Keywords
Cajuputs candy, essential oil, caries, mixed biofilm, Candida albicans, Streptococcus mutans
-
Views
-
Downloads
How to cite this article
Septiana S, Bachtiar BM, Yuliana ND and Wijaya CH. Cajuputs candy impairs Candida albicans and Streptococcus mutans mixed biofilm formation in vitro [version 2; peer review: 2 approved]. F1000Research 2020, 8:1923 (https://doi.org/10.12688/f1000research.20700.2)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Export Citation
Sciwheel
EndNote
Ref. Manager
Bibtex
ProCite
Sente
▬
✚
Research Article
Revised
Cajuputs candy impairs Candida albicans and Streptococcus mutans mixed biofilm formation in vitro
[version 2; peer review: 2 approved]
PUBLISHED 27 May 2020
OPEN PEER REVIEW
REVIEWER STATUS
Abstract
Corresponding author:
Christofora Hanny Wijaya
Competing interests:
IPB University is the patent holder for Cajuputs candy and CHW and BMB are named on the patent. However, the authors declare that they do not have any financial interest to disclose.
Grant information:
This study was funded by Directorate General of Resources for Science, Technology, and Higher Education, Ministry of Research, Technology and Higher Education, The Republic of Indonesia, through Program Pendidikan Magister menuju Doktor untuk Sarjana Unggul (PMDSU) 2018.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Copyright:
© 2020 Septiana S et al.
This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
How to cite: Septiana S, Bachtiar BM, Yuliana ND and Wijaya CH. Cajuputs candy impairs Candida albicans and Streptococcus mutans mixed biofilm formation in vitro [version 2; peer review: 2 approved]. F1000Research 2020, 8:1923 (https://doi.org/10.12688/f1000research.20700.2)
First published: 15 Nov 2019, 8:1923 (https://doi.org/10.12688/f1000research.20700.1)
Latest published: 27 May 2020, 8:1923 (https://doi.org/10.12688/f1000research.20700.2)
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Revised Amendments from Version 1
In response to the referee, we have revised the manuscript as suggested:
- rephrased aim of the study (third sentence of the Introduction’s last paragraph)
- added the information on the last sentence in microbial strains and MCEO samples section.
- rephrased the term “susceptibility” as suggested into “efficacy” throughout the paper and rephrased the fourth sentence in the first result section according to this correction.
- to enhance the readers’ understanding we have revised Figure 1 and the figure legend as well. “Figure 1. … absorbance at 600nm. The letters on histogram represented the significantly different values compared to each other formula within the groups in 0, 3, or 24 hours according to Duncan’s test (p <0.05)…”
- removed the term of “significantly” regarding the SEM analysis as suggested since we didn’t conduct any quantitative analysis on this image data
- to give a better understanding, we have revised several sentences as suggested by the reviewers: the sixth sentence on mixed biofilm formation paragraph-Method section, the third sentence in Result’s fourth paragraph, the fifth sentence in Discussion’s fourth paragraph, and last sentence in the fifth paragraph of the Discussion section.
- added the additional sentence according to the possible bioactive compounds (the sixth sentence on the Discussion’s the last paragraph)
- added new relevant references and updated the “unpublished report” since it has just published this year.
See the authors' detailed response to the review by Mohd Hafiz Arzmi and Hasna Ahmad
See the authors' detailed response to the review by Dikdik Kurnia
Abbreviations
CC, Cajuputs candy; MCEO, Melaleuca cajuputi essential oil; G0, untreated biofilm, control group, without the addition of CC formula; G1, biofilm group treated with Cajuputs candy made with Melaleuca cajuputi essential oil from Pulau Buru; G2, biofilm group treated with Cajuputs candy made with Melaleuca cajuputi essential oil from Mojokerto; G3, biofilm group treated with Cajuputs candy made with Melaleuca cajuputi essential oil from Ponorogo; G4, biofilm group treated with Cajuputs candy made with Melaleuca cajuputi essential oil from Pasuruan; G5, biofilm group treated with Cajuputs candy made with Melaleuca cajuputi essential oil from Kuningan.
Introduction
Candida albicans is the most prevalent fungus in oral microbiota1. This opportunistic fungus grows as yeast, pseudohyphae, and hyphae based on environmental conditions2. The hyphal form is relevant for its virulence as it allows penetration and invasion of epithelial cells3.
