Background
Colorectal cancer (CRC) is one of the most common cancers and a leading cause of cancer-related deaths [
1]. According to WHO statistics, there were an estimated 1.2 million cases of CRC in 2008 worldwide. CRC development is a multi-step and multigene process, involving activation and overexpression of oncogenes, and inactivation and downregulation of tumor suppressor genes [
2], which have multiple effects in CRC tumorigenesis, including cell proliferation, apoptosis, invasion, and metastasis. Mutation of the tumor suppresser gene, adenomatous polyposis coli (APC), is one of the most well studied in CRC. Familial adenomatous polyposis (FAP), an autosomal, dominantly inherited disease, can cause the development of hundreds to thousands of colorectal tumors during the second and third decades of a patient’s life [
3]. Germline mutations in APC are identified in approximately 80% of FAP affected individuals [
4,
5]. Many other oncoproteins have been reported to be upregulated or activated in CRC, such as FOXQ1 [
6], PIK3CA [
7], and cyclin D1 [
8]. Although CPE, a prohormone/proneuropeptide processing enzyme, has been reported to be elevated in CRC [
9], its role in tumor development remains poorly understood.
CPE is found primarily in endocrine and neuroendocrine cells, and is a metalloexopeptidase [
10]. It encodes a carboxypeptidase that cleaves C-terminal amino acid residues, and is involved in the biosynthesis of peptide hormones and neuropeptides, which are synthesized as precursors in the rough endoplasmic reticulum. After being packaged into secretory granules, these precursors are processed sequentially, first, by prohormone convertases (PC1/3 and PC2) to remove the carboxyl side of paired basic residues to yield basic residue-extended peptides [
11,
12], then by a subset of soluble CPE to cleave the basic residues to generate biologically active peptide hormones and neuropeptides [
10,
13,
14]. CPE also functions as a prohormone sorting receptor for the regulated secretory pathway (RSP) [
15,
16]. Mice with Cpe mutations, or Cpe knockout mice, exhibit pathophysiological conditions, such as obesity, diabetes, infertility, low bone mineral density, and deficits in learning and memory [
17‐
20]. In humans, deregulated CPE has been associated with numerous diseases, such as diabetes, Alzheimer's disease [
21], and cancers. Horing
et al. found reduced expression of CPE in Glioblastoma, and proposed that CPE functioned as a putative tumor suppressor gene [
22]. Conversely, Murthy
et al. reported that CPE was significantly elevated in many human cancers, and its upregulation was correlated with tumor growth and metastasis [
9]. Therefore, the role of CPE in cancer remains unclear.
In this study, we found that CPE was significantly upregulated in CRC cell lines and tumor tissues. Further investigations revealed that overexpression of CPE led to decreased expression of cyclin-dependent kinase (CDK) inhibitors, p21 and p27, and increased expression of the CDK regulator, cyclin D1. The resulting increase in the S-phase fraction of tumor cells may account for CPE’s role in enhancing cell growth rates and tumorigenicity activity in CRC cells. These results suggest that CPE may be a novel target for CRC therapeutics.
Methods
Ethics statement
For the use of clinical materials for research purposes, samples were obtained with prior written informed consents from the patients and approval from the Institutional Research Ethics Committees of ZengchengPeople,s Hospital (BoJi-Affiliated Hospital of Sun Yat-Sen University) ethics Committee.
Cell lines and tissue specimens
Colorectal cancer (CRC) cell lines, including SW480, SW620, KM12, HCT15, HCT116, Caco-2, and LoVo, were cultured in RPMI 1640 medium (Invitrogen, Carlsbad, CA, US) supplemented with 10% FBS (HyClone, Logan, Utah, US). Tissue specimens were freshly collected from Zengcheng People’s Hospital (BoJi-Affiliated Hospital of Sun Yat-Sen University), and were histopathologically and clinically diagnosed.
