Urolithin a attenuates IL-1β-induced inflammatory responses and cartilage degradation via inhibiting the MAPK/NF-κB signaling pathways in rat articular chondrocytes

Urolithin A (CAS No. 1143-70-0) was bought from Cayman Chemical (Ann Arbor, MI, USA). Recombinant rat IL-1β (400-01B) was purchased from (Peprotech, Suzhou, China). Fetal bovine serum (FBS) was provided by Gibco Life Technologies (Grand Island, NY, USA). Antibodies against antiphospho-ERK (#4370), ERK (#9102), antiphospho-JNK (#4668), JNK (#9252), antiphospho-p38 (#4511), p38 (#8690), antiphospho-p65 (#3033), p65 (#8242), COX2 (#12282), iNOS (#13120) Sox-9 (#82630) were bought from Cell Signaling Technology (Danvers, MA, USA). Antibodies against MMP3 (ab52915), MMP13 (ab39012), Collagen II (ab34712), aggrecan (ab36861) were purchased from Abcam (Cambridge, UK). Horseradish peroxidase (HRP)-conjugated glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (ET1702–66) and HRP-linked goat anti-rabbit (HA1001) were supplied by Huabio (Hangzhou, China). Phalloidin was provided by Beyotime (Shanghai, China). Cy3- conjugated goat anti-rabbit secondary antibody (BA1032) and 4′,6-diamidino-2-phenylindole (DAPI) (AR1177) were purchased from Boster (Wuhan, China). Other reagents were of the highest commercial grade and were purchased from Sigma Chemical (St. Louis, MO, USA).

Primary chondrocytes were obtained from knee joints cartilage of 2-week-old Sprague Dawley rats. The detailed procedure was performed according to a previously described method [20]. Briefly, cartilage of the knee joint was isolated and cut into pieces and then incubated in 0.5% trypsin-EDTA (containing 0.5 g/L of trypsin (1:250) and 0.2 g/L EDTA•4 Na in 0.85% saline solution) for 30 min and subsequently 0.2% collagenase for 24 h at 37 °C. The chondrocytes were collected and cultured in Dulbecco’s minimum essential medium: F12 medium containing 10% FBS with humid air with 5% CO₂ at 37 °C. Cells were trypsinized with 0.5% trypsin-EDTA and passaged at a ratio of 1:3 when cell density reaches 75%, and the medium was changed every 2 days. Chondrocytes at passage 3 were utilized in the subsequent experiments.

The Cell Counting Kit-8 (CCK8, Dojindo, Japan) was utilized to analyze cell viability. Firstly, chondrocytes were seeded in 96-well plates at a density of 1 × 10⁴ cells/well. After 24 h of adhesion, cells were then treated with IL-1β alone or with UA at different concentrations. Cell viability was carried out after cultivating for 1, 3, and 7 days. In brief, 10 μl CCK-8 solution dissolved in 100 μl culture medium was added into each well and then incubated in the dark at 37 °C for 1.5 h. The absorbance of the solution was recorded at 450 nm using a plate reader (BioTek, Winooski, VT, USA).

All procedures were performed as previously described [21, 22]. Briefly, the chondrocytes were suspended in medium with 10% FBS, 0.25% penicillin-streptomycin, and 0.25% L-glutamine, and plated at a density of 2.5 × 10⁵ cells/10 μl in 24-well plates. Four hours later, the medium was added into the plate with IL-1β alone or with IL-1β with UA for 2 days. Then the micromasses were stained with Alcian Blue.

