Skip to main content

Advertisement

SpringerLink
Log in

Prognostic utility of β-tubulin isotype III and correlations with other molecular and clinicopathological variables in patients with early breast cancer: a translational Hellenic Cooperative Oncology Group (HeCOG) study

  • Clinical trial
  • Published:
Breast Cancer Research and Treatment Aims and scope Submit manuscript

Abstract

We evaluated the prognostic and predictive utility of β-tubulin isotype III (TUBB3) tumour gene transcription in early breast cancer patients enrolled in a randomised study. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was applied for assessment of TUBB3, ER, PgR, HER2 and MAPT messenger RNA and immunohistochemistry (IHC) for protein expression in 314 patients enrolled in trial HE10/97, evaluating epirubicin–alkylator adjuvant chemotherapy with or without paclitaxel. High TUBB3 mRNA status was associated with advanced T stage, high histological grade, low mRNA and protein levels of ER, PgR and MAPT, and high levels of HER2 (p < 0.001). At a median follow-up of 98 months, multivariate analysis showed high TUBB3 mRNA status to have prognostic significance for DFS (HR = 1.83, 95% CI 1.25–2.68, p = 0.002) and OS (HR = 1.71, 95% CI 1.03–2.83, p = 0.038), along with the number of involved axillary nodes, PgR mRNA status and tumour grade. TUBB3 mRNA levels did not predict benefit from inclusion of paclitaxel in adjuvant chemotherapy (test for interaction p = 0.96 for OS, p = 0.46 for DFS). Transcriptional activity of β-tubulin isotype III in early breast cancer is an adverse prognostic factor, though not a predictive one for taxane efficacy.

This is a preview of subscription content, log in via an institution to check access.

Access this article

Log in via an institution

Price excludes VAT (USA)
Tax calculation will be finalised during checkout.

Instant access to the full article PDF.

Institutional subscriptions

Fig. 1
Fig. 2
Fig. 3
Fig. 4
Fig. 5
Fig. 6
Fig. 7

Similar content being viewed by others

References

  1. EBCTC Group (2005) Effects of chemotherapy and hormonal therapy for early breast cancer on recurrence and 15-year survival:an overview of the randomised trials. Lancet 365:1687–1717

    Article  Google Scholar 

  2. Trudeau M, Charbonneau F, Gelmon K et al (2005) Selection of adjuvant chemotherapy for treatment of node-positive breast cancer. Lancet Oncol 6:886–898

    Article  PubMed  CAS  Google Scholar 

  3. Bedard P, Leo A, Piccart-Gebhart M (2010) Taxanes: optimizing adjuvant chemotherapy for early-stage breast cancer. Nat Rev Clin Oncol 7:22–36

    Article  PubMed  CAS  Google Scholar 

  4. Bhat KMR, Setaluri V (2007) Microtubule-associated proteins as targets in cancer chemotherapy. Clin Cancer Res 13:2849–2854

    Article  PubMed  CAS  Google Scholar 

  5. Mollinedo F, Gajate C (2003) Microtubules, microtubule-interfering agents and apoptosis. Apoptosis 8:413–450

    Article  PubMed  CAS  Google Scholar 

  6. Kavallaris M (2010) Microtubules and resistance to tubulin-binding agents. Nat Rev Cancer 10:194–204

    Article  PubMed  CAS  Google Scholar 

  7. Fountzilas G, Skarlos D, Dafni U, Gogas H, Briasoulis E et al (2005) Postoperative dose-dense sequential chemotherapy with epirubicin, followed byCMFwith or without paclitaxel, in patients with high-risk operable breast cancer: a randomised phase III study conducted by the Hellenic Cooperative Oncology Group. Ann Oncol 16:1762–1771

    Article  PubMed  CAS  Google Scholar 

  8. Bohmann K, Hennig G, Rogel U, Poremba C, Mueller BM, Fritz P, Stoerkel S, Schaefer K-L (2009) RNA extraction from archival formalin-fixed paraffin-embedded tissue: a comparison of manual, semiautomated, and fully automated purification methods. Clin Chem 55:1719–1727

    Article  PubMed  CAS  Google Scholar 

  9. Mueller BM, Kronenwett R, Hennig G, Euting H, Weber K et al (2011) Quantitative determination of estrogen receptor, progesterone receptor and HER2 mRNA in formalin-fixed paraffin-embedded tissue—a new option for predictive biomarker assessment in breast cancer. Diagn Mol Pathol 20:1–10