Streptococcus mutans is a strong acidogenic and aciduric bacteria, defined as the major cause of dental caries. The critical virulence factor of S. mutans is its capacity to convert dietary sugars to produce an extracellular polysaccharide (EPS) matrix, mainly through glucosyltransferase enzymes (Gtfs)4. EPS is the main building block of the biofilm. It can provide a binding site for colonization by other microbes and creates an acidic environment5,6.
Several studies have reported that C. albicans is frequently found with S. mutans in early childhood caries (ECC)7–9. The presence of both microbes indicates cross-kingdom feeding10. Furthermore, GtfB from S. mutans plays a significant role in mediating this dual-species interaction11. Their co-species interaction enhanced cell accumulation, biofilm formation, and Gtf gene expression8,12. Therefore, targeting the synergism of C. albicans and S. mutans in mixed biofilms has become a promising strategy for oral antimicrobial exploration13–15.
In accordance with the efficacy of essential oils as natural antimicrobial substances, Cajuputs candy (CC) has been developed using Melaleuca cajuputi essential oil (MCEO) as the main flavor ingredient. Previous work in our lab revealed the efficacy of CC in inhibiting biofilm formation by single oral microbes such as S. mutans (unpublished report) and C. albicans16. This functional candy may have interfered with their synergistic relationship in dual-species biofilm5,7,8,10. Therefore, this study aimed to evaluate the capacity of CC to impair their symbiotic interaction. This finding will provide novel evidence for CC in interfering with the traits of cariogenic oral microorganisms.
Methods
Microbial strains and MCEO samples
A C. albicans and S. mutans Xc were used for this study. C. albicans was obtained from the Oral Biology Laboratory stock culture previously isolated from the patients with their consent in the dental hospital of Universitas Indonesia17. S. mutans Xc was kindly provided by Prof. Yoshihisa Yamashita, Department of Preventive Dentistry, Kyushu University, Japan17. They were maintained as glycerol stocks at -80°C in our laboratory. C. albicans was grown in Sabouraud dextrose broth (SDB) (Oxoid, UK) for 24 hours at 37°C. S. mutans was cultured in brain heart infusion (BHI) (Himedia Laboratories, India) for 24 hours under anaerobic conditions (10% CO2, 10% H2, 10% N2). The cell densities of each culture were quantified using total plate count on an agar medium.
Five essential oils were obtained. MCEO from Mojokerto, Ponorogo, Pasuruan, and Kuningan were provided by Perhutani Indonesia, whereas MCEO from Pulau Buru was obtained from local villages where they produce the MCEO on a small scale by home distilling. For this, approximately 300kg of sun-dried leaves of Melaleuca cajuputi are placed in the boiler of the distilling apparatus and hydrodistillation is performed for six hours. After passing through the condenser, the extracted oil is collected and separated from the residual water. A similar method was also used for the other extracts. The essential oil is stored in a dark bottle.
CC preparation
The candies were prepared by mixing 98 g isomalt (Beneo-Palatinit GmbH, Germany), 0.1 g Acesulfame K (Anhui Jinhe Industries, China) and 0.1 g water18. The mixed ingredients were heated to 150°C with continuous stirring. As the temperature decreased to 135°C, 820 µL MCEO and 180 µL peppermint oil (Brataco Chemika, Indonesia) was added and the dough was molded. Peppermint oil was used as a secondary flavor in addition to MCEO. To identify the most active MCEO, the MCEOs were varied among the candies. Pulau Buru was used as the targeted reference as it has been utilized from the beginning of our research series16,18 and needed to be replaced with other potent MCEOs due to its currently limited amounts. Four MCEOs were selected from our previous work as they had similar sensory characteristics to MCEO Pulau Buru19. Five kinds of CCs were prepared using MCEO from different origins with Pulau Buru as the reference, and Mojokerto, Ponorogo, Pasuruan, and Kuningan as the alternative MCEOs.