Chondrocytes were cultured in a sterile six-well plates at 37 °C with 5% CO₂. After reaching 80% density, the cells were exposed to IL-1β alone or with UA. The total proteins were obtained from stimulated or control chondrocytes using radioimmunoprecipitation assay lysis buffer containing 1% proteinase inhibitor and 1% phosphatase inhibitor cocktail for 30 min on ice at the indicated time points. Protein concentrations were measured using BCA protein assay kits (Boster). Then, 40 μg of protein was separated on 12% sodium dodecyl sulfate-polyacrylamide gels and transferred to polyvinylidene fluoride membranes (Millipore, Burlington, MA, USA), blocked with 5% bovine serum albumin (BSA) in Tris-buffered saline with 0.1% Tween-20 (TBS-T) and incubated with primary antibody (2% BSA in TBS-T) overnight at 4 °C. Subsequently, the membrane was washed with TBS-T and incubated with the corresponding secondary antibodies for 2 h at room temperature. Finally, the protein bands were visualized with western ECL Substrate Kits (Yseasen, Shanghai, China) on a Tanon imaging system, and grayscale images were analyzed with ImageJ (National Institutes of Health, Bethesda, MD, USA)/Olympus (Tokyo, Japan) software.

Total RNA was extracted by a total RNA extraction kit (Omega Bio-tek, Norcross, GA, USA) from chondrocytes exposed to IL-1β alone or with UA in accordance with the manufacturer’s instructions. RNA purity and concentration were determined by a spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Complementary DNA (cDNA) was synthesized from total RNA and amplified with SYBR Green Master Mix in an ABI PRISM 7500 PCR Sequence Detection System (Applied Biosystems, Foster City, CA, USA) according to following condition: 30 s of denaturation followed by 40 cycles of 94 °C for 5 s and 60 °C for 35 s. The melting curve was generated to test for primer dimer formation and false priming for each reaction. Relative expressions of gene-specific products were analyzed using the comparative Ct (2^−ΔΔCt) method and normalized to the reference gene GAPDH. The sequences of primers constructed were as follows: ADAMTS4: forward (CCGTTCCGCTCCTGTAACACTAAG), reverse (AGGTCGGTTCGGTGGTTGTAGG); MMP9: forward (CTACACGGAGCATGGCAACGG), reverse (TGGTGCAGGCAGAGTAGGAGTG); Col2a1: forward (ACGCTCAAGTCGCTGAACAACC), reverse (ATCCAGTAGTCTCCGCTCTTCCAC); GAPDH: forward (GACAATTTTGGCATCGTGGA), reverse (ATGCAGGGATGATGTTCTGG).

Chondrocytes were plated in 12-well plates. When the density reached 80%, the cells were stimulated with IL-1β alone or with UA. Next, cells were fixed in 4% paraformaldehyde for 15 min at room temperature. Subsequently, the cells were permeabilized in phosphate-buffered saline (PBS) containing 0.3% Triton X-100 for 15 min and then blocked with 5% BSA for 30 min. Cells were then incubated with anti-P65 (1:200 dilution) in a humid chamber overnight at 4 °C. The next day, the plates were washed three times with PBS and then incubated with Cy3-conjugated goat antirabbit secondary antibody (1:100 dilution) at 37 °C for 1 h in the dark. Finally, cells were stained with phalloidin and DAPI. Images were acquired using an inverted fluorescence microscope (Olympus) with identical acquisition settings, and the results were statistically analyzed using ImageJ software.

All experimental protocols were approved by the Committee of Ethics of Animal Experiments at Zhongshan Hospital, Fudan University, China. Cartilage explants were obtained from the knee joints of 4-week-old Sprague Dawley rats that were group-housed at 20 ± 5 °C (55 ± 5% humidity) on a 12-h light/dark cycle with free access to standard chow and water. The detailed procedure was described in a published protocol [23]. Initially, the explants were cultured in medium containing 10% FBS at 37 °C with 5% CO₂ for 2 days. Then, the explants were cultured in medium (10% FBS and 0.25% penicillin-streptomycin) containing IL-1β and/or IL-1β with UA for 3 additional days. Next, explants were collected and fixed in 4% paraformaldehyde, sectioned at 6 μm, and stained with hematoxylin and eosin (H&E), Safranine O-Fast Green (S-O Fast green), or Alcian Blue, then we used the Osteoarthritis Research Society International (OARSI) scoring system with double blindness as described previously to evaluate the destruction of articular cartilage, scoring including the matrix staining, cartilage tissue structure, chondrocyte clusters, and surface integrity [24, 25]. Further, Collagen type II and aggrecan were analyzed by immunochemistry and The percentages of Collagen II, Aggrecan positive cells in each section were quantified by Image Pro Plus. All stained sections were imaged using an upright microscope (Olympus).

