Upregulated expression of Annexin II is a prognostic marker for patients with gastric cancer

GC tissues were obtained from gastrectomy specimens of 436 patients with primary gastric cancer subjected to curative surgical resection (median age: 60.0 years; range: 30 to 91 years; 311 men, 125 women) from the Department of Surgery, Zhejiang Provincial People’s Hospital from January 1998 to January 2004. All tissue samples were formalin-fixed, paraffin-embedded, clinically and histopathologically diagnosed at the Departments of Gastrointestinal Surgery and Pathology. The follow-up deadline was December 2008 and all patients had follow-up records for more than five years. Survival time was calculated from date of surgery to follow-up deadline or date of death, which was caused mainly by carcinoma recurrence or metastasis. Based on the Lauren classification, 223 cases were intestinal and 213 cases were diffuse gastric cancer. There were 55, 163, and 218 cases from the cardia, body, and antrum, respectively. According to the 2002 World Health Organization (WHO) histological classification of gastric carcinoma, there were 326 tubular, 16 papillary, 29 mucinous, 65 signet-ring cell, and 13 highly differentiated, 128 well or moderately differentiated, 293 poorly differentiated, and two undifferentiated adenocarcinomas, respectively. Ninety cases were categorized as stage I, 104 were stage II, 173 were stage III, and 69 were stage IV. There were 61 cases with distant metastasis. A total of 92 non-cancerous gastric mucosa were obtained from gastrectomies of adjacent gastric cancer margins of >5 cm. Patients with advanced-stage disease underwent routine chemotherapy after surgery, but no radiation treatment was given to any patients included in our study. We followed up all patients by consulting their case documents or by telephone. All of the tissue specimens were obtained for the present study with patient informed consent and the use of the human specimens was approved by the Zhejiang Provincial People’s Hospital Institutional Review Board.

The expressions of annexin II and S100A6 in 40 tumor tissue samples and matched non-cancerous gastric mucosa were confirmed by real-time PCR. Total RNA was extracted by Trizol and cDNA was reverse-transcribed by RevertAid TM reverse transcriptase. Real-time PCR was carried out using the ABI PRISM 7700 Sequence Detection System (Applied Biosystems, Hangzhou, Zhejiang, China), 95°C for ten minutes followed by 40 cycles at 95°C for 15 seconds and at 60°C for one minute. The primers for GAPDH (224 bp) were 5′- TGAAGGTCGGAGTCAACGG -3′ (sense) and 5′- CTGGAAGATGGTGATGGGATT -3′ (antisense). The primers for annexin II (213 bp) were 5′- GATGTGAAACACTTTGCTCCT -3′ (sense) and 5′- ATAGCGACACTTGGATAGGGG -3′ (antisense). The primers for S100A6 (176 bp) were 5′- GGCTGATGGAAGACTTGGACC -3′ (sense) and 5′- TTACCCACCACTGGATTTGACTC -3′ (antisense). The expression of GAPDH was used to normalize that of the target genes. Each assay was done in triplicate, the average was calculated, the expression level of annexin II was expressed as 2–ΔΔCt, where ΔCt = Ct(annexin II)–Ct(GAPDH), and the expression level of S100A6 was expressed as 2–ΔΔCt, where ΔCt = Ct(S100A6) – Ct(GAPDH).

The tissue microarray (TMA), containing 528 cases (436 cancer samples and 92 non-cancer tissue samples), was constructed as described previously [20, 21]. Briefly, formalin-fixed, paraffin-embedded archival tissue blocks with representative regions were selected according to their matching H & E-stained slides. Core tissue cylinders were collected from individual paraffin-embedded gastric tumors (donor blocks) and arranged in recipient paraffin blocks (tissue array blocks). It has previously been proven that staining results obtained from different intratumoral areas in various tumors correlate well, so a core was sampled in each case. From every archival block, one cylinder of 2.0 mm diameter was taken from cancer tissues of each patient from representative areas and transferred to paraffin recipient blocks using a trephine. An adequate case was defined as a tumor occupying >10% of the core area. Four-micrometer-thick sections were consecutively incised from the recipient block and transferred to polylysine-coated glass slides. H & E staining was performed on tissue microarray for confirmation of tumor tissue.

Immunohistochemistry was performed for each antigen to study altered protein expression in 92 non-cancerous gastric tissue controls and 436 gastric cancer tissues [6]. Briefly, TMA slides were baked at 60°C for two hours followed by deparaffinization in xylene and rehydrated in graded alcohol.

