Isolation and characterization of a strain of Lichtheimia corymbifera (ex Absidia corymbifera) from a case of bovine abortion

The aborted fetus and placenta were chilled and referred to our laboratory within 12 hours from the abortion, together with the blood samples from the aborted cows.

Histological examinations were performed on fetal tissue samples including skin, heart, lung, liver, spleen, kidney, fetal stomach and placenta collected during the necropsy and fixed in 4% buffered formalin (Bio-Optica). The samples were routinely processed and stained with hematoxylin and eosin (HE) for histopathological evaluation. To investigate the presence of fungi, periodic acid Schiff reaction (PAS) and Grocott's Methenamine Silver stain (GMS) were also performed on tissue sections.

Bacteriological examination was performed on fetal spleen, liver, kidney, lung, heart, skin, stomach content and placenta on blood agar (5% bovine erythrocytes) and Mc Conkey agar (DIFCO) and incubated for 24-48 hours at 37°C in air. The fetal stomach content was specifically cultured for the isolation of Brucella spp. on 5% blood agar and incubated in microaerophilic (5% CO₂) environment.

Mycological culture was performed on fetal spleen, liver, kidney, lung, heart and placenta on Sabouraud agar (DIFCO), and incubated for 24-48 hours at 37°C in air.

Melezitose assimilation was performed using ID32C strip (bioMérieux, Marcy l'Etoile, France) as reported by Schwarz and coll. [16].

Serological examinations for the main infectious abortive agents were performed on blood sera from aborted cows. Moreover, during the necropsy of the fetus, 1 ml of blood from the atrial chambers of the heart was taken. The serological examination of the blood samples to investigate the presence of antibodies against abortive agents was performed for Brucella abortus by card test agglutination (Brucelloslide Test, bioMérieux), Neospora caninum by indirect immunofluorescence, Chlamydophila abortus by ELISA (Civtest Bovis Chlamydia ps., Hipra), Bovine Viral Diarrea (BVD) virus by seroneutralization, Coxiella burnetii by ELISA (Chekit Q Fever antibody ELISA test kit, IDEXX), and Leptospira serovar sejroe-hardjo, australis-bratislava, pomona-pomona, icterohaemorrhagiae-copenhageni by microagglutination test. ELISAs were performed following manufacturer instructions. Seroneutralization, indirect immunofluorescence and microagglutination test were performed following our in-house protocols.

Virological examination was performed on fetal spleen and lung tissues by direct ELISA (ELISA BVD/MD antigen mix screening, Pourquier) following manufacturer instructions to assess the presence of BVD virus.

Molecular identification and characterization was performed on isolated fungal mycelia. Genomic DNA extraction, PCR and RFLP were performed as described by Machouart and coll. [17]. Specific sense primers for Rhizopus spp., Rhizomucor spp., Mucor spp., and Lichtheimia corymbifera (RpL1, 5' TGATCTACGTGACAAATTCT 3'; RmL1, 5' TGATCTACGCGAGCGAACAA 3'; MucL1, 5' TGATCTACGTGACATATTCT 3'; and AbsL1, 5' TGATCTACACGGCATCAAAT 3', respectively) were used with a degenerate antisense primer (MR1, 5' AGTAGTTTGTCTTCGGKCAA 3'). The region selected for the design of primers excluded the amplification of human DNA and other filamentous fungi. Primers Lap (5' GAAACTGCGAATGGCTCATTA 3') and Rap (5' CAATCCAAGAATTTCACCTCT 3') designed to amplify all the fungi and the human DNA were used as positive controls.

The amplicon was also sub-cloned into the 2886 bp pTZ57R/T vector (Fermentas, Glen Burnie, USA) and subjected to RFLP analysis with AclI restriction enzyme.

Cotyledons appeared thickened, firm and necrotic, whereas intercotyledonary chorioallantois showed brown exudate and moderate hyperemia (Fig. 1A). Multifocal and coalescing white, raised and dry plaques were present in the skin of the fetus, mainly localized on the head (periorbital regions) and on the back (Fig. 1B). Small, white, raised plaques were occasionally seen also in the skin of the abdomen, legs and tail. No gross lesions were present in the other organs.

Microscopically, mild necrotizing placentitis and vasculitis, mainly localized on the cotyledons, were evident in the placenta and in the larger vessels at the base of the cotyledons. Numerous fungal hyphae morphologically consistent with Zygomycetes were present in the grossly evident placentar lesions (Fig. 2A and 2B). Hyphae were elongate, filamentous, 6 to 15 μm in diameter and strongly PAS and GMS positive. Skin lesions were characterized by spread multifocal areas of orthokeratotic hyperkeratosis, oedema and rare infiltrate of lymphocytes in the superficial derma.

Rare single hyphae were also present within the skin lesions. No other relevant alterations were detected in the other organs.

Non-haemolytic, non-pathogenic Escherichia coli has grown up from liver, spleen, kidney, heart and lung. After 6 days, these plates were still negative for Brucella spp. growth. Colonies with typical morphological features of fungi grew up on Sabouraud agar after 24 hours of aerobic incubation from fetal skin and placenta. Colonies were fast growing, white at first becoming pale grey with age, and up to 1.5 cm high (Fig. 3A), woolly to cottony in aspect. The reverse side was uncoloured and without pigment production. On the colonies a direct microscopic examination with Cotton Blue staining showed a large number of nonseptate hyphae, with a diameter of 6 to 15 μm. Specialised hyphae sporangiophores, hyaline or faintly pigmented in colour and simple or branched, arised in groups of three at the internodes (Fig. 3C). Sporangiophores showed relatively small sporangia (20-120 μm of diameter), typically pyriform in shape with characteristic conical-shaped columella and pronounced apophysis (Fig. 3B), often with a short projection at the top, morphologically consistent with Lichtheimia corymbifera [18, 19]. Sporangiospores were ellipsoid, light grey coloured and smooth-walled (Fig. 3D). They were detected in the sporangium and released to the surrounding area. The presence of rhizoids was not observed. Moreover, the isolate was not capable to utilize melezitose as sole carbon source.

Regarding the serological and virological results, all the blood samples were negative for antibodies against Leptospira serovars tested, BoHV-1, Brucella abortus and Chlamydophila abortus. The mother of the examined fetus was seropositive at low titre for BVDV antibodies. One of the other aborted dams was seropositive for Neospora caninum and the third one was seropositive for BVDV, Neospora caninum and Coxiella burnetii. The serological analyses on the fetal blood sample were negative for the abortive agents tested. The ELISA performed on fetal tissues for BVD virus gave negative result.

An expected specific amplicon of 824 bp was obtained only with the set of primers specifying for Lichtheimia (ex Absidia) corymbifera. In contrast none amplification products were obtained when primers for Rhizopus spp., Rhizomucor spp. and Mucor spp. were applied (Fig. 4A). The 824 bp amplicon was sub-cloned into pTZ57R/T vector and both the 824 bp PCR amplicon (Fig. 4B) and the subcloned amplicon (Fig. 4C) were analyzed by RFLP with AclI restriction enzyme. AclI digestion generated 2 restriction fragments of 518 and 306 bp for the 824 bp PCR amplicon and 3 fragments of 1846, 1481 and 373 bp for the subcloned 824 bp amplicon. In both cases the restriction pattern corresponds to Lichtheimia corymbifera (Fig. 4D). Sequencing of the 824 bp cloned fragment further confirmed the specificity of the amplicon and the absence of hypothetical polymorphisms or mutations.