Background
Gastric cancer is estimated to account for about 10% of invasive cancers worldwide and is the second leading cause of cancer deaths. Although the incidence of gastric cancer has been decreasing, it remains a common malignancy worldwide, especially in Asia [
1]. Patients with gastric cancer frequently experience recurrent tumors, even after a curative surgical resection, because gastric cancer is frequently diagnosed at an advanced stage. Surgical treatment alone is not useful for patients with local and distal recurrences. Therefore, another therapeutic modality might be useful to prevent the recurrence of advanced gastric carcinoma. The National Comprehensive Cancer Network (NCCN) guidelines on gastric cancer treatment recommend radiotherapy as a standard treatment for patients with a high risk of recurrence, which is also supported by the clinical trial INT0116 [
2]. Because gastric cancer has limited sensitivity to radiotherapy, a radiosensitizer is needed to overcome this problem.
It has been reported that antagonists of cyclooxygenase 2 (COX-2), epidermal growth factor receptor (EGFR), and vascular endothelial growth factor (VEGF) can act as radiosensitizers to enhance therapeutic sensitivity in many tumors [
3‐
6]. Although associated with cell proliferation, invasion, angiogenesis and metastasis, nuclear factor κB (NF-κB) has been closely linked with radioresistance in multiple tumors [
7,
8]. Numerous studies suggest that prosurvival signaling mediated by NF-κB is linked to radiation resistance and poorer clinical outcomes among many cancers. Helen
et al. reported that activation of β-adrenoceptors (β-ARs) and the subsequent stimulation of COX-2 and VEGF expression was perhaps an important mechanism in the tumorigenic action of nicotine in colon tumor growth [
9]. It is not yet known whether propranolol (a β-AR antagonist) can be used as a radiosensitizer. The goal of this study was to investigate radiosensitizing activities of propranolol in human gastric cancer cell lines and to determine its precise signaling pathway.
Methods
Cell culture and drug treatment
Two human gastric adenocarcinoma (HGC) cell lines, BGC-823 and SGC-7901, were established in the People's Hospital of Peking University and China and No.6 Hospital of Shanghai, China, respectively. These two human gastric cancer cell lines were obtained from the Medical Center Laboratory of Xi'an Jiaotong University (Xi'an, China). Both cell lines were cultured in complete Dulbecco's modified eagle medium (Gibco, Grand Island, NY) containing 10% (v/v) heat-inactivated fetal bovine serum (Gibco, Grand Island, NY), penicillin (100 U/mL) and streptomycin (100 mg/mL), and they were maintained in a 37°C humidified incubator supplying 5% CO2. When cells reached the logarithmic phase, they were treated with isoproterenol (25 μmol/L) or propranolol (50 μmol/L). The concentrations of drugs were chosen from our previous research. The β-AR antagonist propranolol and the β-AR stimulator isoproterenol were purchased from Sigma Chemical. After 24 h of drug exposure, untreated and drug-treated cultures were irradiated at different doses (0, 2, 4, 6, 8 and 10 Gy). X-irradiation was performed with an X-ray generator (Elekta Precise Linear Accelerator, UK) at 4 Mev with a source-skin distance of 100 cm and at a dose rate of 200 cGy/min.
Cell survival analysis
Colony formation assays were used to quantify the cytotoxicity of gastric cancer cells induced by treatments. The cells were plated in six-well plates (Costar, USA) at low densities. After overnight culture, the cells were treated as described above. The treated cells were cultured until colonies formed. The colonies were washed with PBS and stained with a crystal violet dye. The surviving fraction of each irradiation dose was calculated as the total number of colonies/(total cells inoculated×plating efficiency). A dose-survival curve was obtained for each experiment and used for calculating several survival parameters. Parallel samples were set at each radiation dosage.
Cell apoptosis analysis
To detect phosphatidylserine externalization (on the surface of cell membrane), an indicator of early apoptosis, flow cytometry (FCM, BD Biosciences, USA) was performed with PI and fluorescein isothiocyanate (FITC)-labeled Annexin V (Joincare Biosciences, Zhuhai, China) [
10]. After treatment, the remaining intact cells were incubated at 37°C for 24 hr, and then the cells were washed with cold PBS at 4°C. After centrifugation at 1500 rpm for 5 min, 500 μL of 1×binding buffer, 5 μL of FITC-labeled Annexin V and 10 μL of PI were added to the cell suspension and gently mixed. After incubation at 25°C for 10 min in the dark, the cells were analyzed by FCM.