    Article  CAS  Google Scholar 

  10. Hammond ME, Hayes DF, Dowsett M, Allred DC, Hagerty KL, Badve S et al (2010) American Society of Clinical Oncology/College Of American Pathologists guideline recommendations for immunohistochemical testing of estrogen and progesterone receptors in breast cancer. J Clin Oncol 28:2784–2795

    Article  PubMed  Google Scholar 

  11. Wolff AC, Hammond ME, Schwartz JN, Hagerty KL, Allred DC, Cote RJ et al (2007) American Society of Clinical Oncology/College of American Pathologists guideline recommendations for human epidermal growth factor receptor 2 testing in breast cancer. Arch Pathol Lab Med 131:18–43

    PubMed  CAS  Google Scholar 

  12. Pusztai L, Jeong J-H, Gong Y, Ross JS, Kim C, Paik S, et al (2009) Evaluation of microtubule-associated protein-tau expression as a prognostic and predictive marker in the NSABP-B 28 randomized clinical trial. J Clin Oncol 27:4287–4292

    Article  PubMed  CAS  Google Scholar 

  13. Pentheroudakis G, Kalogeras K, Wirtz R, Grimani I, Zografos G, Gogas H et al (2009) Gene expression of estrogen receptor, progesterone receptor and microtubule-associated protein Tau in high-risk early breast cancer: a quest for molecular predictors of treatment benefit in the context of a Hellenic Cooperative Oncology Group trial. Breast Cancer Res Treat 116:131–143

    Article  PubMed  CAS  Google Scholar 

  14. Hudis TL (2007) Proposal for standardized definitions for efficacy end points in adjuvant breast cancer trials: the STEEP system. J Clin Oncol 25:2127–2132

    Article  PubMed  Google Scholar 

  15. McShane LM, Altman DG, Sauerbrei W et al (2005) Reporting recommendations for tumor marker prognostic studies. J Clin Oncol 23:9067–9072

    Article  PubMed  Google Scholar 

  16. Jordan MA, Wilson L (2004) Microtubules as a target for anticancer drugs. Nat Rev Cancer 4:253–265

    Article  PubMed  CAS  Google Scholar 

  17. Cleveland DW, Sullivan KF (1985) Molecular biology and genetics of tubulin. Annu Rev Biochem 54:331–365

    Article  PubMed  CAS  Google Scholar 

  18. Lopata MA, Cleveland DW (1987) In vivo microtubules are copolymers of available h-tubulin isotypes: localization of each of six vertebrate h-tubulin isotypes using polyclonal antibodies elicited by synthetic peptide antigens. J Cell Biol 105:1707–1720

    Article  PubMed  CAS  Google Scholar 

  19. Cicchillitti L, Penci R, Di Michele M, Fillipetti F, Rotilio D, Benedetta Donati M et al (2008) Proteomic characterisation of cytoskeletal and mitochondrial class III b-tubulin. Mol Cancer Ther 7:2070–2079

    Article  PubMed  CAS  Google Scholar 

  20. Orr GA, Verdier-Pinard P, McDaid H, Horwitz SB (2003) Mechanisms of taxol resistance related to microtubules. Oncogene 22:7280–7295

    Article  PubMed  CAS  Google Scholar 

  21. Mozzetti S, Ferlini C, Concolino P, Fillippetti F, Raspaglio G, Prislei S et al (2005) Class III b-tubulin overexpression is a prominent mechanism of paclitaxel resistance in ovarian cancer patients. Clin Cancer Res 11:298–305

    PubMed  CAS  Google Scholar 

  22. Hasegawa S, Miyoshi Y, Egawa C et al (2003) Prediction of response to docetaxel by quantitative analysis of class I and III beta-tubulin isotype mRNA expression in human breast cancers. Clin Cancer Res 9:2992–2997

    PubMed  CAS  Google Scholar 

  23. Magnani M, Ortuso F, Soro S, Alcaro S, Tramontano A, Botta M (2006) The beta/beta III tubulin isoforms and their complexes with antimitotic agents: Docking and molecular dynamics studies. FEBS J 273:3301–3310

    Article  PubMed  CAS  Google Scholar 

  24. Seve P, Dumontet C (2008) Is class III b-tubulin a predictive factor in patients receiving tubulin-binding agents? Oncology 9:168–175

    PubMed  CAS  Google Scholar 

  25. Seve P, Lai R, Ding K et al (2007) Class III beta tubulin expression and benefit from adjuvant cisplatin/vinorelbine chemotherapy in operable non-small cell lung cancer. Analysis of NCIC BR.10. Clin Cancer Res 13:994–999

