights the presence of this pathogen among these patients. The findings underscore the importance of vigilant screening and early detection to mitigate the risks associated with this opportunistic infection, which can cause severe gastrointestinal complications and impact the overall success of organ transplantation. These findings shed light on the hidden dangers faced by transplant patients, emphasizing the need for heightened awareness and proactive management strategies. In a study by Goetz and colleagues, a case of a liver transplant patient infected with E. bieneusi was reported in Germany using molecular and parasitological methods. This patient experienced chronic diarrhea and abdominal pain, which is consistent with the findings of our study [33]. Similarly, in a study conducted by Mirjalali et al., in Tehran, Iran, involving 329 immunocompromised patients (AIDS, cancer, and organ transplant recipients), 14 cases of E. bieneusi infection were confirmed by molecular methods [13].
Clinically, the findings of the current study highlight the need for routine parasite screening, and advanced molecular diagnostics that consider patient-specific risks. Preventive measures, including hygiene education and dietary guidelines, should be prioritized. Raising awareness and fostering international collaborations could greatly improve the management of parasitic diseases in transplant recipients.
The study’s limitations include its relatively small sample size of 150 participants, which may not represent the broader population of organ transplant recipients, particularly in different regions or countries. Additionally, its cross-sectional design only provides a snapshot of infections at a single point in time, limiting insights into the progression, recurrence, or long-term effects of these infections. Lastly, the study’s focus on intestinal parasites overlooks other potential parasitic infections, which could also significantly impact immunocompromised individuals.
Conclusion
The results of this study highlight the prevalence of intestinal protozoa, notably Blastocystis species, among transplant patients in southern Iran. An instance of E. bieneusi infection was also detected, underscoring the importance of increased vigilance towards these parasitic agents, particularly in diarrheal cases. The findings may provide practical implications for healthcare providers, particularly in the management and screening of transplant patients. Future research could explore the progression and recurrence of parasitic diseases in transplant patients. Comparative studies across regions, alongside evaluations of environmental, dietary, and lifestyle factors, could refine diagnostic and treatment approaches tailored to this group.
Acknowledgements
The study was a part of the results of Mrs. Leila Morabi’s MSc dissertation.
Declarations
Ethics approval and consent to participate
The study was approved by the Ethical Committee of Shiraz University of Medical Sciences (Ref. No. IR.SUMS.REC.1401.176) and written informed consent was obtained from each participant.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
