Human Papillomavirus in Head and Neck Cancer
Abstract
:1. Introduction
2. Papillomavirus: General Aspects, Evolution, and Classification
3. HPV and Cancer
3.1. HPV Infection in Genital Sites
3.2. HPV and Head Neck Cancer
3.3. The Incidence of HPV-OPC
3.4. HPV Prevalence in the Oral Cavity
3.5. Βeta, Gamma and other Cutaneous HPV Types in Oral Sites
4. HPV in Oral Site and Biomarkers
Authors, Years [Ref] | Subject Type | Sample Type | % Alpha Types ^ | %Beta Types ^ | % Gamma Types |
---|---|---|---|---|---|
Bottalico et al., 2011 [51] | HIV positive (n = 52) | Oral rinse (HPV +, n = 35) | 60 ^ | 57 ^ | 20 ^ |
HIV negative (n = 317) | Oral rinse (HPV+ n = 117) | 25 ^ | 74 ^ | 12 ^ | |
HIV negative women, (n = 1,807) | Cervical sample (HPV+, n = 14) | 96 | 2 | 4 | |
Fatahzadeh et al., 2013 [52] | HIV positive (n = 52) | Oral lavage sample (HPV+ n = 45) | 23 | 46 | § |
Forslund et al., 2013 [53] | HIV negative (n = 312) | Oral samples(n = 311, 6% HPV+) | 0.96 | 31 | 1.6 |
Nasal samples (n = 304, 50% HPV+) | 3 | 31 | 23 | ||
Lang Kuhs et al., 2013 [56] | Women, control arm (n = 2926) | Oral and gargle rinse | 1.9 | 18.6 (93/500 #) | 4.0 (20/500 #) |
Vaccine arm (n = 2912) | Oral and gargle rinse | 1.6 | 18.6 (93/500 #) | 4.0 (20/500 #) | |
Paolini et al., 2013 [59] | A:healthy patients n = 25 | Oral rinse and mouth swabs | 8 | 25 ° | |
B: non malignant lesions (n = 47) | Oral rinse and mouth swabs | 12.7 | 51 ° | ||
C: cancers (n = 78) | Biopsies from neoplastic lesions | 21.8 | 20.5 ° |
5. Methods for Detecting Alpha, Beta, Gamma, mu, nu Papilloma Viruses
6. Conclusions
Primer Name | Sequence (5' → 3') | HPV Region | Product Length (bp) | Genotypes Detected | References |
---|---|---|---|---|---|
SKF1 | GAGCAAAATTTCCAACAAAGG | L1 | 210–238 | [68] | |
SKR1 | ATACCATAGAYCCACTRGG | ||||
SKF2 | AAATATCCTGATTATTTRGGMATG | ||||
SKR2 | AAACYATAGAGCCACTWGG | 1a, 2a, 3; 4; 6; 7; 10; 11; 16; 18, 27; 28; 29, 57; 60; 63; 65 | |||
FAP59 | TAACWGTIGGICAYCCWTATT | L1 | 478 | [55] | |
FAP64 | CCWATATCWVHCATITCICCATC | 65 genotypes. No band was detected for HPV types: 1; 2; 35; 41; 44; 55; 63; 66; 71; 74 | |||
FAP6085 | CCWGATCCHAATMRRTTTGC | L1(nested of FAP59/64 PCR) | 235 | [69] | |
FAP6319 | ACATTTGIAITTGTTTDGGRTCAA | ≈10 fold greater sensitivity compared to that of single round PCR [55]. No band was detected for HPV types: 1; 2; 35; 41; 44; 55; 63; 66; 71; 74 | |||
PM-A | ACTGACCAAAGCTGGAAATC | E1 | 117 | [57] | |
PM-B | TCTTGCAGAGCATTGAAACG | 5; 8, 9; 12; 14; 15; 17; 19; 20; 21; 22; 23; 24; 25; 36; 37; 38; 47; 49; 75; 76; 80; 92; 93; 96 | |||
CP65 | CA(A/G)GGTCA(C/T)AA(C/T)AATGG(C/T)AT | L1 | 452–457 | [72] | |
CP70 | AA(C/T) TTTCGTCC(C/T)A(A/G)AG (A/G)A(A/T) ATTG(A/G)TC | 5b; 8;9; 14a; 15; 17; 19; 20; 21; 24; 25; 34; 36; 38; 41; 48; 49; 50 | |||
CP66 | AATCA(A/G)(A/C)TGTTT(A/G)TTAC(A/T)GT | 389 | 3, 5b; 8;9; 10,14a; 15; 17; 19; 20; 21; 24; 25; 34; 36; 38; 41; 48; 49; 50 | [73] | |
CP69 | G(A/T)TAGATCC(A/T)ACAT(C/T)CCA(A/G)AA |
Acknowledgements
Conflict of Interest
References
- Chaturvedi, A.K.; Engels, E.A.; Pfeiffer, R.M.; Hernandez, B.Y.; Xiao, W.; Kim, E.; Jiang, B.; Goodman, M.T.; Sibug-Saber, M.; Cozen, W.; et al. Human papillomavirus and rising oropharyngeal cancer incidence in the United States. J. Clin. Oncol. 2011, 29, 4294–4301. [Google Scholar] [CrossRef]
- Bravo, I.G.; de Sanjosé, S.; Gottschling, M. The clinical importance of understanding the evolution of papillomaviruses. Trends Microbiol. 2010, 18, 432–438. [Google Scholar] [CrossRef]
- Papillomavirus Episteme. Available online: http://pave.niaid.nih.gov/ (accessed on 15 March 2014).