Mixed biofilm formation
A mixed biofilm was prepared on a 96-well plate by inoculating approximately 2 × 104 colony forming units per milliliter (CFU/mL) of C. albicans suspended in SDB and 2 × 106 CFU/mL of S. mutans in BHI in an equal suspension volume (50 µL). The well was previously coated with fetal bovine serum (FBS) (Biosera, South America) with one-hour incubation at 37°C. Similar with saliva, FBS coating aims to induce phenotype-associated C. albicans biofilm formation20–22. Supernatants were removed after a 90-minute incubation under anaerobic conditions15. Then, 140µL of tryptic soy broth (Oxoid, UK) supplemented with 1% sucrose was added to each well followed by 60 µL of CC formula (each CC was dissolved in sterile distilled water (1:2 w/v) prior to the analysis). For the untreated control, the formula was replaced by 60 µL sterile phosphate-buffered saline (PBS). The biofilm group treated with CC made from Pulau Buru MCEO (as the reference) was represented as G1. Other treated groups G2, G3, G4, and G5 represented biofilms with the addition of CC made from Mojokerto, Ponorogo, Pasuruan, and Kuningan MCEOs, respectively. The untreated control (G0) was mixed biofilm without addition of the test CC formula. A light microscope equipped with a mobile camera (Primo Vert, Zeiss, Germany) was used to observe biofilm formation.
Mixed biofilm analysis
The plates mentioned previously were incubated for zero, three, and 24 hours at 37°C under anaerobic conditions. The supernatants were aspirated and washed twice with 200 µL PBS. Attached biofilms were stained using 100 µL crystal violet (CV) 0.5% (v/v). Total biomass was extracted using absolute ethanol and absorbance at 600 nm was measured. This CV assay was performed in triplicate from two independent experiments.
Similar to the CV assay, the mixed biofilms on 96-well plates were washed twice with PBS after zero, three, and 24 hours of incubation at 37°C. Next, 50 µL of 5 mg/mL MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) were added for total cell viability analysis. The plates were incubated for three hours followed by tetrazolium salt extraction using 100 µL acidified isopropanol. After re-incubation for two hours at 37°C under anaerobic conditions, absorbance was measured at 600 nm. Three independent experiments were conducted in triplicate.
Total plate count of C. albicans and S. mutans
The 24 hour biofilms on 96-well plates were washed twice with PBS. The biofilms at the bottom of the well were manually scraped and diluted with 300 µL PBS. The solutions obtained from each well underwent serial dilution and were grown for 24 hours at 37°C in separate media in triplicates. Sabouraud dextrose agar was used for C. albicans, whereas brain heart infusion agar was used for S. mutans.
Morphology analysis of dual-species biofilm formation
A 24-well plate supplemented with 8 mm acrylic resin discs inside was used to grow the mixed biofilms. The biofilms were fixed by immersion in 1 mL of 2.5% glutaraldehyde for 1 hour followed by 20 minutes dehydration with each ethanol series (10, 25, 50, 75, and 90%). They were then immersed in 100% alcohol for one hour. The plates were dried at 37°C for 24 h20. The mixed biofilm on the acrylic resin disc was analyzed using an FEI Quanta 650 Scanning Electron Microscope (SEM) (Thermo Scientific, Chicago).
Mixed biofilm-related gene expression
The biofilm was harvested after 24 hours incubation. RNA was extracted using Trizol reagent (Sangon Biotech, China). cDNA synthesis was performed using ReverTra Ace qPCR RT Master Mix (Cat. No. FSQ-301; Toyobo, Japan) following the manufacturer’s protocol. cDNA concentration was measured using a Qubit RNA HS Assay Kit (Cat. No. Q32852; Thermo Fisher Scientific, USA). The PCR mixture contained 10 µL SensiFAST SYBR Hi-ROX (Cat. No. BIO-92020; Bioline Reagents, UK), 0.8 µL of the forward and reverse primer, nuclease free water, and 50 ng/mL of template-diluted cDNA to achieve a 20 µL final volume. Table 1 shows the list of primers used for C. albicans and S. mutans specific genes based on the literature13. The PCR program for C. albicans genes was started with five minutes initial denaturation at 95oC, followed by 40 cycles of 15 seconds at 95°C and 60°C for one minute. For S. mutans, the PCR was run at 95°C for two minutes followed by 40 cycles of 95°C for five seconds and 60–61°C for 30 seconds. qRT-PCR was run on a StepOnePlus Real-Time PCR System (Applied Biosystems, USA). The relative gene expression was calculated as 2-ΔΔCt and normalized to 18S rRNA and 16S rRNA for C. albicans and S. mutans genes, respectively.
