PARP inhibitor exerts an anti-tumor effect via LMO2 and synergizes with cisplatin in natural killer/T cell lymphoma

Olaparib and niraparib were purchased from Selleckchem (China). Fluzoparib was a gift from Jiangsu Hengrui Pharmaceuticals Co., Ltd. (Jiangsu, China). Pamiparib was a gift from Beigene (Beijing) Biotechnology Co., Ltd. (Beijing, China). All of the drugs were dissolved in dimethyl sulfoxide to obtain a stock solution of 10 mM and stored at − 80 °C. Cisplatin was obtained from Jiangsu Hausen Pharmaceutical Co., Ltd. (Jiangsu, China) and stored at 5 mg/mL at room temperature (RT). D-Luciferin (sodium salt) was purchased from Glpbiochem (China), dissolved in PBS stored at − 80 °C in the dark.

NKYS, KHYG1, YT, and NKL were cultured in RPMI 1640 medium (Gibco, USA) supplemented with 10% fetal bovine serum (Clack, USA) and 1% penicillin/streptomycin (Invitrogen, California, USA). Additionally, NKYS, KHYG1, and NKL were recombinant human interleukin-2-dependent (100 IU/mL, PeproTech, Rocky Hill, NJ, USA). SNK6 was cultured in X-VIVO medium (Lonza, USA) with 500 IU/mL recombinant human interleukin-2. NKYS, KHYG1, and YT were kindly obtained from Dr. Wing C. Chan (City of Hope Medical Center). SNK6 was kindly provided by Dr. Norio Shimizu and Yu Zhang of Chiba University, and NKL was purchased from the cell bank of the Bena Culture Collection (Beijing, China).

A total of 2 × 10³ cells were seeded into 96-well plates and treated with different concentrations of different agents. After 72 h, CCK-8 solution (US Everbright Inc., Jiangsu, China) was added to each well and allowed to react for another 1 h at 37 °C. Then, the absorbance value at optical density (OD) 450 nm was measured by a Multiskan FC microplate reader (Thermo Scientific, Waltham, MA, USA). The half maximal inhibitory concentration (IC₅₀) values were predicted using SPSS software version 25.0 (IBM Corp.). The synergistic effects were estimated by combination index (CI) value using the Chou–Talalay method and CompuSyn software (CompuSyn Inc.). CI < 1: synergism; CI = 1: additive effect; CI > 1: antagonism. Independent experiments were repeated at least three times.

A total of 2 × 10⁵ cells were seeded in 24-well plates and treated with different concentrations of different agents for 48 h or 72 h. For cell apoptosis analysis, cells were stained with Annexin V-APC and PI/7-AAD (Keygen Biotech, Jiangsu, China) in the dark for 15 min at RT. For cell cycle analysis, cells were fixed in 75% ethanol overnight at 4 °C and then digested with RNase A and PI (Keygen Biotech, Jiangsu, China) in the dark for 30 min at RT. Then, all these cells were analyzed by a FACS Calibur flow cytometer (BD Biosciences, NJ, USA). Independent experiments were repeated at least three times.

Total RNA extraction, mRNA library construction, sequencing, and data analysis were performed by Shanghai Yuanqi Biomedical Technology Co., Ltd. (Shanghai, China) according to the standard procedure. Brief procedures are listed in Additional file 1. The raw sequencing data are available from the NCBI and are archived under accession number PRJNA884169.

Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) from NKTCL cells according to the manufacturer’s instructions. The concentration and purity of these samples were measured by Nanodrop 1000 spectrophotometry (Thermo Scientific, Wilmington, DE, USA). cDNA was synthesized by reverse transcription using UEIris RT mix with DNase (US Everbright Inc., Jiangsu, China), and qRT-PCR was performed using Universal SYBR Green qPCR Supermix (US Everbright Inc., Jiangsu, China). The primers were synthesized by Hangzhou Shangyasai Biotechnology Co., Ltd. (Hangzhou, China), and the sequences are listed in Additional file 2: Table S1. GAPDH was used as a reference gene for mRNA quantitation. The relative expression level was calculated with the 2^−ΔΔCt method.