- Van Ranst, M.; Kaplan, J.B.; Burk, R.D. Phylogenetic classification of human papillomaviruses: Correlation with clinical manifestations. J. Gen. Virol. 1992, 73, 2653–2660. [Google Scholar] [CrossRef]
- Ghittoni, R.; Accardi, R.; Hasan, U.; Gheit, T.; Sylla, B.; Tommasino, M. The biological properties of E6 and E7 oncoproteins from human papillomaviruses. Virus Genes 2010, 40, 1–13. [Google Scholar] [CrossRef]
- Hubert, P.; Caberg, J.H.; Gilles, C.; Bousarghin, L.; Franzen-Detrooz, E.; Boniver, J.; Delvenne, P. E-cadherin-dependent adhesion of dendritic and Langerhans cells to keratinocytes is defective in cervical human papillomavirus-associated (pre)neoplastic lesions. J. Pathol. 2005, 206, 346–355. [Google Scholar] [CrossRef]
- Ronco, L.V.; Karpova, A.Y.; Vidal, M.; Howley, P.M. Human papillomavirus 16 E6 oncoprotein binds to interferon regulatory factor-3 and inhibits its transcriptional activity. Genes Dev. 1998, 12, 2061–2072. [Google Scholar] [CrossRef]
- Park, J.S.; Kim, E.J.; Kwon, H.J.; Hwang, E.S.; Namkoong, S.E.; Um, S.J. Inactivation of interferon regulatory factor-1 tumor suppressor protein by HPV E7 oncoprotein. Implication for the E7-mediated immune evasion mechanism in cervical carcinogenesis. J. Biol. Chem. 2000, 275, 6764–6769. [Google Scholar]
- De Villiers, E.M.; Fauquet, C.; Broker, T.R.; Bernard, H.U.; zur Hausen, H. Classification of papillomaviruses. Virology 2004, 324, 17–27. [Google Scholar] [CrossRef]
- De Villiers, E.M. Cross-roads in the classification of papillomaviruses. Virology 2013, 445, 2–10. [Google Scholar] [CrossRef]
- Martin, E.; Dang, J.; Bzhalava, D.; Stern, J.; Edelstein, Z.R.; Koutsky, L.A.; Kiviat, N.B.; Feng, Q. Caracterization of three novel human papillomavirus types isolated from oral rinse samples of healthy individuals. J. Clin. Virol. 2014, 59, 30–37. [Google Scholar] [CrossRef]
- Bernard, H.U.; Burk, R.D.; Chen, Z.; van Doorslaer, K.; zur Hausen, H.; de Villiers, E.M. Classification of papillomaviruses (PVs) based on 189 PV types and proposal of taxonomic amendments. Virology 2010, 401, 70–79. [Google Scholar] [CrossRef]
- Hsueh, P.R. Human papillomavirus, genital warts, and vaccines. J. Microbiol. Immunol. Infect. 2009, 42, 101–106. [Google Scholar]
- Guan, P.; Howell-Jones, R.; Li, N.; Bruni, L.; de Sanjosé, S.; Franceschi, S.; Clifford, G.M. Human papillomavirus types in 115,789 HPV-positive women: A meta-analysis from cervical infection to cancer. Int. J. Cancer 2012, 131, 2349–2359. [Google Scholar] [CrossRef]
- Li, N.; Franceschi, S.; Howell-Jones, R.; Snijders, P.J.; Clifford, G.M. Human papillomavirus type distribution in 30,848 invasive cervical cancers worldwide: Variation by geographical region, histological type and year of publication. Int. J. Cancer 2011, 128, 927–935. [Google Scholar] [CrossRef]
- GLOBOCAN 2012: Estimated Cancer Incidence, Mortality, and Prevalence Worldwide in 2012. Available online: http://globocan.iarc.fr/ (accessed on 1 April 2014).