The sections were submerged into ethylenediaminetetraacetic acid (EDTA) antigenic retrieval buffer and microwaved for antigenic retrieval, after which they were treated with 3% hydrogen peroxide in methanol to quench endogenous peroxidase activity, followed by incubation with 0.3% bovine serum albumin to reduce background non-specific staining. Sections were incubated with rabbit anti-annexin II (Epitomics Biotechnology Inc, Burlingame, California, USA), or mouse anti-S100A6 (Santa Cruz Biotechnology Inc, Delaware Avenue, California, USA), at 4°C overnight. Negative controls were performed by replacement of the primary antibody with non-reacting antibodies of the same species. After washing, tissue sections were treated with secondary antibody. Slides were stained with 3, 3-diaminobenzidine (DAB) and counterstained with hematoxylin, then dehydrated and mounted. The membrane with annexin II was stained as buffy, while S100A6 was stained as buffy in cytoplasm and nuclei. The degree of immunostaining was scored independently by two pathologists blinded to the clinical outcome of the patients, based on the proportion of positively stained tumor cells and intensity of staining [22, 23]. For each antibody preparation studied, the staining index was calculated as the product of staining intensity score and the proportion of positive tumor cells. The location of immunoreactivity (cytoplasmic, nuclear, or combined) was noted and the proportion of positively staining tumor cells was as follows: 0 for <5% positive tumor cells; 1 for 6% to 25% positive tumor cells; 2 for 26% to 50% positive tumor cells; and 3 for >51% positive tumor cells. Staining intensity was graded according to the following criteria: 0 (no staining); 1 (weak staining = light yellow); 2 (moderate staining = yellow-brown); and 3 (strong staining = brown). We use this method of assessment to evaluate annexin II and S100A6 expression in human nontumor mucosa and malignant lesions by determining the staining index with scores of 0, 1, 2, 3, 4, 6, or 9. An optimal cut-off value was identified as: a staining index score of ≥4 was used to define tumors with high annexin II and S100A6 expression, and a staining index score of ≤3 was used to indicate low annexin II and S100A6 expression.

Statistical analysis was performed using SPSS13.0 software. Measurement data were analyzed using the Student’s t test, while categorical data were studied using the chi-square test or Fisher exact test. The influence of prognostic factors on tumor-related survival was assessed by Kaplan-Meier estimates; the log-rank test was used to compute differences between curves. The multivariate Cox proportional hazard regression model was performed to assess prognostic values of protein expression. Correlation coefficients between protein expression and clinicopathological findings were analyzed using the Pearson correlation method. A value of P < 0.05 was considered statistically significant.

The mRNA expressions of annexin II and S100A6 in gastric tumor tissues and corresponding non-tumor tissues were analyzed using qRT-PCR in a total of 40 pairs of matched tissue specimens. In gastric tumors, the mRNA expression levels of Annexin II were higher in cancer tissues (0.037 ± 0.035) than non-tumor tissues (0.030 ± 0.016, P < 0.05, Figure 1A). The mRNA expression levels of S100A6 were higher (5.884 ± 6.988) than non-tumor tissues (2.883 ± 1.687, P < 0.05, Figure 1B).

Annexin II protein was detected in 18 of 92 (19.57%) human non-tumor mucosa; all samples expressed the protein at low levels. Annexin II protein was detected in 175 of 436 (40.14%) human gastric cancer cases. High expression of annexin II protein was detected in 133 (30.50%) tumors, and low expression was detected in 42 (9.63%) tumors. Annexin II was overexpressed strongly in the cell membrane of primary cancer and weakly in the cytoplasm of carcinoma cells (Figure 2). S100A6 protein was detected in 9 of 92 (9.78%) human nontumor mucosa; all samples expressed the protein at low levels. S100A6 protein was detected in 256 of 436 (58.72%) human gastric cancer cases. High expression of S100A6 protein was detected in 183 (41.97%) tumors and low expression was detected in 73 (16.74%) tumors. S100A6 was predominantly localized in the cytoplasm, while nuclear staining was also detectable in some samples (Figure 3).

The expression of annexin II correlated with age, location of tumor, size of tumor, differentiation, histological type, depth of invasion, vessel invasion, lymph node metastasis, distant metastasis, and TNM stage (P < 0.05) but did not correlate with gender (P > 0.05) (Table 1).

Positive expression of S100A6 correlated with age, location, size of tumor, depth of invasion, vessel invasion, lymph node metastasis, distant metastasis and TNM stage (P < 0.05), but did not correlate with gender, differentiation or histological type (P > 0.05) (Table 2). Factors with possible prognostic effects in gastric carcinoma were analyzed by Cox regression analysis. Statistical analysis showed that depth of invasion (P = 0.029), lymph node metastasis (P = 0.025), distant metastasis (P = 0.016), TNM stage (P = 0.021), expression of annexin II (P = 0.027) and expression of S100A6 (P = 0.011) were independent prognostic factors in patients with gastric carcinoma. However, the location of the tumor, tumor size, histological type, differentiation and vessel invasion had no prognostic value in our Cox’s proportional hazards regression model. It may relate to sample collection so it is critical that large sample and well-designed multicenter studies based on different groups are needed to confirm our results. We further performed the stratified analysis according to different TNM stages and the results confirmed that annexin II was an independent prognostic factor in patients with gastric carcinoma (P = 0.000).

A total of 163 gastric cancer cases had low expression of both annexin II and S100A6, while 158 gastric cancer cases had high expression of both annexin II and S100A6. There was a significant correlation between annexin II and S100A6 (χ 2 = 120.198; P = 0.000) (Table 1).

In stage I, II and III, the five-year survival rates of patients with high expression of annexin II were all significantly lower than in patients with low expression. In stage I, the cumulative five-year survival rate was 87.2% in the low-annexin II expression group, but 75.0% in the high expression group (P = 0.007). In stage II, the cumulative five-year survival rate in the low expression group (70.4%) was higher than in the high expression group (45.5%, P = 0.000). In stage III, the cumulative five-year survival rate was 30.8% in the low expression group, which was higher than in the high expression group (17.7%, P = 0.000). In stage IV, annexin II expression did not correlate with the five-year survival rate and the survival rate was 20.0% in the low expression group and 6.2% in the high expression group (P = 0.074). Cumulative five-year survival rates of patients with high expression of both annexin II and S100A6 was significantly lower than those with low expression of both (12.7% versus 38.3%, P = 0.000). (Figure 4)