Table 1. Primers used in qRT-PCR analysis of dual-species biofilm.
| Primers | Sequences* |
|---|---|
| ALS3 | F: CAACTTGGGTTATTGAAACAAAAACA R: AGAAACAGAAACCCAAGAACAACC |
| HWP1 | F: GCTCCTGCTCCTGAAATGAC R: CTGGAGCAATTGGTGAGGTT |
| YWP1 | F: GCTACTGCTACTGGTGCTA R: AACGGTGGTTTCTTGAC |
| gtfB | F: AGCAATGCAGCCAATCTACAAAT R: ACGAACTTTGCCGTTATTGTCA |
| gtfD | F: ACAGCAGACAGCAGCCAAGA R: ACTGGGTTTGCTGCGTTTG |
| 16S rRNA | F: CCTACGGGAGGCAGCAGTAG R: CAACAGAGCTTTACGATCCGAAA |
| 18S rRNA | F: CACGACGGAGTTTCACAAGA R: CGATGGAAGTTTGAGGCAAT |
*Primer sequences were produced based on a previous study13.
Statistical analysis
Data analysis was performed using IBM SPSS Statistics 22 (IBM Corp., New York, USA). A one-way analysis of variance (ANOVA) followed by Duncan’s test (p <0.05) were used to analyze total biomass, cell viability, and CFU/mL. The means of gene expression were evaluated by Student’s t-test. All the graphs were produced using GraphPad Prism 8.0.2 (GraphPad Software, San Diego, California)
Results
Effect of CC on dual-species biofilm development
All the CC formulae significantly inhibited biofilm development during the early-prematurity phase (0–3 hours) until the maturity phase (24 hours) (Figure 1A). Total viable cell analysis showed comparable results23. CC effectively suppressed both C. albicans and S. mutans viable cells (0–3 hours) (Figure 1B). Cell viability (24 hours) was also reduced in the presence of the CC formula, with G2 exhibiting the strongest capacity, similar to the reference group (G1). Figure 2 showed that CC exposure had similar efficacy against both microbes in single biofilm. G3, G4, and G5 did not interfere significantly with the number of C. albicans and S. mutans organisms, whereas G2 exhibited the highest inhibition capacity.
Figure 1.
Cajuputs candy exposure inhibited C. albicans and S. mutans biofilm development: (A) total biomass on C. albicans and S. mutans dual-species biofilm, evaluated by crystal violet (CV) assay; (B) total viable cells on C. albicans and S. mutans dual-species biofilm based on MTT assay. The values were presented as mean and standard deviation of absorbance at 600nm. The letters on histogram represented the significantly different values compared to each other formula within the groups in 0, 3, or 24 hours according to Duncan’s test (p <0.05). G0: untreated control, biofilm group treated with Cajuputs candy made with Melaleuca cajuputi essential oil from different origins denoted by G1: Pulau Buru, G2: Mojokerto, G3: Ponorogo, G4: Pasuruan, and G5: Kuningan.
Figure 2.
Total plate count (colony forming units/mL) of C. albicans and S. mutans on mixed biofilm (in vitro): (A) mean and standard deviation of the C. albicans colonies; (B) mean and standard deviation of the S. mutans colonies. Different letters represented the significantly different values among the groups according to Duncan’s test (p <0.05). G0: untreated control, biofilm group treated with Cajuputs candy made with Melaleuca cajuputi essential oil from different origins denoted by G1: Pulau Buru, G2: Mojokerto, G3: Ponorogo, G4: Pasuruan, and G5: Kuningan.
Effect of CC on the morphology of dual-species biofilm
Biofilm development started with the germ-tube formation of C. albicans in the 90 minutes before formula treatments (Figure 3A). In the maturity stage (24 hours), the hyphal form of C. albicans dominated the biofilm, surrounded by S. mutans accumulation in the untreated control (G0) (Figure 3B). A corncob-like structure24 was observed in the mixed biofilm (Figure 3C).
Figure 3.
Light microscopy analysis of C. albicans and S. mutans interaction in mixed biofilm: (A) germ tube formation in the first stage of biofilm development in 90 minutes (40× magnification); (B) hyphal growth on untreated control of mixed biofilm after 24 hours incubation (20× magnification); (C) dual-species interaction formed a corn cob-like structure for biofilm treated with Cajuputs candy (40× magnification). Grayscale color adjustment has been performed in order to clarify the figures.
