Background
Pancreatic ductal adenocarcinoma (PDAC) is a highly aggressive malignancy and one of the leading causes of cancer death worldwide with very poor 5-year overall survival (OS) [
1,
2]. For early stage patients, surgical resection remains the mainstay of treatment, followed by post-operative chemotherapy with or without radiation. Most patients are unfortunately diagnosed with advanced stage, and for patients with early stage disease, relapse is extremely common [
3‐
5]. Therefore, it is imperative to investigate for potential therapeutic strategies by understanding the mechanism of invasion and metastasis of PDAC.
Several microRNAs have been identified to be involved in the oncogenic process, drug resistance, and metastasis of PDAC [
6]. The CpG methylation of microRNA promoter region has been found to be a major mechanism in regulating their expression [
7]. The microRNA miR-200 gene family (including miR-200a, miR-200b, miR-200c, miR-141 and miR-429) which is clustered in two separate chromosomal locations: miR-200a/200b/429 on chromosome 1 and miR-141/200c on chromosome 12, has been characterized with high methylation and low expression in a variety of tumor cells. Downregulation of miR-141, miR-200a, miR-200b and miR-200c have been shown to promote cancer cell proliferation and metastasis in prostate cancer [
8], gastric cancer [
9], hepatocellular carcinoma [
10], head and neck squamous cell carcinoma [
11]. In addition, miR-200c/429 was shown to suppress tumorignecity and invasion of breast cancer stem cells [
12,
13]. A study showed that miR-200a and miR-200b were hypomethylated in pancreatic cancer, distinct from the other findings in other malignancies suggesting that miR-200a/b may promote cell proliferation in pancreatic cancer [
14]. The methylation status of other miR-200 members in PDAC has not been reported yet. Furthermore, most studies exploring the functional role and target genes of miR-200 in PDAC have depended on cell culture experiments with little in vivo characterizations [
15‐
18].
The gene encoded by Wiskott–Aldrich syndrome protein (WASP) interacting protein family member 1 (WIPF1) participates in actin cytoskeleton organization and polymerization that are associated with cell proliferation and invasion [
19‐
21]. WIPF1 binds to a region of Wiskott-Aldrich syndrome protein (WASP) that is frequently mutated in Wiskott-Aldrich syndrome (WAS) [
22,
23]. WAS is associated with high frequency of malignancy especially lymphoma [
24]. WIPF1 was found to be a oncogene in breast cancer, glioma and colorectal cancer [
25]. However, the role of WIPF1 in PDAC is unclear.
YAP/TAZ is a key component of HIPPO signaling pathway that is consisted of a kinase cascade controlling organ size by regulating cell proliferation and differentiation [
26]. While many components of HIPPO pathway are tumor suppressors, YAP/TAZ functions as oncogene by suppressing the contact inhibition, conferring the stemness and stimulating cell growth and metastasis of malignant cells [
27‐
30]. Like WIPF1, YAP/TAZ is overexpressed in several malignancies including PDAC and has also been shown to regulate cytoskeleton organization of cells and cell adhesion [
28,
29].
The aim of this study was to investigate the mechanism by which miR-200 family members regulate the oncologic behaviors of PDAC. We show that miR-141/200c is epigenetically silenced in PDAC both in vitro and in vivo. Furthermore, we identified WIPF1 as a direct target of miR-141/200c and demonstrated that miR-141/200c interacts with the 3′-untranslated region of WIPF1 to inhibit WIPF1-YAP/TAZ pathway in PDAC, finally suppressing PDAC growth and metastasis.
Methods
Patients and tissue samples
This study was approved by the Committee for the Ethical Review of Research, Fujian Medical University Union Hospital (No. 2016-ZQN-34). Human pancreatic cancer samples were collected from patients undergoing surgery at Fujian Medical University Union Hospital, Fuzhou, China, from March 2016 to July 2017. Informed consent was obtained before sample collection. All patients received curative surgery and had histologically confirmed PDAC. None of the patients received neoadjuvant radiation or chemotherapy. The stage of each patient was assessed based on the American Joint Committee on Cancer version 7 (AJCC 7). The tissue samples were placed in liquid nitrogen or RNAlater immediately after dissection and stored at −80C° until DNA and RNA extractions were performed.
Cell culture and drug treatment
The human pancreatic duct epithelial cells (HPDE) and pancreatic cancer cell lines (PANC-1, BxPC-3, HPAF-II and SW1990) were obtained from the Cell Bank, Chinese Academy of Sciences (Shanghai, China) and propagated in our laboratory by culturing in complete growth medium as recommended by the supplier. All cell lines were genotyped for identity by Cell Bank, Chinese Academy of Sciences and tested for ruling out mycoplasma contamination. Cells were incubated at 37 °C in atmospheric conditions of 20% O2 and 5% CO2, treated with 4 μM 5-aza-2′-deoxycitidine (5-Aza-dC) (Sigma, St. Louis, MO, USA) for 3 days, before harvesting for assays for methylation and mRNA expression.
