Long noncoding RNA ACART knockdown decreases 3T3-L1 preadipocyte proliferation and differentiation

2.1 Animal model and adipose tissues

Adult male C57BL/6 mice were purchased from the Shanghai Experimental Animal Center, housed at an optimal temperature and humidity, and given free access to water and food. The animal work was performed in accordance with the guidelines and regulations of the CCCA and the approval of the Animal Ethics Committee of Shanghai Shuguang Hospital (No. PZSHUTCM220124012). Obesity was achieved by feeding the mice an HFD (catalog number: D12492, Research Diets, NJ, USA) for 7 weeks (n = 5) [18]. Normal mice (n = 5) were fed a basal diet (BD, catalog number: D12450B, Research Diets). Mice were euthanized via isoflurane inhalation, and then, subcutaneous, perirenal, and epididymal fat was collected when the difference in body weight between the two groups was 30% [9].

1. Ethical approval: The research related to animal use has been complied with all the relevant national regulations and institutional policies for the care and use of animals and has been approved by Animal Ethics Committee of Shanghai Shuguang Hospital (No. PZSHUTCM220124012).

2.2 Cell culture

A murine preadipocyte cell line, 3T3-L1, was purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). These cells were maintained in complete medium (Dulbecco’s modified eagle’s medium supplemented with 10% fetal bovine serum; Product number: SLM-243-B; Sigma-Aldrich, MO, USA) in an incubator with 5% CO₂ at 37°C, as described previously [19]. Two days after complete fusion, 3T3-L1 cells were induced to differentiate (Day 0, D0) using a previously described standard cocktail regimen: 0.5 mM IBMX (Product number: 15879; Sigma-Aldrich), 10⁻⁶ M dexamethasone (Product number: D4902; Sigma-Aldrich), and 5 µg/mL insulin (Product number: 12643; Sigma-Aldrich) (designated as MDI) [20]. Two days after this induction, the medium was replaced with complete medium supplemented with insulin (5 µg/mL) for 48 h. Finally, the cells were maintained in complete medium without any inducer.

2.3 RNA interference (RNAi) and overexpression

Oligomers for sh-Acart (forward, GATCCCCAGAAUCCCACACGUCAATTGCAATTGACGTGTGGGATTCTGGTTTTTT; reverse, CTAGAAAAAACCAGAAUCCCACACGUCAATTgcAATTGACGTGTGGGATTCTGGG) or shNegative Control (sh-NC) were synthesized from Sangon Biotech (Shanghai, Chain) and cloned into a pGE1 vector. Oligomers for sh-NC were as follows: forward, GATCCTTCTCCGAACGTGTCACGTTTGCAAACGTGACACGTTCGGAGAATTTTTT; reverse, CTAGAAAAAATTCTCCGAACGTGTCACGTTTGCAAACGTGACACGTTCGGAGAAG. sh-Acart and sh-NC were synthesized and cloned into pLKO.1 vector (Product number: 1.8787; Addgene, USA) to construct recombinant plasmids pLKO.1-sh-Acart and pLKO.1-sh-NC, respectively. pLKO.1-sh-Acart and pLKO.1-sh-NC were transfected into 3T3-L1 cells using lipofectamine 3000 (Product number: L300001; Invitrogen, CA, USA), and the interference efficiency was validated using quantitative real-time PCR (qRT-PCR) after 48 h. The recombinant plasmid of pcDNA-Acart was constructed to overexpress Acart in 3T3-L1 cells.

2.4 Oil Red O staining

After treatment with the specified reagents, 3T3-L1 cells (2 × 10⁵ cells per well in six-well plates) were fixed with 4% PFA (Product number: P1110; Solarbio, Shanghai, China) and stained with Oil Red O (Product number: 08010-5; Solarbio) to assess lipid accumulation, as previously described [21]. After staining, cells were visualized and photographed using a microscope (Olympus, Tokyo, Japan).

2.5 qRT-PCR

Total RNA was extracted with TRIzol reagent (Product number: T9424; Sigma-Aldrich). Genomic DNA was degraded using DNase I (Product number: EN0521; Thermo Fisher Scientific) prior to reverse transcription. cDNA was synthesized using Moloney’s murine leukemia virus reverse transcriptase (Product number: M1302; Sigma-Aldrich) and random primers (3 µg/µL; Product number: 48190011; Invitrogen, CA, USA). qRT-PCR was performed in triplicate on a ABI 7500-Fast Real-Time PCR System (Applied Biosystem, CA, USA) using a OneStep qPCR kit (Product number: 210210; Qiagen, Duesseldorf, Germany). The temperature protocol was 95°C for 15 min, followed by 39 cycles of 95°C for 15 s and 58.5°C for 15 s. Beta (β)-actin served as an internal control. The mRNA levels were analyzed using the 2^(−ΔΔCT) method [22]. The primer sequences are shown in Table 1. The specificity of qRT-PCR product was ascertained through gel electrophoresis and melt curve analysis.