- Danaei, G.; Vander Hoorn, S.; Lopez, A.D.; Murray, C.J.; Ezzati, M. Comparative Risk Assessment collaborating group (Cancers). Causes of cancer in the world: Comparative risk assessment of nine behavioural and environmental risk factors. Lancet 2005, 366, 1784–1793. [Google Scholar] [CrossRef]
- Kim, H.J.; Fay, M.P.; Feuer, E.J.; Midthune, D.N. Permutation tests for joinpoint regression with applications to cancer rates. Stat. Med. 2000, 19, 335–351. [Google Scholar] [CrossRef]
- Franceschi, S.; Bidoli, E.; Herrero, R.; Muñoz, N. Comparison of cancers of the oral cavity and pharynx worldwide: Etiological clues. Oral. Oncol. 2000, 36, 106–115. [Google Scholar] [CrossRef]
- Smith, E.M.; Hoffman, H.T.; Summersgill, K.S.; Kirchner, H.L.; Turek, L.P.; Haugen, T.H. Human papillomavirus and risk of oral cancer. Laryngoscope 1998, 108, 1098–1103. [Google Scholar] [CrossRef]
- Schwartz, S.M.; Daling, J.R.; Doody, D.R.; Wipf, G.C.; Carter, J.J.; Madeleine, M.M.; Mao, E.J.; Fitzgibbons, E.D.; Huang, S.; Beckmann, A.M.; et al. Oral cancer risk in relation to sexual history and evidence of human papillomavirus infection. J. Natl. Cancer Inst. 1998, 90, 1626–1636. [Google Scholar] [CrossRef]
- Gillison, M.L.; Koch, W.M.; Capone, R.B.; Spafford, M.; Westra, W.H.; Wu, L.; Zahurak, M.L.; Daniel, R.W.; Viglione, M.; Symer, D.E.; et al. Evidence for a causal association between human papillomavirus and a subset of head and neck cancers. J. Natl. Cancer Inst. 2000, 92, 709–720. [Google Scholar] [CrossRef]
- Fouret, P.; Monceaux, G.; Temam, S.; Lacourreye, L.; St Guily, J.L. Human papillomavirus in head and neck squamous cell carcinomas in nonsmokers. Arch. Otolaryngol. Head Neck Surg. 1997, 123, 513–516. [Google Scholar] [CrossRef]
- Paz, I.B.; Cook, N.; Odom-Maryon, T.; Xie, Y.; Wilczynski, S.P. Human papillomavirus (HPV) in head and neck cancer. An association of HPV 16 with squamous cell carcinoma of Waldeyer’s tonsillar ring. Cancer 1997, 79, 595–604. [Google Scholar] [CrossRef]
- Rabkin, C.S.; Biggar, R.J.; Melbye, M.; Curtis, R.E. Second primary cancers following anal and cervical carcinoma: Evidence of shared etiologic factors. Am. J. Epidemiol. 1992, 136, 54–58. [Google Scholar]
- Kreimer, A.R.; Clifford, G.M.; Boyle, P.; Franceschi, S. Human papillomavirus types in head and neck squamous cell carcinomas worldwide: A systematic review. Cancer Epidemiol. Biomark. Prev. 2005, 14, 467–475. [Google Scholar] [CrossRef]
- Lace, M.J.; Anson, J.R.; Klussmann, J.P.; Wang, D.H.; Smith, E.M.; Haugen, T.H.; Turek, L.P. Human papillomavirus type 16 (HPV-16) genomes integrated in head and neck cancers and in HPV-16-immortalized human keratinocyte clones express chimeric virus-cell mRNAs similar to those found in cervical cancers. J. Virol. 2011, 85, 1645–1654. [Google Scholar] [CrossRef]
- Kreimer, A.R.; Clifford, G.M.; Snijders, P.J.; Castellsagué, X.; Meijer, C.J.; Pawlita, M.; Viscidi, R.; Herrero, R.; Franceschi, S.; International Agency for Research on Cancer (IARC) Multicenter Oral Cancer Study Group. HPV16 semiquantitative viral load and serologic biomarkers in oral and oropharyngeal squamous cell carcinomas. Int. J. Cancer 2005, 115, 329–332. [Google Scholar] [CrossRef]