Cells were lysed in cold RIPA lysis buffer with protease and phosphatase inhibitor cocktail (Thermo Scientific, Waltham, MA, USA) for 30 min on ice. The cell lysates were clarified by centrifugation at 13,000 × g for 30 min. Proteins were resolved on gels with different concentrations by SDS-PAGE and transferred onto PVDF membranes (Amersham Biosciences, Piscataway, NJ, USA). The membranes were blocked in TBST buffer containing 5% non-fat milk for 1 h at RT. Then, the membranes were incubated with primary antibodies overnight at 4 °C and secondary antibodies for 1 h at RT. The antibodies are listed in Additional file 2: Table S2. The band images were digitally captured and quantified with a ChemiDoc™ XRS + system (Bio-Rad Laboratories, Hercules, CA, USA).

Cells were washed with PBS, fixed with 4% formaldehyde for 15 min at RT, and permeabilized with 0.5% Triton X-100 for another 15 min at RT. The cells were incubated with primary antibodies at 4 °C overnight and secondary antibodies in the dark for 1 h at RT. Then, the cells were stained with DAPI (US Everbright Inc, Jiangsu, China) in the dark for 5 min. Images were captured using a Zeiss Axio Imager M2 microscope (Carl Zeiss Corporation, Germany). The antibodies are listed in Additional file 2: Table S2.

In this study, we collected 67 tumor tissues from NKTCL patients who were histologically and clinically diagnosed by the department of pathology and oncology between 2014 and 2019 at the First Affiliated Hospital of Zhengzhou University. The IHC protocol was performed as the standard streptavidin–biotin-peroxidase-immunostaining procedure. The antibodies are listed in Additional file 2: Table S2. We defined that LMO2 expression was scored as negative or positive based on a 30% cut-off, which is based on previous studies in DLBCL and T-ALL [12, 13]. The scores were assessed by pathologists without prior knowledge of the patients’ information. Moreover, the detailed clinical characteristics of these patients are listed in Additional file 2: Table S3. The protocols were approved by the Institutional Research Ethics Committee of the First Affiliated Hospital of Zhengzhou University (Lot No.2022-KY-1061–002).

Stable LMO2 knockdown cell lines were generated using lentiviral constructs expressing short hairpin RNA (shRNA) of LMO2 (shLMO2, target sequence: AGGTGACAGATACCTCCTCAT) and negative control (shNC, target sequence: TTCTCCGAACGTGTCACGT). Stable 53BP1 knockdown cell lines were generated using lentiviral constructs expressing shRNA of 53BP1 (sh53BP1, target sequence: GATACTGCCTCATCACAGT) and negative control (shNC, target sequence: TTCTCCGAACGTGTCACGT). All of these were designed and provided by Shanghai Genechem Co., Ltd. (Shanghai, China).

A total of 2 × 10⁵ cells were seeded in 24-well plates, which were infected with 10μL HitransG P solution and lentivirus including shNC, shLMO2, or sh53BP1 (MOI = 1:10). After more than 48 h, the cells were transferred to a fresh complete medium, which included 1 mg/mL puromycin. Subsequently, the transfection efficiency was measured by flow cytometry and western blotting, and stable cell lines were established for the following experiments.

Cells were lysed in cold IP lysis buffer with protease and phosphatase inhibitor cocktail (Thermo Scientific, Waltham, MA, USA) for 30 min on ice. Cell debris was removed by centrifugation at 13,000 × g for 30 min. Cell lysate (1 mg) was combined with antibody and incubated overnight at 4 °C with rotation. The antigen–antibody mixture was added to the tube containing prewashed agarose beads and incubated at RT for 1 h with mixing. After washing five times with IP lysis buffer, the antigen–antibody complex was eluted before SDS-PAGE. The antibodies are listed in Additional file 2: Table S2.

Twenty NSG mice (3–4 weeks old, female, 15–20 g) were purchased from the Shanghai Model Organisms Center (Shanghai, China). A total of 1 × 10⁷ NKYS-Luciferase cells dissolved in a mixture of 200 µL medium and 200 µL matrigel (Corning Incorporated, USA) were injected into the right axillary region by subcutaneous inoculation to establish the tumor xenograft models. After one week, these mice were randomly divided into four groups (n = 5) and given different treatments by intraperitoneal injections (i.p.): control, fluzoparib (40 mg/kg, twice every 5 days), cisplatin (2 mg/kg, three times in the first week), and fluzoparib (40 mg/kg, twice every 5 days) plus cisplatin (2 mg/kg, three times in the first week).

Tumor size was measured every week, and tumor volume (V) was calculated using the following formula: V = ab²/2 (a: the long diameter and b: the short diameter). Mice were given D-Luciferin (150 mg/kg, i.p.) and anesthetized with isoflurane. After 5 min, luminescence was detected using the in vivo imaging system (IVIS), and the intensity was quantitated and normalized by Living Image software (PerkinElmer, Massachusetts, USA).