    Article  PubMed  CAS  Google Scholar 

  26. Dumontet C, Krajewska M, Treilleux I, Mackey JR, Martin M, Rupin M et al (2010) BCIRG 001 molecular analysis: prognostic factors in node-positive breast cancer patients receiving adjuvant chemotherapy. Clin Cancer Res 16:3988–3997

    Article  PubMed  CAS  Google Scholar 

  27. Dennis K, Ulttenbogaard M, Chiaramello A, Moody SA (2002) Cloning and characterisation of 5-flanking region of the rat neuron-specific class III beta-tubulin gene. Gene 294:269–277

    Article  PubMed  CAS  Google Scholar 

  28. Raspaglio G, Filipetti F, Prislei S et al (2008) Hypoxia induces Class III beta-tubulin gene expression by HIF1a binding to its 3-flanking region. Gene 409:100–108

    Article  PubMed  CAS  Google Scholar 

  29. Gan PP, Pasquier E, Kavallaris M (2007) Class III b-tubulin mediates sensitivity to chemotherapeutic drugs in non small cell lung cancer. Cancer Res 67:9356–9363

    Article  PubMed  CAS  Google Scholar 

  30. Loo LW, Grove DI, Williams EM, Neal CL, Cousens LA et al (2004) Array comparative genomic hybridization analysis of genomic alterations in breast cancer subtypes. Cancer Res 64(23):8541–8549

    Article  PubMed  CAS  Google Scholar 

  31. Kaur GP, Reddy DE, Zimonjic DB, de Riel JK, Athwal RS (2005) Functional identification of a BAC clone from 16q24 carrying a senescence gene SEN16 for breast cancer cells. Oncogene 24(1):47–54

    Article  PubMed  CAS  Google Scholar 

  32. Chin SF, Wang Y, Thorne NP, Teschendorff AE, Pinder SE, Vias M et al (2007) Using array-comparative genomic hybridization to define molecular portraits of primary breast cancers. Oncogene 26(13):1959–1970

    Article  PubMed  CAS  Google Scholar 

  33. Mongroo PS, Rustgi AK (2010) The role of the miR-200 family in epithelial-mesenchymal transition. Cancer Biol Ther 10(3):219–222

    Article  PubMed  CAS  Google Scholar 

  34. Goldstein NS, Ferkowicz M, Odish E et al (2003) Minimum formalin fixation time for consistent estrogen receptor immunocytochemical staining of invasive breast carcinoma. Am J Clin Pathol 120:86–92

    Article  PubMed  Google Scholar 

  35. Rhodes A (2003) Quality assurance in immunohistochemistry. Am J Surg Pathol 27:1284–1285

    PubMed  Google Scholar 

  36. Morris KV (2008) RNA-mediated transcriptional gene silencing in human cells. Curr Top Microbiol Immunol 320:211–224

    Article  PubMed  CAS  Google Scholar 

  37. Ravo M, Mutarelli M, Ferraro L, Grober OM, Paris O et al (2008) Quantitative expression profiling of highly degraded RNA from formalin-fixed paraffin-embedded breast tumour biopsies by oligonucleotide microarrays. Lab Invest 88:430–440

    Article  PubMed  CAS  Google Scholar 

  38. Yasuda J, Hayashizaki Y (2008) The RNA continent. Adv Cancer Res 99:77–112

    Article  PubMed  CAS  Google Scholar 

  39. Rouzier R, Rajan R, Wagner P, Hess KR, Gold DL et al (2005) Microtubule-associated protein tau: a marker of paclitaxel sensitivity in breast cancer. PNAS 102:8315–8320

    Article  PubMed  CAS  Google Scholar 

  40. Andre F, Hatzis C, Anderson K, Sotiriou S, Mazouni C et al (2007) Microtubule-associated protein tau is a bifunctional predictor of endocrine sensitivity and chemotherapy resistance in estrogen-receptor positive breast cancer. Clin Cancer Res 13:2061–2067

    Article  PubMed  CAS  Google Scholar 

Download references

Acknowledgments

The authors wish to thank Ms. Evita Fragou and Ms. Dimitra Katsala for monitoring the study, Ms. Maria Moschoni for coordinating the data management and Ms. Thalia Spinari for tissue sample collection.