Real-time reverse transcription polymerase chain reaction (real-time RT-PCR)
Total RNA was extracted from cultured cells by Tri-Reagent (Sigma, MO, USA). To eliminate DNA contamination, extracted RNA was treated with a genomic DNA elimination mixture. Subsequently, the purified RNA was reverse transcribed to cDNA. Expression of β1- and β2-AR mRNA was quantified by RT-PCR (Applied Biosystems, Inc., Foster City, CA). The expression of COX-2, VEGF and EGFR was quantified using a real-time RT-PCR kit from Takara (Takara Biochemicals, Japan). Briefly, following a pre-heating step at 95°C for 10 min, the reaction was carried out using an Icycler (Bio-Rad, Hercules, CA) at a melting temperature of 95°C for 15 sec and an annealing temperature for 1 min for 40 cycles. The primer sequences and annealing temperatures for the six genes studied are given in Table
1. Primers were designed according to Genbank, NCBI. For validation, each experiment was done in triplicate.
Table 1
The primer sequences and annealing temperatures for the seven genes studied
β-actin | 60 | Forward Reverse | ATCGTGCGTGACATTAAGGAGAAG AGGAAGGAAGGCTGGAAGAGTG | 179 | NM_001101 |
β1-AR | 60 | Forward Reverse | GGGAGAAGCATTAGGAGGG CAAGGAAAGCAAGGTGGG | 270 | NM_000684 |
β2-AR | 60 | Forward Reverse | CAGCAAAGGGACGAGGTG AAGTAATGGCAAAGTAGCG | 334 | NM_000024 |
COX-2 | 57 | Forward Reverse | TTGACCAGAGCAGGCAGATG CCAGAAGGGCAGGATACAGC | 171 | NM_000963.2 |
VEGF-A | 57 | Forward Reverse | CTGGGCTGTTCTCGCTTCG CTCTCCTCTTCCTTCTCTTCTTCC | 140 | NM_001025370.1 |
EGFR | 53 | Forward Reverse | AGG ACA GCA TAG ACG ACA C AGG ATT CTG CAC AGA GCC A | 90 | NM_005228.3 |
Western blot assay
The primary antibodies recognizing the β1-adrenergic receptor and β2-adrenergic receptor were purchased from Abcam (Cambridge, Mass). Antibodies recognizing COX-2, VEGF, NF-κB (p65), and EGFR were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). The nitrocellulose membrane was purchased from Millipore (Bedford, Mass). The BCA assay kit and the chemiluminescence kit were purchased from Pierce (Rockford, Ill). Equal amounts of protein (20 mg) of each sample, quantified by the Bradford method, were electrophoresed on 10% SDS-PAGE and electrotransferred onto nitrocellulose membranes (400 mA for 2 hr) using a Bio-Rad Mini PROTEAN 3 System (Hercules, CA) according to the standard protocol. Wet transfer was used for EGFR protein, and semi-dry transfer was used for other proteins. The nitrocellulose membranes were then blocked with TBS containing 10% milk powder and 0.1% Tween-20 at 37°C for 4 hr. Subsequently, the membranes were incubated with a 1:200 dilution of the primary antibodies for β1-AR, β2-AR, COX-2, VEGF, EGFR and NF-κB (p65), and a 1:500 dilution of anti-β-actin at 4°C overnight. An antibody against rabbit or mouse IgG was used as the secondary antibody corresponding to the appropriate primary antibody. Immunopositive bands were examined by an enhanced chemiluminescence (ECL) detection system (Amersham Bioscience, Piscataway, NJ, USA), and the images were transferred onto an X-ray film according to the manufacturer's instructions.
Statistical analysis
The results were expressed as the mean ± S.D. Statistical differences were estimated by one-way analysis of variance (ANOVA) followed by Dunnett's test. Those p values that were less than 0.05 were considered statistically significant. Analysis of the data and plotting of the figures were performed with the aid of software (Origin Version 7.5 and SPSS Version 13.0).
Discussion
Gastric cancer is one of the major causes of cancer mortalities in the world, and radiotherapy is an important treatment for gastric cancer patients with a high risk of recurrence. As we know, radiosensitizers have played a key role in radiotherapy. In recent years, many researchers have focused on antagonists of VEGF, COX-2 and EGFR expression as radiosensitizers [
3‐
6], all of which have the ability to enhance the sensitivity to radiation. Helen
et al. reported that β-ARs and the downstream COX-2 and VEGF genes played an important role in colon tumor growth [
9]. This suggests that propranolol (β-AR antagonist) may act as a radiosensitizer of gastric cancer. To our knowledge, this study was the first to determine the propranolol radiosensitizing activities in human gastric cancer cell lines and to investigate its precise signaling pathway.