Plasmids and antibodies
For overexpression of CPE: human full-length CPE cDNA from HCT116 cells was amplified by PCR and cloned into a pMSCV-puro retroviral vector. For depletion of CPE: two human shRNA sequences were cloned into the pSuper-retro-puro plasmid to generate pSuper-retro CPE shRNA. The following sequences were selected: RNAi#1, CTCCAGGCTATCTGGCAATAA; and RNAi#2, GATAGGATAGTGTACGTGAAT. Anti-CPE (BD, Franklin Lakes, New Jersey, US), anti-β-actin (Sigma, Saint Louis, MI, US), and anti-BrdU (Upstate, Temecula, CA, US) were used for Western blot analysis and bromodeoxyuridine (BrdU) incorporation assays.
Total RNA from cultured cells was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, US), following the manufacturer’s instructions. The cDNA was amplified and quantified using an ABI Prism 7500 Sequence Detection System (Applied Biosystems, Foster City, CA), with SYBR Green I dye (Molecular Probes, Invitrogen, CA Carlsbad, CA, US). The following primers were selected: CPE: CCATCAGCAGGATTTACACG (forward) and TAAATTCAGGCTCACCAGGC (reverse); p21: CGATGCCAACCTCCTCAACGA (forward) and TCGCAGACCTCCAGCATCCA (reverse); p27: TGCAACCGAC GATTCTTCTACTCAA (forward) and CAAGCAGTGATGTATCTGATAAACA AGGA (reverse); Cyclin D1: AACTACCTGGACCGCTTCCT (forward) and CCAC TTGAGCTTGTTCACCA (reverse); GAPDH: ACCACAGTCCATGCCATCAC (forward) and TCCACCACCCTGTTGCTGTA (reverse). Expression data were normalized to GAPDH, and calculated as 2-(C
t
[gene] – C
t
[GAPDH]), where Ct represents the threshold cycle for each transcript.
For the MTT assay: cells were seeded in 96-well plates (2000 cells/plate); at each time point, cells were stained with 100 μl sterile MTT dye (0.5 mg/ml; Sigma, St. Louis, MO, US) for 4 h at 37°C; the culture medium was removed; and 150 μl of dimethyl sulphoxide (DMSO; Sigma) was added. The absorbance was measured at 570 nm; the reference wavelength was 655 nm. For the colony formation assay: cells were seeded in 6-well plates (1000 cells/plate); cultured for 10 days; fixed with ice-cold methanol for 10 min; and stained with 1% crystal violet for 1 min.
Bromodeoxyuridine incorporation assay
Cells were seeded on coverslips (Fisher, Pittsburgh, PA, US) in 24-well plates (5 × 104 cells/plate). After 24 h, the cells were incubated with BrdU for 1 h, and stained with anti-BrdU antibody (Upstate, Temecula, CA, US), following the manufacturer’s instructions. Gray level images were acquired under a laser scanning microscope (Axioskop 2 plus, Carl Zeiss Co. Ltd., Jena, Germany).
Anchorage-independent growth ability assay
Cells (5000 cells/plate) were mixed in 2 × RPMI 1640 with an equal volume of soft agar (Sigma, Saint Louis, MO, US) to give a final solution of 0.3% agar, 1 × RPMI 1640, 10% FBS. The cell-agar mixture was added to the top of the cell-free bottom layer with 1% agar. After 10 days, viable colonies larger than 0.1 mm were counted.
Statistical analysis
Statistical tests for data analyses are Student’s 2-tailed t test. Statistical analyses were performed using the SPSS 11.0 statistical software package. Data represent mean ± SD. P values of 0.05 or less were considered statistically significant.
Discussion and conclusion
In the present study, we found that CPE is elevated in CRC and have suggested a mechanistic role for CPE in the proliferation of CRC cell lines. Furthermore, we proposed that CPE possesses oncogenic functions in CRC development. This is consistent with other studies: Lee
et al. reported that an N-terminal truncated CPE isoform was highly upregulated, and could induce tumor growth. They further suggested its use as a biomarker for predicting metastasis in hepatocellular carcinoma [
23]. By analyzing profile data in the Gene Expression Omnibus (GEO) database (
http://www.ncbi.nlm.nih.gov/geo/), Murthy
et al. found that CPE was elevated in CRC and many other types of human cancer, including hepato-cellular carcinoma, cervical cancer, and kidney cancer [
9]. However, in glioma, CPE expression level appears to be controversial: Liu
et al. analyzed 12 primary brain glioma biopsies using cDNA microarrays, and revealed elevation of CPE expression compared to normal brain tissue [
24]; this was supported by another cDNA microarray study which found elevation of CPE expression in 50 human gliomas of various histogenesis, compared to normal brain tissue samples [
9]. In contrast, a study by Horing
et al. indicated that CPE acted as a tumor suppressor by reducing expression of CPE in a cell death-resistant glioma cell line, and in GBM samples from The Cancer Genome Atlas cohort, compared to normal control brain specimens [
22]. Therefore, regulation of CPE may be different in different types of cancer, and it is not yet possible to define CPE as either a tumor suppressor or an oncogene.