Author information

Author notes

  1. Ralf Kronenwett

    Present address: Sividon Diagnostics GmbH, Nattermann Allee 1, 50829, Cologne, Germany

  2. Ralph M. Wirtz

    Present address: Stratifyer Molecular Pathology GmbH, Werthmannstrasse 1, 50935, Cologne, Germany

Authors and Affiliations

  1. Department of Medical Oncology, Ioannina University Hospital, Niarxou Avenue, 45500, Ioannina, Greece

    George Pentheroudakis & Nicholas Pavlidis

  2. Department of Pathology, Ioannina University Hospital, Ioannina, Greece

    Anna Batistatou & Sevasti Kamina

  3. Department of Medical Oncology, Papageorgiou Hospital, Aristotle University of Thessaloniki School of Medicine, Thessaloniki, Greece

    Konstantine T. Kalogeras & George Fountzilas

  4. Translational Research Section, Hellenic Cooperative Oncology Group, Data Office, Athens, Greece

    Konstantine T. Kalogeras

  5. Siemens Healthcare Diagnostics, Cologne, Germany

    Ralf Kronenwett & Ralph M. Wirtz

  6. Department of Clinical Therapeutics, Alexandra Hospital, University of Athens School of Medicine, Athens, Greece

    Evangelos Bournakis

  7. Section of Biostatistics, Hellenic Cooperative Oncology Group, Data Office, Athens, Greece

    Anastasia G. Eleftheraki

  8. Section of Oncology, 2nd Department of Internal Medicine, Hippokration Hospital, University of Athens School of Medicine, Athens, Greece

    Dimitrios Pectasides

  9. Laboratory of Molecular Oncology, Hellenic Foundation for Cancer Research, Aristotle University of Thessaloniki School of Medicine, Thessaloniki, Greece

    Mattheos Bobos

  10. Department of Histopathology, Alexandra Hospital, Athens, Greece

    Irini Papaspirou

  11. 1st Department of Medicine, Laiko General Hospital, University of Athens School of Medicine, Athens, Greece

    Helen Gogas

  12. Division of Oncology, Department of Medicine, University Hospital, University of Patras Medical School, Patras, Greece

    Angelos K. Koutras

Authors
  1. George Pentheroudakis
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Anna Batistatou
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Konstantine T. Kalogeras
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Ralf Kronenwett
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Ralph M. Wirtz
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Evangelos Bournakis
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Anastasia G. Eleftheraki
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Dimitrios Pectasides
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Mattheos Bobos
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. Irini Papaspirou
    View author publications

    You can also search for this author in PubMed Google Scholar

  11. Sevasti Kamina
    View author publications

    You can also search for this author in PubMed Google Scholar

  12. Helen Gogas
    View author publications

    You can also search for this author in PubMed Google Scholar

  13. Angelos K. Koutras
    View author publications

    You can also search for this author in PubMed Google Scholar

  14. Nicholas Pavlidis
    View author publications

    You can also search for this author in PubMed Google Scholar

  15. George Fountzilas
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to George Pentheroudakis.

Additional information

On behalf of the Hellenic Foundation for Cancer Research, Athens, Greece, the senior author (GF) has pending patent applications with Siemens Healthcare Diagnostics, Cologne, Germany.

Appendix 1

Appendix 1

Primers and Probes (FAM/TAMRA-labelled) used for qRT-PCR of ER, PgR, HER2 and MAPT (5′->3′)

  • ESR1

  • Probe ATGCCCTTTTGCCGATGCA

  • Forward Primer GCCAAATTGTGTTTGATGGATTAA

  • Reverse Primer GACAAAACCGAGTCACATCAGTAATAG

  • PgR

  • Probe TTGATAGAAACGCTGTGAGCTCGA

  • Forward Primer AGCTCATCAAGGCAATTGGTTT

  • Reverse Primer ACAAGATCATGCAAGTTATCAAGAAGTT

  • HER2

  • Probe ACCAGGACCCACCAGAGCGGG

  • Forward Primer CCAGCCTTCGACAACCTCTATT

  • Reverse Primer TGCCGTAGGTGTCCCTTTG

  • MAPT

  • Probe AGACTATTTGCACACTGCCGCCT

  • Forward Primer GTGGCTCAAAGGATAATATCAAACAC

  • Reverse Primer ACCTTGCTCAGGTCAACTGGTT

Rights and permissions

Reprints and permissions

About this article

Cite this article

Pentheroudakis, G., Batistatou, A., Kalogeras, K.T. et al. Prognostic utility of β-tubulin isotype III and correlations with other molecular and clinicopathological variables in patients with early breast cancer: a translational Hellenic Cooperative Oncology Group (HeCOG) study. Breast Cancer Res Treat 127, 179–193 (2011). https://doi.org/10.1007/s10549-011-1427-0

Download citation

  • Received:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1007/s10549-011-1427-0

Keywords

Search

Navigation