SEM analysis confirmed the germ tube formation in the first 90 minutes in which S. mutans was found close to C. albicans (Figure 4A). As shown in Figure 4B, hyphal cells grew progressively in the untreated biofilm (G0), enclosed within the self-produced EPS matrix. This co-species population formed a complex structure within the biofilm. Interestingly, the presence of CC altered the architecture of the mixed biofilm. C. albicans tended to be maintained in yeast form, whereas S. mutans adherence to C. albicans was obviously reduced, especially for G2 (Figure 4C–D). The microcolonies formed were not as many as those in the untreated control. However, exposure to G5 did not affect the interaction and a matrix-rich biofilm was still formed (Figure 4E–F).
Figure 4.
In vitro dual-species biofilm formation of C. albicans and S. mutans by scanning electron microscopy: (A) initial germ-tube formation (3000× magnification); (B) mixed biofilm of untreated control group (G0) (1000× magnification); (C–D) mixed biofilm under G2 exposure (1000× and 5000× magnification, respectively); (E–F) mixed biofilm under G5 exposure (1000× and 5000× magnification, respectively). The presence of Cajuputs candy reduced the hyphal cells of C. albicans and inhibited matrix production after 24 hours biofilm formation. (1. S. mutans cell; 2. C. albicans yeast and hyphal cells; 3. water channel; 4. extracellular polysaccharides matrix; 5. microcolony).
Effect of CC on the expression of biofilm-related genes
All of the CC groups demonstrated significant downregulation of ALS3, the adhesion-specific gene of C. albicans. HWP1, which is responsible for hyphal filamentation, was still expressed in G1, G2, and G3. However, the expression of YWP1, the yeast-specific gene, was had a higher upregulation in almost all of the CC groups than other specific genes (HWP1 and ALS3) (Figure 5A). This result confirmed the results of the SEM imaging, that CC exposure tends to maintain the commensal form of C. albicans.
Figure 5.
qRT-PCR assay of C. albicans and S. mutans biofilm-related genes: (A) C. albicans-specific genes expression; (B) S. mutans specific genes expression. An untreated control (G0) was defined as ‘1’. The values were shown as mean and SD. *Significantly regulated than the untreated control (G0) according to Student t-test (p<0.05). G0: untreated control, biofilm group treated with Cajuputs candy made with Melaleuca cajuputi essential oil from different origins denoted by G1: Pulau Buru, G2: Mojokerto, G3: Ponorogo, G4: Pasuruan, and G5: Kuningan.
As for S. mutans gene expression, the greatest downregulation was observed for gtfB in the mixed biofilm exposed to G2, whereas exposure to other formulas still allowed the expression of this insoluble glucan-specific enzyme (Figure 5B). Regarding gtfD expression (the gene for the soluble glucan enzyme), none of the CC groups had a significant effect on gene regulation compared to the untreated control (G0).
Discussion
CC is a lozenge that has been known as an emerging functional food in Indonesia. Further studies have shown its capability in maintaining oral cavity health due to the antimicrobial capacity of MCEO as its flavor against pathogenic oral microbes16,18,25. In addition to the existing MCEO (PB), we successfully identified four additional MCEOs as potential CC flavors19. However, the mechanism by which CC interferes with the relationship between the fungus and cariogenic bacteria (S. mutans) remains unknown. CC consists of isomalt and peppermint oil in addition to MCEO as the main flavor. These ingredients were each added at the same concentration in all of the formulas. Hence, their effect can be assumed as background activity. So far, no studies have been performed to evaluate the efficacy of CC derived from several alternative MCEOs in attenuating the mixed biofilm of S. mutans and C. albicans. Our data show that all the CC groups showed a potent capacity in reducing the biofilm formation composed of these oral microflorae, as well as the viability of biofilm cells, until the biofilm reached its maturation stage. We observed that a higher total biofilm in the early prematurity phase (three hours) dominantly contributed to matrix production since cell viability was maintained at a low level. The colony number confirmed that viability reduction in the mature biofilm was contributed by the reduction in cell numbers of both microbes, with G2 demonstrating the strongest inhibition capacity, similar to our existing MCEO (G1) used as the reference18.