Animals
All animal experimental protocols were approved by the Ethics Committee for Animal Research of Fuzhou General Hospital of Chinese PLA Nanjing Military Command. (No. FZZY-2016-26). The male athymic nude (BALB/c-nu) mice of 4 to 5 weeks and male NOD/SCID mice of 5 weeks were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China) and housed in a pathogen-free facility of Comparative Medicine Center of Fuzhou General Hospital and maintained on a 12-h light-dark cycle. Food and tap water were provided ad libitum.
CpG methylation analysis
Genomic DNA was extracted from tissue samples and cell lines with the QIAamp DNA Mini Kit (QIAGEN, Dusseldorf, Germany) according to the manufacturer’s instructions. DNA concentration and purity were determined based on the absorbance at 260 and 280 nm. A total of 1.5 μg of genomic DNA from each sample was converted with sodium bisulfite using an EZ DNA Methylation-Gold Kit (Zymo research, Orange County, CA, USA) according to the manufacturer’s instructions. PCR primers were designed using Epidesigner (
http://www.epidesigner.com) and are shown in the Additional file
1: Table S1. Polymerase chain reaction (PCR) was performed with the PCR Accessory Set (Sequenom, San Diego, CA, USA) and the following parameters: hot start at 94 °C for 10 min, followed by denaturing at 94 °C for 45 s, annealing at 62 °C for 48 s, extension at 72 °C for 1 min for 10 cycles, then denaturing at 94 °C for 45 s, annealing at 57 °C for 48 s, extension at 72 °C for 1 min for 35 cycles and final incubation at 72 °C for 3 min. Unincorporated dNTPs were dephosphorylated using the MassCLEAVE Kit (Sequenom). The reaction mixture was incubated at 37 °C for 20 min and shrimp alkaline phosphate (SAP) was then heat inactivated for 5 min at 85 °C. After SAP treatment, 2 μl of the PCR products were used for in vitro transcription and RNase cleavage in accordance with the manufacturer’s instructions (Sequenom). The samples were conditioned and spotted on a 384-pad SpectroCHIP (Sequenom) using the Sequenom MassARRAY platform (CapitalBio, Beijing, China), based on the matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry. Mass spectra were acquired via MassARRAY Compact MALDI-TOF (Sequenom) and the methylation ratios were generated by the EpiTyper software (Sequenom).
Quantitative real-time PCR (qRT-PCR)
Total RNA was extracted from cells or fresh-frozen tissues with TRIzol reagent (Invitrogen, San Diego, CA, USA) by following the manufacturer’s protocol. The miR-200c and miR-141 levels were quantified by qRT–PCR using TaqMan assay kits (Applied Biosystems, Foster City, CA, USA) with U6 small nuclear RNA as an internal normalization reference. WIPF1, ZEB1, E-Cadherin and Vimentin mRNA was measured by qRT–PCR using a SYBR Premix Ex Taq (Takara, Dalian, China) and normalized for GAPDH expression. The qRT-PCR reactions were performed using an ABI Stepone plus Real-Time PCR System (Applied Biosystems). The primer sequences are listed in the Additional file
1: Table S2.
Oligonucleotide transfection and sequences of miR-141/200c mimics and anti-miR141/200c mimics
All RNA oligoribonucleotides, including miR-200c mimic, miR-141 mimic, negative control mimic (NC), miR-141/200c inhibitors (anti-miR-141 and anti-miR-200c) and their NC were obtained from Genepharma (Shanghai, China) and their sequences are shown in the Additional file
1: Table S3. The short hairpin RNA (shRNA) sequence for human WIPF1–1 was 5’-GGCCAACAGGGATAATGATTCTTCAAGAGAGAATCATTATCCCTGTTGGCCTT-3′ and WIPF1–2 was GGGAAAGCAGATTCTACTTCCTTCAAGAGAGGAAGTAGAATCTGCTTTCCCTT. Negative Control shRNA vector (Genepharma) was used as a control for RNA interference. The oligonucleotide transfection was performed using the Lipofectamine 2000 reagent (Invitrogen) and transfection was performed according to the manufacturers’ recommendations.