The protocol was approved by the Institutional Research Ethics Committee of the First Affiliated Hospital of Zhengzhou University (Lot No.2022-KY-1061–002).

First, we executed mice using the cervical dislocation method on day 49 after tumor cells inoculation. The fresh tissues (hearts, livers, kidneys, and lungs) were collected from mice, then put into 4% paraformaldehyde, embedded in paraffin, and cut into 5 μm-thick sections. The next procedures were as follows: coating, dewaxing, dehydration, hematoxylin, differentiation, bluing, eosin, dehydration, clearing, and cover-slipping. Two senior pathologists viewed cellular and tissue structure using a Zeiss Axio Imager M2 microscope (Carl Zeiss Corporation, Germany).

First, peripheral blood mononuclear cells (PBMCs) were obtained by Ficoll-Paque density gradient centrifugation from the blood of healthy donors. NK cells were isolated from PBMCs using CD56 microbeads (Miltenyi Biotec, Germany). CD3 − CD56 + NK cells (more than 95%) were selected and cultured in RPMI 1640 with 15% fetal bovine serum and 100 IU/mL interleukin-2 for the next experiments.

Statistical analyses were performed using GraphPad Prism version 8.0 (GraphPad Software, Inc., La Jolla, CA, USA). Data are expressed as the mean ± standard deviation (SD). Comparisons between groups were performed using Student’s t test and analysis of variance (ANOVA), respectively. PFS and OS were calculated using the Kaplan–Meier method and log-rank test. The correlation between LMO2 expression and clinicopathologic features was assessed using χ²-test. A value of p < 0.05 was considered statistically significant.

To investigate the effect of PARPi on NKTCL cell proliferation, NKTCL cells were treated with PARPi at different concentrations for 72 h, and CCK-8 reagent was added to measure OD values at 450 nm. PARPi significantly inhibited the proliferation of NKTCL cells in a dose-dependent manner (Fig. 1A), and NKTCL cells were more sensitive to niraparib (IC₅₀ values for NKYS, KHYG1, YT, SNK6, and NKL were respectively 1.45 μM, 3.43 μM, 7.15 μM, 3.00 μM, and 11.64 μM) and fluzoparib (IC₅₀ values for NKYS, KHYG1, YT, SNK6, and NKL were respectively 0.88 μM, 2.22 μM, 5.68 μM, 3.40 μM, and 17.59 μM). Next, for the following experiments, we explored the cell apoptosis and cell cycle of NKTCL cells after treatment with fluzoparib or niraparib. NKYS, KHYG1, and YT cells were treated with fluzoparib and niraparib at different concentrations for 48 h or 72 h, and cell apoptosis and the cell cycle were analyzed by flow cytometry. Apoptotic cells increased in a dose- and time-dependent manner (Fig. 1B). In addition, the number of cells in the S phase obviously increased, while the percentage of cells in the G0/G1 phase decreased as the concentration increased (Fig. 1C). All of these results suggested that PARPi showed an anti-tumor effect to some extent in vitro, and this effect was progressively enhanced with increasing concentration and duration. Moreover, primary human NK cells, as a negative control cell sample, were treated with PARPi at different concentrations for 72 h, and CCK-8 reagent was added to measure OD values at 450 nm. It was found that there was no obvious change in the survival rates (more than 80%) of NK cells on concentrations effective for NKTCL cells (Additional file 3: Fig. S1).

Consequently, we established NKTCL-cell-drived NSG mouse xenograft models to explore the anti-tumor effect of fluzoparib in vivo. During the treatment of fluzoparib (40 mg/kg, twice every 5 days), tumor volume and fluorescence gradually decreased in the fluzoparib group while gradually increased in the control group (Additional file 3: Fig. S2). After six weeks of treatment, we executed mice using the cervical dislocation method and performed the HE staining on the hearts, livers, kidneys, and lungs of mice to evaluate the toxicity of fluzoparib in vivo. There was no obvious histological change in these tissues, which suggested that fluzoparib could be administered without related toxicity in mice (Additional file 3: Fig. S3).