The interkingdom interaction might begin in the first 90 minutes of biofilm growth, in which a corn-cob-like structure was observed (shown in Figure 3C). This result is in accordance with that of Zijnge et al.24, who first found that S. mutans cells adhere to the hyphal cells of C. albicans to form this structure. This occurred due to the high affinity of S. mutans cells to the O-mannan group in the C. albicans cell wall7,26. Our study showed that G2 exposure intervenes in the C. albicans and S. mutans interaction, indicated by reduction in total biofilm and cell viability (CV and MTT assays, respectively). SEM imaging confirmed these quantitative results. The inhibition effect was related to the morphology alteration of C. albicans into the yeast form, inhibition of S. mutans adherence, and lack of microcolonies compared to the untreated control (G0).
The molecular mechanism underlying the CC inhibition capacity was explained by the expression patterns of selected biofilm-related genes. The adhesion trait of C. albicans was suppressed by ALS3 downregulation when the CC formulas were present. As observed in this study, HWP1 was still expressed in G1–G3. These two genes contribute to hyphal formation as the critical factors in C. albicans biofilm formation27. However, the gene for the alteration from hyphal to yeast cell (YWP1) was more dominantly expressed under CC exposure than the other specific gene (ALS3 and HWP1),, indicating that CCs tend to impair biofilm development by maintaining the yeast form of C. albicans with lack of adhesion and further filamentation. This was confirmed by observation of the hyphal form using SEM imaging (Figure 4).
A parallel investigation of S. mutans genes showed that insoluble glucan production (gtfB) was inhibited as an effect of G2 exposure, which showed greater inhibitory capacity compared to the G1 reference. In contrast, gtfD was still expressed, similar to the untreated control (G0) in all the CC groups. This means that these genes were still expressed in the biofilm. Furthermore, gtfB is one of the key factors for initiating dual-species interaction8,11. It has thus been found to bind C. albicans due to its low dissociation rate, resulting in strong and stable binding such as a covalent bond26. Lower gtfB expression indicated a fewer matrix formation of S. mutans which important to form a polymicrobial biofilm with C. albicans, as shown by the CV and MTT assays in this study. This result also clearly explained the lack of a matrix on G2 SEM images (Figure 4C and 4D).
Related to our finding, farnesol (quorum sensing molecule [QSM] of C. albicans) at low concentrations has reported inducing S. mutans growth besides GtfB10. A lower concentration of farnesol could induce the hyphal form of C. albicans. QSMs are also produced by S. mutans, such as Autoinducer-2 (AI2), which is responsible for suppressing the inhibition capacity of farnesol. Another QSM of S. mutans is competence-stimulating peptide (CSP), which stimulates hyphal-to-yeast alteration28. The result of this study showed that G2 caused a morphology alteration, which might also be correlated with the impairment of these QSMs. This inter-species signaling might induce the yeast form of C. albicans, which inhibits S. mutans cell accumulation. QSMs in the mixed biofilm was not measured quantitatively or qualitatively in our study. However, this assumption needs to be studied further.
MCEO, as a plant-based antimicrobial used in this experiment, significantly suppressed biofilm formation by reducing the cell number of both the microbes and also inhibited the total biomass production similar to other natural antimicrobials14,15,29. Interestingly, the expression profile of morphology-related genes from C. albicans showed a comparable trend with the synthetic antimicrobial thiazolidinedione-8 (S-8) reported by Fieldman et al.13. G2 also showed an additional activity of inhibiting S. mutans insoluble glucan production. This observation strengthens the potential of this formula to suppress mixed biofilm formation in vitro.