Lentivirus production and transduction
Human miR-141 mimics, miR-200c mimics and WIPF1 shRNA oligonucleotides were designed and cloned into the LV3-pGLVH1/GFP + Puro vector (GenePharma). The coding sequence of WIPF1 without its 3’-UTR was amplified and cloned into another lentiviral expression vector, LV5-pGCMV/MCS/EF1a/GFP + Puro vector (GenePharma), to produce WIPF1. BxPC-3 and PANC-1 cells were infected with lentiviruses following the instructions of the GenePharma Recombinant Lentivirus Operation Manual. At 72 h after lentivirus infection, the medium was replaced with fresh medium containing puromycin to select for stably infected cells.
Luciferase reporter assay
The region of the 3′-untranslated region (UTR) of human WIPF1 containing three putative miR-200c binding sites and one putative miR-141 binding site were selected to generate four mutant variants (TargetScan, Additional file
1: Figure S1A and B). Mutant 3’-UTR of human WIPF1 mRNA was generated by site-specific mutagenesis of the wild-type 3’-UTR segment of human WIPF1 mRNA using altered sequence in the complementary site (Additional file
1: Table S1B). The wild-type (WT) and four mutant variants (MUT) derived from the 3’-UTR segment of human WIPF1 mRNA were amplified and subcloned into restriction sites downstream of the luciferase reporter gene in the pmirGlo-vector (GenePharma). Luciferase activities were assayed using a Dual-Luciferase Reporter Assay system (Promega, Madison, WI, USA) according to the manufacturer’s instructions. Transfections were performed in duplicate and repeated at least three times in separate experiments.
Cell proliferation assay
Cell proliferation was evaluated using the Cell Counting Kit-8 (CCK-8, Dojindo, Tokyo, Japan). BxPC-3 and PANC-1 cells were seeded in 96-well culture plates at 5 × 103 cells/well, transfected with the indicated miRNA and incubated for 1, 2, 3, 4 and 5 days. After washed in PBS, 100 μl medium containing 10% CCK-8 solution was added to each well and incubated for 2 h at 37 °C. Samples are read directly in the wells using an absorbance of the 450 nm wavelength by an enzyme linked immunosorbent assay (ELISA) plate reader.
Migration and invasion assays
Cell migration and invasion were measured by a Transwell migration plates (24-well, 8 μm pore size, Corning Costar, NY, USA) and chamber invasion assay (Matrigel-coated membrane, Corning Costar). The upper chamber contained pancreatic cancer cells in serum-free medium, and the lower chamber contained culture medium with 10% fetal calf serum. After incubation for 8 h (for migration assay without Matrigel-coated membrane) or 24 h (for invasion assay with Matrigel-coated membrane) at 37 °C, non-invading cells were removed with cotton swabs, and cells that had invaded to the underside of the membrane were stained with 0.1% crystal violet. Then, the invaded cells were counted under an inverted microscope.
In vivo tumorigenicity assay
Pancreatic cancer cells (1 × 107 cells in 100 μl PBS) were injected subcutaneously into the right axilla of each male athymic nude mice. The length (L), width (W) and height (H) of the tumors were measured weekly. The tumor volume (V) was calculated using the following formula: V = (L × W × H) × 0.5. Mice were sacrificed 28 days after the injection. Tumors were removed and weighed. Each group contained at least five animals.
An in vivo metastasis model was established as previously described [
31]. Pancreatic cancer cells (1 × 10
6 cells in 50 μl PBS) were injected into the spleens of NOD/SCID mice. Ten weeks after the injections, the animals were sacrificed under deep anesthesia (pentobarbital sodium [30 mg·kg
− 1]) and the liver and lungs were harvested. Tumor metastases were quantified by counting the number of metastatic colonies on one histological section at the middle portion of each liver or lung sample. Each group contained at least five animals.
Western blot
Western blotting of WIPF1, YAP and TAZ in pancreatic cancer cells was with the methods described previously [
32].
The cancer genome atlas (TCGA) data analysis
RNAseq and clinical data of 177 patients defined by the TCGA pathologist as PDAC were obtained from the TCGA Data Portal (
https://tcga-data.nci.nih.gov). All data were downloaded from the November 22, 2017 standard dataset. For RNAseq data, expression levels were TPM-normalized and ENSG-ID transformed.
Statistical analysis
Quantitative data were expressed as the mean ± standard deviation (SD) and analyzed with variance and Student’s t-test. The relationships between the expression of miRNA and the level of DNA methylation were analyzed with a Spearman correlation coefficient. The Kaplan–Meier method was used to analyze the overall survival (OS) of patients from the TCGA database for correlation with WIPF1 expression, and statistical significance was calculated using the log-rank test. All statistical analyses were performed using SPSS statistical software version 19.