The experiments were performed at least three times. All data are presented as mean ± standard deviation (SD). Statistical analyses were performed using GraphPad Prism software (GraphPad Inc., San Diego, CA, USA) and SPSS 18.0 (IBM, Armonk, NY, USA). For differences among treatments, Student’s t-tests were used for the comparisons between two groups, and data involving more than two groups were analyzed by one-way analysis of variance followed by Tukey post hoc tests. P values less than 0.05 were considered statistically significant.

First, we examined the potential toxicity of UA on chondrocytes with CCK8 assays. As shown in Fig. 1a, UA had no significant effect on chondrocyte viability and proliferation at concentrations of 1, 5, 7.5, or 15 μM for 1, 3, or 7 days. However, chondrocyte activity decreased by ~ 50% compared with the control group (P < 0.05) when the concentration reached 30 μM, indicating that a high concentration of UA may inhibit cell activity. Therefore, we set the maximum concentration of UA to 15 μM (1, 7.5, 15 μM) for subsequent experiments. When chondrocytes were treated with IL-1β for 1, 3, or 7 days, as shown in Fig. 1b and c, there were no significant changes in cell viability with increasing concentrations of IL-1β (< 30 ng/ml) with and without UA (< 15 μM). To investigate whether UA protects against cell damage induced by IL-1β, cartilage micromasses were co-incubated with 20 ng/ml IL-1β and various concentrations of UA from 1 to 15 μM for 2 days and then stained with Alcian Blue. UA markedly ameliorated IL-1β-induced degradation of cartilage matrix in a dose-dependent manner (Fig. 1d). These results suggest that no marked UA cytotoxicity occurred in chondrocytes, and UA partially protected against IL-1β-induced cartilage matrix degradation.

ECM gene expression levels were detected with RT-qPCR after treatment with various UA concentrations (0, 1, 7.5, 10 μM) for 48 h. MMP9 and ADAMTS4 are matrix-degrading enzymes, and Collagen II could antagonize this effect and promote ECM anabolism. MMPs (MMP3 and MMP13) are catabolic enzymes of Collagen II and Aggrecan. As shown in Fig. 2g and h, MMP9 and ADAMTS4 mRNA expression markedly increased in a dose-dependent manner. UA obviously suppressed the overproduction of MMP9 and ADAMTS4 mRNA induced by IL-1β stimulation. Meanwhile, UA reversed the downregulated gene expression of Collagen II in the IL-1β stimulated condition. However, UA did not affect the expression of these genes at the lowest concentration (1 μM). The effect of UA on IL-1β-induced MMP 3 and MMP13 production were measured by western blot. UA treatment partially reduced protein expression of MMP 3 and MMP13 compared to cells treated with IL-1β alone (Fig. 2a).

To evaluate chondrocyte degeneration, we investigated ECM replacement by chondrocytes under IL-1β stimulation with or without UA pretreatment by western blot analysis. Collagen II and Aggrecan are the two main components of cartilage matrix responsible for the anti-compression and shock absorption capabilities of cartilage under mechanical loading. Fig. 3a-c show that IL-1β significantly decreased protein expression of Collagen II (P < 0.05) and Aggrecan (P < 0.01). However, these alterations were reversed by pretreatment with UA, especially at the highest concentration of 15 μM. The key regulator of Collagen II synthesis is Sox-9, and UA could prevent its degradation induced by IL-1β (P < 0.01, Fig. 3a and d). This result was consistent with the RT-qPCR findings.

Protein expression levels of iNOS and COX-2 were quantified to examine the extent of IL-1β-induced inflammation and evaluate whether it is attenuated by UA. Chondrocytes were pretreated with different concentrations of UA (1–15 μM) for 2 h and then simulated with or without IL-1β (20 ng/ml) for 48 h. Western blotting was performed to detect protein expression of the inflammatory mediators iNOS and COX2. As shown in Fig. 2a, IL-1β stimulation significantly increased iNOS and COX2 production. However, UA inhibited the excessive production of these mediators. Our results demonstrate that UA co-treatment significantly (P < 0.05) and dose dependently decreased the inflammation induced by IL-1β. However, the lowest dose of UA (1 μM) had no protective effects (P > 0.05).