In general, all of the CC groups indicated potent inhibitory capacity against mixed biofilm formation. Mojokerto performed as the strongest MCEO in CC against the co-species C. albicans and S. mutans biofilm, comparable with the existing MCEO (Pulau Buru). This could be related to their similar metabolite composition as found in our recent work19. MCEO from Mojokerto is dominated by 1,8-cineole (46.43%), caryophyllene (6.00%), α-terpineol (3.70%), γ-terpinene (3.09), and α-pinene (2.45%). The antibiofilm capacity of this MCEO could be related to these terpenic metabolites, as reported by several studies that essential oils from the Melaleuca genus have various antimicrobial activities30,31. Based on the previously published article, 1,8-cineole, a-terpineol, caryophyllene, linalool, terpinene-4-ol, and several other terpene compounds on MCEO were commonly reported as the responsible bioactive compounds on the MCEO antifungal and antibacterial activities32–33. Simşek and Duman34 further reported the capacity of 1,8-cineole that increases the antimicrobial activity of chlorhexidine gluconate due to its synergistic effect and is expressed as a penetration enhancer. Moreover, Caryophyllene which most found in the MOJ also thought to be correlated with the effect of CC in the biofilm formation as it has been widely reported responsible for the antimicrobial activity35. Nazzaro et al.36 summarized their potential mechanisms such as cell wall degradation, affecting the quorum sensing system, and altering adherence capability.
Conclusions
CC showed the ability to impair mixed C. albicans and S. mutans biofilm formation, with Mojokerto being identified as the most effective MCEO. Inhibition of the total biomass and cell viability were related with the candy’s capacity to maintain the commensal phenotype of C. albicans and to suppress insoluble glucan production by S. mutans.
Data availability
Underlying data
Open Science Framework: Cajuputs candy impairs Candida albicans and Streptococcus mutans mixed biofilm formation in vitro. https://doi.org/10.17605/OSF.IO/YT3HQ23.
This project contains the following underlying data:
Data are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication).
Download
Export To
metrics
| Views | Downloads | |
|---|---|---|
| F1000Research | - | - |
|
PubMed Central
Data from PMC are received and updated monthly.
|
- | - |
Citations
CITE
how to cite this article
Septiana S, Bachtiar BM, Yuliana ND and Wijaya CH. Cajuputs candy impairs Candida albicans and Streptococcus mutans mixed biofilm formation in vitro [version 2; peer review: 2 approved] F1000Research 2020, 8:1923 (https://doi.org/10.12688/f1000research.20700.2)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.
Open Peer Review
Current Reviewer Status:
Key to Reviewer Statuses
VIEW
HIDE
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations
A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 2
VERSION 2
PUBLISHED 27 May 2020
Revised
Views
5
How to cite this report:
Arzmi MH and Ahmad H. Reviewer Report For: Cajuputs candy impairs Candida albicans and Streptococcus mutans mixed biofilm formation in vitro [version 2; peer review: 2 approved]. F1000Research 2020, 8:1923 (https://doi.org/10.5256/f1000research.26745.r63983)
The direct URL for this report is:
https://f1000research.com/articles/8-1923/v2#referee-response-63983
https://f1000research.com/articles/8-1923/v2#referee-response-63983
NOTE: it is important to ensure the information in square brackets after the title is included in this citation.
Reviewer Report 02 Jun 2020
Mohd Hafiz Arzmi, Fundamental Dental and Medical Sciences Department, Kulliyyah of Dentistry, International Islamic University Malaysia (IIUM), Kuantan, Malaysia
Hasna Ahmad, Kulliyyah of Allied Health Sciences, International Islamic University Malaysia (IIUM), Kuantan, Malaysia
Approved
VIEWS 5
I have no
... Continue reading
CITE
HOW TO CITE THIS REPORT
Arzmi MH and Ahmad H. Reviewer Report For: Cajuputs candy impairs Candida albicans and Streptococcus mutans mixed biofilm formation in vitro [version 2; peer review: 2 approved]. F1000Research 2020, 8:1923 (https://doi.org/10.5256/f1000research.26745.r63983)
The direct URL for this report is:
https://f1000research.com/articles/8-1923/v2#referee-response-63983
https://f1000research.com/articles/8-1923/v2#referee-response-63983
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Version 1
VERSION 1
PUBLISHED 15 Nov 2019
Views
21
How to cite this report:
Kurnia D. Reviewer Report For: Cajuputs candy impairs Candida albicans and Streptococcus mutans mixed biofilm formation in vitro [version 2; peer review: 2 approved]. F1000Research 2020, 8:1923 (https://doi.org/10.5256/f1000research.22766.r58901)
The direct URL for this report is:
https://f1000research.com/articles/8-1923/v1#referee-response-58901
https://f1000research.com/articles/8-1923/v1#referee-response-58901
NOTE: it is important to ensure the information in square brackets after the title is included in this citation.