Discussion
MicroRNA miR-141 and miR-200c are upregulated in several malignancies while downregulated in several others, playing dual regulatory roles on cell growth and differentiation, tumor invasion and metastasis, depending on the cellular context. For example, miR-141/200c is downregulated in triple negative breast cancer and its overexpression stimulates its invasive and migratory property [
34]. In non-small cell lung cancer, high expression of miR-141/200c was associated with worse survival [
35]. While in renal cell carcinoma, miR-141/200c suppresses cell proliferation and metastasis by targeting EphA2 [
36]. In PDAC, miR141 and miR-200c are downregulated and target several genes including YAP1 [
17], as well as MAP4K4, MUC1, and TM4SF1 [
37]. All these indicate that miR-141 and miR-200c play important roles in regulating cell growth and differentiation as well as metastasis.
We show that the CpG methylation in the promoter region was responsible at least in part for the downregulation of miR-141/200c expression in human PDAC. This was further confirmed by the restoration of miR-141/200c expression by the demethylating agent 5-azacitidine-dC in PDAC cell lines. In contrast, the other cluster of miR-200 family members including miR-200a, miR-200b and miR-429 were hypomethylated in PDAC, suggesting that the different cluster of the same microRNA family may play opposing roles.
We focused our study on the roles of miR-141/200c in PDAC and demonstrated that miR-141 suppressed the cell proliferation and tumor growth of PDAC in in vitro and in xenograft model. Interestingly, our data showed the lack of inhibition on cell proliferation by miR-200c, despite both microRNAs displayed the inhibitory effect on tumor cell invasion, migration, metastasis as well as expression of WIPF1. This suggests that the inhibitory effect on the cell proliferation and the metastasis of PDAC by miR-200c may be two separate and decoupled mechanisms independent of each other and miR-200c is a key regulator for the metastasis but not for primary tumor growth, similar to a previous study [
38]. This is consistent with that two transmembrane mucins involved in invasion and metastasis, MUC4 and MUC16, are targeted by miR-200c [
18]. A previous study also showed that miR-141 inhibited invasion and migration of PDAC cells but not proliferation [
16]. There are likely other unidentified factors that are involved in the miR-200c dependent regulation of primary tumor growth. Importantly, we showed that both miR-141 and miR-200c suppressed the expression of EMT markers while stimulating the expression of tumor suppressor E-cadherin.
Using TargetScan program, we identified WIPF1 as a direct target of miR-141/miR-200c. The 3’-UTR of WIPF1 contains the miR-141 and miR-200c binding sites and the deletion of this 3’-UTR from WIPF1 rendered its expression no longer responsive to the suppression by miR-141/miR-200c. Consistent with this, our data with 37 PDAC cases showed that the expression of miR-141/200c and WIPF1 in human PDAC inversely correlated. WIPF1 binds to the untranslated region of WASP and stabilize its expression [
22]. The mutations on the WIPF1 binding site of WASP cause Wiskott-Aldrich syndrome (WAS) with increased susceptibility to leukemia and lymphoma [
22]. WIPF1 participates in actin cytoskeleton organization and polymerization that are required for the epithelial-to-mesenchymal transition (EMT) [
19‐
21]. Our data show that silencing of WIPF1 blocks tumor growth and metastasis while high expression of WIPF1 in human PDAC was associated with inferior patient survival, consistent with the previous study that high expression of WIPF1 was associated with poor survival in other types of malignancy [
25,
39]. These findings indicate that WIPF1 harbors characteristics of an oncogene and plays important role in promoting tumor growth and metastasis.
Importantly, our study shows that miR-141 and miR200c suppress YAP/TAZ expression by repressing the expression of WIPF1. Forced expression of WIPF1 stimulated the expression of YAP/TAZ and overcame the suppression of YAP/TAZ by miR-141/200c, consistent with a previous study that showed WIPF1 stimulated tumor growth by enhancing YAP/TAZ stability [
32]. The YAP/TAZ complex is a key complex of HIPPO pathway and participates in the regulation of other critical signaling transduction pathways such as Wnt/beta-catenin and may serve as a common endpoint of several pathways leading to malignant progression [
30,
40‐
44]. By silencing miR-141/200c, PDAC hijacks a physiologic regulatory checkpoint that is key to preventing deregulated cell growth.
Acknowledgements
The authors thank Wei Zheng (Department of Pathology, Fujian Medical University, Fuzhou, China) for providing histological technology and analysis. The authors also thank He-ping Zheng, Yuan Dang, Fu-li Wen and Lai-en Xue for their help with the animal studies at the Comparative Medicine Center of Fuzhou General Hospital.