Previous studies have demonstrated that IL-1β could trigger inflammation by activating the mitogen-activated protein kinase (MAPK) pathway [26]. Specifically, MAPK signaling mediates inflammation responses and cartilage degradation in the pathogenesis of OA. To clarify the mechanism of action underlying UA protection, MAPK activity evaluated using western blot analysis. The phosphorylation levels of ERK, JNK, and p38 were significantly upregulated compared to the control group after treatment with IL-1β for 2 h (P < 0.01). Notably, UA could suppress the upregulated phosphorylation of ERK1/2, JNK, and p38 in a concentration-dependent manner (Fig. 4a-d). These results suggest that UA protects chondrocytes against IL-β-induced inflammation injury by inhibiting the phosphorylation of MAPK pathway members.

To further explore the anti-inflammatory mechanism of UA, immunofluorescence and western blot analyses of NF-κB p65 were performed to evaluate the effect of UA on the NF-κB pathway. IL-1β significantly up-regulated p65 phosphorylation (P < 0.01). As expected, UA remarkably inhibited IL-1β-induced NF-κB activation in a dose-dependent manner (Fig. 4a and b). However, it is worth noting that phosphorylated p65 was lower than in the control group and the inhibitory effect of UA did not increase at concentrations > 7.5 μM. Immunofluorescence showed that most p65 was present in the cytoplasm in control cells. However, as shown in Fig. 5a and b, IL-1β treatment significantly increased p65 fluorescence intensity, indicating that NF-κB activation induced its nuclear translocation and subsequent transcription of inflammatory mediators. Moreover, chondrocytes treated with 20 ng/ml IL-1β for 2 h exhibited nearly 80% activated p65 was activated, as demonstrated by an ~ 8-fold increase in fluorescence intensity compared to the control group. However, UA pretreatment inhibited p65 translocation into the nucleus (Fig. 5a and b). This observation was consistent with the western blot results. Collectively, these findings suggest that UA protects chondrocytes against IL-β-induced inflammation injury by inhibiting phosphorylation of a member of the NF-κB pathway (p65).

We used an ex vivo culture model of cartilage explants from nine 4-week-old rats to evaluate effect of UA on cartilage degradation. The cartilage explants were treated with UA (15 μM) with or without IL-1β stimulation (30 ng/ml) for 3 days. The explants were divided into three groups: (1) control, (2) IL-1β stimulated (30 ng/ml), and (3) IL-1β plus (30 ng/ml) UA (15 μM). Histopathological changes in cartilage were evaluated by H&E, S-O Fast green, and Alcian blue staining. As shown in Fig. 6a, h &E and S-O Fast Green staining revealed normal structure of cartilage including smooth and intact surfaces and normal morphology and numbers of well-organized chondrocytes in the control group. However, the IL-1β treated group had apparent morphological changes including rough surfaces (black arrow), clustered and disorganized chondrocytes (black triangle), obvious hypocellularity, and loss of Safranin-O staining compared with the control group. Notably, OARSI scores of the cartilage showed cartilage damage was significantly attenuated by treatment with UA (Fig. 6b). Alcian Blue staining for glycosaminoglycan (GAG) distribution. The control group showed the strongest positive expression of GAG, indicating a sound chondroprotective effect. However, the IL-1β group showed the loss of GAG from the superficial zone to the deep zone of articular cartilage (Fig. 6c). Intriguingly, these changes were slightly decreased by UA. Immunohistochemistry showed that the expression of Collagen II and Aggrecan were reduced by IL-1β (Fig. 6d). Apparently, UA administration could effectively reverse the pathological changes with significantly (Fig. 6, f), which was consistent with the western blot results. Taken together, these results indicate that both the structure and ECM of cartilage tissues were better preserved in the UA-treated group.