2.6 Western blot

3T3-L1 cells were lysed with RIPA buffer (Product number: R0010; Solarbio), and the protein concentration was quantified with a BCA protein assay kit (Product number: PC0020; Solarbio). For western blot analysis, equal amounts of protein were loaded on a 10% sodium dodecyl sulfate polyacrylamide gel electro-phoresis gel and then electrotransferred to polyvinylidene fluoride membranes (Product number: 1620177; Bio-Rad, CA, USA). The membranes were blocked with 5% nonfat milk for 90 min and then treated with antibodies against PPARγ (1:1,000, ab178866; Abcam, CA, USA), C/EBPα (1:800, ab40764; Abcam), BCL-2 (1:1,500, ab196495), BAX (1:3,000, ab32503), and β-actin (1:2,000, ab8226; Abcam) overnight at 4°C. An anti-rabbit secondary antibody (1:8,000, ab288151; Abcam) was used to treat the membranes, and an ECL kit (Pierce, IL, USA) was applied to visualize the membranes.

2.7 Cell proliferation

Cell proliferation assays were performed with cell counting kit (CCK)-8 reagent (Product number: CA1210; Solarbio). Briefly, 24 h after transfection with sh-Acart or sh-NC, 3T3-L1 cells were plated into 96-well plates (4 × 10³ cells per well) and incubated for 1, 2, 3, and 4 days. Ten microliters of CCK-8 was added to the wells for 60 min, and then, the absorbance was measured at 450 nm with a microplate reader (Bio-Rad, CA, USA).

2.8 Edu incorporation assay

Twenty-four hours after transfection with sh-Acart or sh-NC, 3T3-L1 cells (0.5 × 10⁵ cells per well in 24-well plates) were induced to differentiate for 24 h and labeled with EdU (Product number: CA1170; Solarbio) and Hoechst (Product number: CA1170; Solarbio) for 1 h. The fluorescence of EdU and Hoechst was observed using a BX53 fluorescence microscope (Olympus).

2.9 Data analysis

Data are shown as the mean ± standard deviation from three independent experiments. Statistical analysis was carried out using two-tailed Student’s t-test with SPSS 20.0 statistical software (IBM, NY, USA). p < 0.05 was considered statistically significant.

3.1 Acart level was upregulated during preadipocyte differentiation

Acart is an lncRNA with 2193 bp in length, mainly located in cytoplasm (Figure A1(a–c)). In a previous study, Acart was identified to play an important role in protecting against cardiomyocyte injury by activating PPARγ signaling [17]. Given that PPARγ is an essential transcription factor in adipogenesis, we first investigated whether Acart was dysregulated during preadipocyte differentiation. To this end, the 3T3-L1 cell line, a well-established preadipocyte, was treated with MDI differentiation medium to simulate adipogenesis in vitro. As shown in Figure 1a, MDI treatment significantly increased lipid droplet accumulation in a time-dependent manner. To further validate 3T3-L1 preadipocyte differentiation, the expression of major adipogenesis markers was assessed. The results from qRT-PCR analysis revealed that the expression of Pparγ, C/ebpα, and Fabp4 exhibited a differentiation-dependent increase (Figure 1b). Based on these results, Acart level was assessed in 3T3-L1 cells during differentiation. Figure 1c shows that Acart levels were significantly upregulated during MDI-induced 3T3-L1 preadipocyte differentiation.

Figure 1

Acart level was increased during preadipocyte differentiation. (a) 3T3-L1 cells were treated with MDI differentiation medium, and lipid accumulation was assayed using oil red O staining at D0, D2, D4, and D8. Scan bar = 100 µm. (b) 3T3-L1 cells were treated with MDI, and then qRT-PCR analysis was carried out to assess the mRNA level of Pparγ, C/ebpα, and Fabp4. (c) 3T3-L1 cells were treated with MDI, and then, qRT-PCR analysis was carried out to assess Acart levels. **p < 0.01, ***p < 0.001.

3.2 Acart was increased in adipose tissues from obese mice

To investigate the association of Acart with obesity, subcutaneous, perirenal, and epididymal fat was obtained from HFD obese mice and BD normal mice. As expected, Pparγ and C/ebpα expression levels were higher in subcutaneous, perirenal, and epididymal adipose tissues from mice with HFD-induced obesity than from mice fed a BD (Figure 2a–c). More importantly, Acart level was also markedly increased in subcutaneous, perirenal, and epididymal adipose tissues in HFD-fed obese mice compared with BD-fed normal mice (Figure 2d and f). We did not detect Acart expression in muscular tissues (Figure A2).