CPE is known to be elevated in many types of human cancer, irrespective of whether they are neuroendocrine tumors, such as lung cancer [
25], or nonendocrine can-cers, such as CRC, as shown by our data and others (Saravana, [
9]). However, the mechanism of CPE upregulation is still unknown. CPE locates at 4q32.3 in the human genome; and duplications of 4q31-qter have been documented in several human diseases [
26‐
28], which may contribute to CPE amplification in cancer. Similarly, CPE upregulation has been reported in cervical cancer, where 70% of cases are correlated with human papillomavirus (HPV) infection [
29], suggesting that CPE upregulation may triggered by viral antigens.
CPE is reported primarily in endocrine and neuroendocrine cells; however, it has now been identified in epithelial-derived cancer cells. CPE functions as a prohormone and neuropeptide processing exopeptidase, and as a regulated secretory pathway (RSP) sorting receptor [
13‐
15]. Consequently, it has important roles in the endocrine and neural systems. In mice, mutation or knockout (KO) of CPE causes deficiencies in peptide hormones and neuropeptides, such as insulin [
17,
19], gonadotropin-releasing hormone, and brain-derived neuro-trophic factor (BDNF) [
30]. CPE KO mice exhibit multiple endocrinopathies leading to obesity, diabetes, and infertility [
19]; however, how CPE promotes tumor progression is largely unknown. In this study, we found that CPE upregulation increased the S-phase fraction of CRC cells, thereby promoting cell growth and tumorigenicity. Further investigation indicated that CPE achieved this pro-proliferation effect by modulating p21, p27 expression and mediating cyclin D1 expression at the mRNA level. To date, CPE has been considered to be an enzyme, and not a transcriptional factor or cofactor. This means that CPE cannot initiate transcription of these cell cycle regulators by itself, and therefore further investigation is needed.
In the current study, we found that ectopic expression of CPE dramatically enhanced, whereas silencing of CPE impaired, growth rates of both CRC cell lines. More importantly, soft-agar assay revealed that the anchorage-independent growth of CRC cells lines significantly enhanced upon CPE upregulation and impaired in response to CPE depletion, suggesting that overexpression of CPE promotes, but downregulation of CPE decreased, the tumorigenicity of CRC cells, which are currently under investigation in our laboratory examined with
in vivo model using CPE-overexpressing and CPE-silenced cells. Meanwhile, Saravana and colleagues have also reported a higher level of CPE in metastatic CRC specimens than primary ones [
9], indicating that CPE involves in tumor metastasis. Therefore, it is also worthy to further investigate the correlation and biological role of CPE in CRC metastasis.
In summary, this study showed that CPE was dramatically elevated in CRC cell lines and tissues samples, compared to normal colorectal epithelial cells and matched adjacent normal tissue (ANT), respectively. Further investigations revealed that upregulation of CPE enhanced cell proliferation and tumorigenicity in CRC cells; whereas downregulation impaired cell proliferation and tumorigenicity, and that this was achieved through regulation of the cell cycle regulators p21, p27, and upregulation of cyclin D1. Understanding the precise role of CPE in CRC progression will increase our knowledge of the biological mechanisms of CRC. Suppression of CPE may offer a novel therapeutic strategy for CRC.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
Conceived and designed the experiments: XCZ GXZ WC. Performed the experiments: XCZ XHL LLL GGW. Analyzed the data: XCZ YCX HFY QLL. Contributed reagents/materials/ analysis tools: XCZ WHL WGH YNH. Wrote the paper: XCZ. All authors read and approved the final manuscript.