- Braakhuis, B.J.; Snijders, P.J.; Keune, W.J.; Meijer, C.J.; Ruijter-Schippers, H.J.; Leemans, C.R.; Brakenhoff, R.H. Genetic patterns in head and neck cancers that contain or lack transcriptionally active human papillomavirus. J. Natl. Cancer Inst. 2004, 96, 998–1006. [Google Scholar] [CrossRef]
- Näsman, A.; Attner, P.; Hammarstedt, L.; Du, J.; Eriksson, M.; Giraud, G.; Ahrlund-Richter, S.; Marklund, L.; Romanitan, M.; Lindquist, D.; et al. Incidence of human papillomavirus (HPV) positive tonsillar carcinoma in Stockholm, Sweden: An epidemic of viral-induced carcinoma? Int. J. Cancer 2009, 125, 362–366. [Google Scholar] [CrossRef]
- Hong, A.M.; Grulich, A.E.; Jones, D.; Lee, C.S.; Garland, S.M.; Dobbins, T.A.; Clark, J.R.; Harnett, G.B.; Milross, C.G.; O’Brien, C.J.; et al. Squamous cell carcinoma of the oropharynx in Australian males induced by human papillomavirus vaccine targets. Vaccine 2010, 28, 3269–3272. [Google Scholar]
- Hammarstedt, L.; Lindquist, D.; Dahlstrand, H.; Romanitan, M.; Dahlgren, L.O.; Joneberg, J.; Creson, N.; Lindholm, J.; Ye, W.; Dalianis, T.; et al. Human papillomavirus as a risk factor for the increase in incidence of tonsillar cancer. Int. J. Cancer 2006, 119, 2620–2623. [Google Scholar] [CrossRef]
- Nagpal, J.K.; Patnaik, S.; Das, B.R. Prevalence of high-risk human papilloma virus types and its association with P53 codon 72 polymorphism in tobacco addicted oral squamous cell carcinoma (OSCC) patients of Eastern India. Int. J. Cancer 2002, 97, 649–653. [Google Scholar] [CrossRef]
- Gillison, M.L.; Alemany, L.; Snijders, P.J.; Chaturvedi, A.; Steinberg, B.M.; Schwartz, S.; Castellsagué, X. Human papillomavirus and diseases of the upper airway: Head and neck cancer and respiratory papillomatosis. Vaccine 2012, 30, F34–F54. [Google Scholar]
- Kreimer, A.R.; Bhatia, R.K.; Messeguer, A.L.; González, P.; Herrero, R.; Giuliano, A.R. Oral human papillomavirus in healthy individuals: A systematic review of the literature. Sex. Transm. Dis. 2010, 37, 386–391. [Google Scholar]
- Gillison, M.L.; Broutian, T.; Pickard, R.K.; Tong, Z.Y.; Xiao, W.; Kahle, L.; Graubard, B.I.; Chaturvedi, A.K. Prevalence of oral HPV infection in the United States, 2009–2010. JAMA 2012, 307, 693–703. [Google Scholar] [CrossRef]
- Beachler, D.C.; Weber, K.M.; Margolick, J.B.; Strickler, H.D.; Cranston, R.D.; Burk, R.D.; Wiley, D.J.; Minkoff, H.; Reddy, S.; Stammer, E.E.; et al. Risk factors for oral HPV infection among a high prevalence population of HIV-positive and at-risk HIV-negative adults. Cancer Epidemiol. Biomark. Prev. 2012, 21, 122–133. [Google Scholar] [CrossRef]
- Parisi, S.G.; Cruciani, M.; Scaggiante, R.; Boldrin, C.; Andreis, S.; dal Bello, F.; Pagni, S.; Barelli, A.; Sattin, A.; Mengoli, C.; et al. Anal and oral human papillomavirus (HPV) infection in HIV-infected subjects in northern Italy: A longitudinal cohort study among men who have sex with men. BMC Infect. Dis. 2011. [Google Scholar] [CrossRef]
- Richter, K.L.; van Rensburg, E.J.; van Heerden, W.F.; Boy, S.C. Human papilloma virus types in the oral and cervical mucosa of HIV-positive South African women prior to antiretroviral therapy. J. Oral Pathol. Med. 2008, 37, 555–559. [Google Scholar] [CrossRef]