Reviewer Report 17 Feb 2020
Approved
VIEWS 21
- The main structure of the research and main data are according and relevant, with all references, and showed the new findings effect on mix biofilm formations.
- As an addition if possible, in table 1,
CITE
HOW TO CITE THIS REPORT
Kurnia D. Reviewer Report For: Cajuputs candy impairs Candida albicans and Streptococcus mutans mixed biofilm formation in vitro [version 2; peer review: 2 approved]. F1000Research 2020, 8:1923 (https://doi.org/10.5256/f1000research.22766.r58901)
The direct URL for this report is:
https://f1000research.com/articles/8-1923/v1#referee-response-58901
https://f1000research.com/articles/8-1923/v1#referee-response-58901
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
-
Author Response 28 May 2020Christofora Hanny Wijaya, Department of Food Science and Technology, IPB University, Bogor, 16680, Indonesia28 May 2020Author ResponseDear reviewer,
Please accept our sincere apology for this delayed response. We do appreciate the opportunity to revise our paper entitled, “Cajuputs candy impairs Candida albicans and Streptococcus mutans mixed biofilm ... Continue reading
COMMENTS ON THIS REPORT
-
Author Response 28 May 2020Christofora Hanny Wijaya, Department of Food Science and Technology, IPB University, Bogor, 16680, Indonesia28 May 2020Author ResponseDear reviewer,
Please accept our sincere apology for this delayed response. We do appreciate the opportunity to revise our paper entitled, “Cajuputs candy impairs Candida albicans and Streptococcus mutans mixed biofilm ... Continue reading
Views
27
How to cite this report:
Arzmi MH and Ahmad H. Reviewer Report For: Cajuputs candy impairs Candida albicans and Streptococcus mutans mixed biofilm formation in vitro [version 2; peer review: 2 approved]. F1000Research 2020, 8:1923 (https://doi.org/10.5256/f1000research.22766.r58903)
The direct URL for this report is:
https://f1000research.com/articles/8-1923/v1#referee-response-58903
https://f1000research.com/articles/8-1923/v1#referee-response-58903
NOTE: it is important to ensure the information in square brackets after the title is included in this citation.
Reviewer Report 05 Feb 2020
Mohd Hafiz Arzmi, Fundamental Dental and Medical Sciences Department, Kulliyyah of Dentistry, International Islamic University Malaysia (IIUM), Kuantan, Malaysia
Hasna Ahmad, Kulliyyah of Allied Health Sciences, International Islamic University Malaysia (IIUM), Kuantan, Malaysia
Approved with Reservations
VIEWS 27
The manuscript elucidates the activity of Cajuputs to Candida albicans and Streptococcus mutans in mixed biofilms. The effect was assessed using CV assay, MTT, CFU, genes expression and SEM. The authors claim that Cajuput inhibits biofilm and production of polysaccharide
... Continue reading
CITE
HOW TO CITE THIS REPORT
Arzmi MH and Ahmad H. Reviewer Report For: Cajuputs candy impairs Candida albicans and Streptococcus mutans mixed biofilm formation in vitro [version 2; peer review: 2 approved]. F1000Research 2020, 8:1923 (https://doi.org/10.5256/f1000research.22766.r58903)
The direct URL for this report is:
https://f1000research.com/articles/8-1923/v1#referee-response-58903
https://f1000research.com/articles/8-1923/v1#referee-response-58903
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
-
Author Response 28 May 2020Christofora Hanny Wijaya, Department of Food Science and Technology, IPB University, Bogor, 16680, Indonesia28 May 2020Author ResponseDear reviewers,
Please accept our sincere apology for this delayed response. We do appreciate the opportunity to revise our paper entitled, “Cajuputs candy impairs Candida albicans and Streptococcus mutans mixed biofilm ... Continue reading
COMMENTS ON THIS REPORT
-
Author Response 28 May 2020Christofora Hanny Wijaya, Department of Food Science and Technology, IPB University, Bogor, 16680, Indonesia28 May 2020Author ResponseDear reviewers,
Please accept our sincere apology for this delayed response. We do appreciate the opportunity to revise our paper entitled, “Cajuputs candy impairs Candida albicans and Streptococcus mutans mixed biofilm ... Continue reading
Comments on this article Comments (0)