Figure 2

Acart level was increased in adipose tissues from obese mice. Subcutaneous (a), perirenal (b), and epididymal (c) adipose tissues were collected from HFD-fed mice and BD-fed mice, and Pparγ and C/ebpα mRNA levels were assessed using the qRT-PCR analysis. Subcutaneous (d), perirenal (e), and epididymal (f) adipose tissues were collected from HFD-fed mice and BD-fed mice, and Acart levels were assessed using the qRT-PCR analysis. ***p < 0.001.

3.3 Acart depletion inhibited preadipocyte differentiation

To explore the biological role of Acart in preadipocyte differentiation, 3T3-L1 cells were treated with pLKO.1-sh-Acart to repress Acart level and then treated with MDI differentiation medium. The results from Oil Red O staining showed that Acart depletion resulted in a significant decrease in lipid droplet accumulation (Figure 3a). Figure 3b shows that the expression levels of four major adipogenesis markers (Pparγ, C/ebpα, Fabp4, and Adipoq) were decreased in Acart-deficient cells. The results from the western blot analysis revealed that PPARγ and C/EBPα protein expression levels were significantly decreased in Acart-deficient 3T3-L1 cells (Figure 3c–e).

Figure 3

Acart depletion inhibited preadipocyte differentiation. (a) After transfection with pLKO.1-sh-Acart for 48 h, 3T3-L1 cells were treated with MDI for 8 days, and lipid accumulation was assayed using oil red O staining. Scan bar = 100 µm. (b) After transfection with pLKO.1-sh-Acart for 48 h, 3T3-L1 cells were treated with MDI for 8 days, and then qRT-PCR analysis was carried out to assess the mRNA levels of Acart, Pparγ, C/ebpα, Fabp4, and Adipoq. (c–e) After transfection with pLKO.1-sh-Acart for 48 h, 3T3-L1 cells were treated with MDI for 8 days, and then western blot (c) and quantitative (d and e) analyses were carried out to assess PPARγ and C/EBPα protein expression. **p < 0.01, ***p < 0.001.

3.4 Acart depletion inhibited preadipocyte proliferation

Given that preadipocyte proliferation is an essential precondition for cell differentiation [19] and that Acart level is promptly increased during preadipocyte differentiation, the role of Acart in regulating preadipocyte proliferation was further explored. The results from the EdU assay showed that the EdU-positive cell proportion was significantly decreased in Acart-deficient cells compared with the negative control cells (Figure 4a and b). Acart knockdown increased BAX expression and decreased BCL-2 expression in 3T3-L1 cells, indicating that Acart knockdown facilitated cell apoptosis (Figure 4c). The CCK-8 assay revealed that cell proliferation was significantly repressed from day 2 to day 4 after Acart depletion (Figure 4d). Conversely, Acart overexpression accelerated preadipocyte proliferation (Figure 5a and b) and inhibited cell apoptosis (Figure 5c and d). Acart overexpression decreased BAX expression and increased BCL-2 expression in 3T3-L1 cells, indicating that Acart inhibited cell apoptosis (Figure 5e). The results from Oil Red O staining revealed that Acart overexpression resulted in a significant increase in lipid droplet accumulation (Figure 5f). These results demonstrate that Acart knockdown inhibits preadipocyte proliferation and differentiation.

Figure 4

Acart depletion inhibited preadipocyte proliferation. (a and b) After transfection with pLKO.1-sh-Acart for 48 h, 3T3-L1 cells were treated with MDI for 24 h, and then, an EdU assay was carried out to assess cell proliferation. (c) The protein expression of BAX and BCL-2 was assessed in 3T3-L1 cells after Acart knockdown. (d) After transfection with pLKO.1-sh-Acart for 48 h, 3T3-L1 cells were treated with MDI for different time periods, and then, a CCK-8 assay was carried out to assess cell proliferation. **p < 0.01.

Figure 5

Acart overexpression accelerated preadipocyte proliferation and differentiation. (a and b) 3T3-L1 cells were treated with pcDNA-Acart and MDI for 24 h, and then, cell proliferation was assessed using the CCK-8 assay. After ACART overexpression, 3T3-L1 cells were treated with MDI for 24 h, and cell apoptosis (c and d) and lipid accumulation (f) were assayed using TUNEL and oil red O staining, respectively. (e) The protein expression of BAX and BCL-2 was assessed in 3T3-L1 cells after Acart overexpression. Scan bar = 100 µm. **p < 0.01.