Subsequently, we performed mRNA-seq of the NKYS cell line to analyze the differentially expressed genes (DEGs) after treatment with fluzoparib. The DEGs were enriched in pathways related to DNA replication, DNA repair, and DDR (p < 0.05) by GO network, KEGG network, and GSEA analyses (Fig. 2A–C). Furthermore, we verified a number of related molecules in the DDR by qRT-PCR and western blotting. On the one hand, there was a noticeable reduction in the expression of several essential molecules in the DDR, such as PARP1, APEX1, LIG1, XRCC1, RPA1, ATM, and RAD51 (Fig. 2D, E). On the other hand, the expression of proteins associated with cell apoptosis and the cell cycle was correspondingly altered upon treatment with increasing concentrations of fluzoparib (Fig. 2E). We found that poly-ADP-ribose (pADPr) was downregulated and p-H2A.X was upregulated after treatment with fluzoparib, as shown by western blotting and immunofluorescence (Fig. 2E, F).

First, we evaluated the expression of LMO2 in tumor tissues from 67 NKTCL patients by immunohistochemistry. Based on a 30% cut-off, there were 22 cases for positive LMO2 expression and 45 cases for negative LMO2 expression (Additional file 3: Fig. S4). The results of Kaplan–Meier survival analysis showed that NKTCL patients with positive LMO2 expression had better PFS and OS (Fig. 3A). We analyzed the relationship between LMO2 expression and clinicopathological features of these patients, and the results showed that LMO2 expression had a significant correlation with the stage of disease (p = 0.022), which revealed that LMO2 expression may be associated with NKTCL progression (Additional file 2: Table S3). In addition, we examined the expression of LMO2 in different NKTCL cell lines (Fig. 3B).

According to the results, we constructed stable LMO2-downregulated NKYS and YT cell lines (Fig. 3C). Compared to shNC cells, the ability of fluzoparib to inhibit cell proliferation, promote cell apoptosis, and induce S-phase cell cycle arrest was weakened in shLMO2 cells (Fig. 3D–F). The apoptosis rate (%) increased from 7.30 to 30.76 in NKYS-shNC cells and from 10.51 to 26.80 in NKYS-shLMO2 cells. The apoptosis rate (%) increased from 9.09 to 33.80 in YT-shNC cells and from 8.47 to 26.60 in YT-shLMO2 cells. The proportion of S phase (%) increased from 37.20 to 46.50 in NKYS-shNC cells and from 43.90 to 47.60 in NKYS-shLMO2 cells. The proportion of S phase (%) increased from 43.20 to 73.10 in YT-shNC cells and from 60.00 to 84.20 in YT-shLMO2 cells. In brief, the absence of LMO2 reduced the sensitivity of NKTCL cells to fluzoparib.

The previous studies have confirmed that LMO2 inhibited DSBs repair by interacting with 53BP1, and 53BP1 could promote ATM-mediated signaling as a key member in DDR [9, 23]. To further explore the mechanism by which LMO2 affects the sensitivity of NKTCL cells to fluzoparib, we examined the interaction of LMO2 with 53BP1 by Co-IP in the NKYS cell line, and the result showed that LMO2 formed a complex with 53BP1 (Fig. 3G). Next, we constructed stable 53BP1-downregulated NKYS and YT cell lines (Additional file 4: Fig. S5). It was evident that the changes in the expression of p-ATM and p-H2A.X in shLMO2 or sh53BP1 cells were not as apparent as those in shNC cells after the same treatment with fluzoparib (Fig. 3H).

To explore the anti-tumor effect of fluzoparib combined with cisplatin, we detected the proliferation of NKTCL cells treated with different combinations of drugs. The results showed that, compared to fluzoparib or cisplatin alone, the combinations of the two drugs could more significantly inhibit cell proliferation (Fig. 4A, B). The combination of the two drugs also enhanced the proportion of apoptotic cells and increased the expression of p-H2A.X, a DNA damage-related indicator (Fig. 4C, D). The combined treatment increased the apoptosis rate (%) from 11.22 to 45.60 in NKYS, and 7.02 to 27.74 in KHYG1, which augmented the cell apoptosis more efficiently than fluzoparib or cisplatin alone.

To explore the anti-tumor effect of fluzoparib combined with cisplatin in vivo, we first established NKTCL-cell-drived NSG mouse xenograft models, which were divided into four groups according to the different treatments. As the duration of treatment increased, tumor volume and fluorescence gradually decreased in the fluzoparib, cisplatin, and combination group while gradually increased in the control group. Importantly, compared with fluzoparib or cisplatin alone, the combination of the two drugs decreased tumor volume and fluorescence more significantly (Fig. 5A–C).