Based on results from the colony-forming assays, propranolol and irradiation cooperated to yield fewer and smaller colonies, suggesting that there was radiosensitization in the SGC-7901 and BGC-823 cell lines. In addition, propranolol showed a synergism of growth inhibition in combination with irradiation in SGC-7901 and BGC-823 cells. On the contrary, isoproterenol demonstrates anti-irradiation effects, which led to higher survival rates than treatment with irradiation only by using isoproterenol before irradiation. Furthermore, the apoptosis assays show that the combination of propranolol and irradiation leads to higher apoptosis rates compared with irradiation only. In addition to this, less apoptosis was observed in comparison to the irradiation-only group caused by pre-treatment of isoproterenol. The apoptosis rates of these three groups are higher than the control group. These results suggest that propranolol (β-adrenergic receptor antagonist) might be a useful irradiation sensitizer in gastric cancer therapy. Guidelines of the NCCN on gastric cancer treatment show that radiotherapy is a standard treatment for gastric cancer patients. Taken together, radiotherapy in combination with propranolol can be more useful for patients with a high risk of recurrence in gastric cancer.
Investigation of the specific mechanisms of NF-κB activation by radiation is currently a rapidly expanding field of research. It has been reported that NF-κB plays a key role in cellular protection against a variety of genotoxic agents including irradiation [
11]. Radiation activates NF-κB activity in cancer cells, thus making the cells radioresistant [
12]. Activation of NF-κB by various stimuli, including inflammation, stress and radiation, involves degradation of the inhibitory subunit and translocation of activated NF-κB to the nucleus to regulate transcription [
13,
14]. Our results demonstrated that treatment of BGC-823 and SGC-7901 cells with propranolol reduced the levels of NF-κB, suggesting that cellular radiosensitivity is increased by propranolol-induced NF-κB inhibition. It has been shown that NF-κB is involved in the modulation of expression of several proinflammatory, prometastatic and proangiogenic genes, including COX-2, EGFR and VEGF [
15]. Anti-apoptotic COX-2 is an enzyme that converts arachidonic acid to prostaglandins and is inducible by radiation [
16,
17]. It is reported that COX-2 inhibitors act as radiosensitizers in brain tumors [
3]. EGFR is a member of the ErbB family of receptors. Its stimulation by endogenous ligands, EGF or transforming growth factor-alpha (TGF-α), results in activation of intracellular tyrosine kinases and promotes cell cycle progression. EGFR was shown to play an influential role not only in cellular growth and differentiation in healthy tissues, but also in tumorigenesis and the progression of malignant disease [
18]. Now, in most studies, EGFR inhibitors are given as a radiosensitizer to enhance the effect of radiotherapy [
19‐
21]. VEGF is thought to be a critical angiogenic factor for endothelial cell proliferation and blood vessel formation. Thus, interfering with VEGF signaling has become a major strategy to inhibit tumor growth and spread [
22,
23]. It has been shown that anti-angiogenic agents combined with radiotherapy improved tumor oxygenation and increased treatment efficacy by killing both cancer and endothelial cells [
24]. It is well accepted that the expression of EGFR, VEGF, and COX-2 is regulated by NF-κB [
25‐
27]. In the present study, propranolol radiosensitization effects were found to be associated with changes in the levels of COX-2 and EGFR and VEGF signaling molecules. It was observed that propranolol can act as a radiosensitizer, which occurred via inhibition of β-ARs and subsequent reduced NF-κB DNA-binding activity, which concomitantly inhibited the expression of COX-2, EGFR and VEGF genes. In this way, propranolol can enhance the effect of radiotherapy on gastric cancer.
These findings, along with the present experimental data, strongly suggest that propranolol, a β-adrenergic receptor antagonist, plays an important role in the radiotherapy of gastric cancer. The present study demonstrates for the first time that β-adrenergic inhibition can enhance the effect of radiotherapy on gastric cancer cells in vitro through the downregulation of NF-κB and modulation of downstream COX-2, EGFR and VEGF gene expression. Furthermore, there is an opposite effect caused by isoproterenol (β-adrenergic receptor agonist) administration. These data suggest that blockade of β-AR-stimulated signaling pathways could have therapeutic implications for augmenting the sensitivity of radiotherapy on gastric cancer.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
XC and XL designed the study, coordinated the work and drafted the manuscript. HLo, HLi and PC did the cytological work, helped with irradiation tests, performed Western blots and PCR. WZ coordinated the work, interpreted the data and helped drafting the manuscript. All authors read and approved the final manuscript.