- Beachler, D.C.; D’Souza, G.; Sugar, E.A.; Xiao, W.; Gillison, M.L. Natural history of anal vs. oral HPV infection in HIV-infected men and women. J. Infect Dis. 2013, 208, 330–339. [Google Scholar] [CrossRef]
- Kreimer, A.R.; Pierce Campbell, C.M.; Lin, H.Y.; Fulp, W.; Papenfuss, M.R.; Abrahamsen, M.; Hildesheim, A.; Villa, L.L.; Salmerón, J.J.; Lazcano-Ponce, E.; et al. Incidence and clearance of oral human papillomavirus infection in men: The HIM cohort study. Lancet 2013, 38, 877–887. [Google Scholar]
- Kreimer, A.R.; Villa, A.; Nyitray, A.G.; Abrahamsen, M.; Papenfuss, M.; Smith, D.; Hildesheim, A.; Villa, L.L.; Lazcano-Ponce, E.; Giuliano, A.R. The epidemiology of oral HPV infection among a multinational sample of healthy men. Cancer Epidemiol. Biomark. Prev. 2011, 20, 172–182. [Google Scholar] [CrossRef]
- Pickard, R.K.; Xiao, W.; Broutian, T.R.; He, X.; Gillison, M.L. The prevalence and incidence of oral human papillomavirus infection among young men and women, aged 18–30 years. Sex. Transm. Dis. 2012, 39, 559–566. [Google Scholar] [CrossRef]
- Edelstein, Z.R.; Schwartz, S.M.; Hawes, S.; Hughes, J.P.; Feng, Q.; Stern, M.E.; O’Reilly, S.; Lee, S.K.; Fu Xi, L.; Koutsky, L.A. Rates and determinants of oral human papillomavirus infection in young men. Rates and determinants of oral human papillomavirus infection in young men. Sex. Transm. Dis. 2012, 39, 860–867. [Google Scholar] [CrossRef]
- Du, J.; Nordfors, C.; Ahrlund-Richter, A.; Sobkowiak, M.; Romanitan, M.; Näsman, A.; Andersson, S.; Ramqvist, T.; Dalianis, T. Prevalence of oral human papillomavirus infection among youth, Sweden. Emerg. Infect. Dis. 2012, 18, 1468–1471. [Google Scholar] [CrossRef]
- Louvanto, K.; Rautava, J.; Willberg, J.; Wideman, L.; Syrjänen, K.; Grénman, S.; Syrjänen, S. Genotype-specific incidence and clearance of human papillomavirus in oral mucosa of women: A six-year follow-up study. PLoS One 2013, 8, e53413. [Google Scholar]
- Machado, A.P.; Gatto de Almeida, F.; Bonin, C.M.; Martins Prata, T.T.; Sobrinho Ávilla, L.; Junqueira Padovani, C.T.; Teixeira Ferreira, A.M.; Dos Santos Fernandes, C.E.; Tozetti, I.A. Presence of highly oncogenic human papillomavirus in the oral mucosa of asymptomatic men. Braz. J. Infect. Dis. 2014, 18, 266–270. [Google Scholar] [CrossRef]
- Tristão, W.; Ribeiro, R.M.; Oliveira, C.A.; Betiol, J.C.; Bettini Jde, S. Epidemiological study of HPV in oral mucosa through PCR. Braz. J. Otorhinolaryngol. 2012, 78, 66–70. [Google Scholar] [Green Version]
- Gewirtzman, A.; Bartlett, B.; Tyring, S. Epidermodysplasia verruciformis and human papilloma virus. Curr. Opin. Infect. Dis. 2008, 21, 141–146. [Google Scholar] [CrossRef]
- Bzhalava, D.; Guan, P.; Franceschi, S.; Dillner, J.; Clifford, G. A systematic review of the prevalence of mucosal and cutaneous human papillomavirus types. Virology 2013, 445, 224–231. [Google Scholar] [CrossRef]
- Bottalico, D.; Chen, Z.; Dunne, A.; Ostoloza, J.; McKinney, S.; Sun, C.; Schlecht, N.F.; Fatahzadeh, M.; Herrero, R.; Schiffman, M.; et al. The oral cavity contains abundant known and novel human papillomaviruses from the Betapapillomavirus and Gammapapillomavirus genera. J. Infect. Dis. 2011, 204, 787–792. [Google Scholar] [CrossRef]
- Fatahzadeh, M.; Schlecht, N.; Chen, Z.; Bottalico, D.; McKinney, S.; Ostoloza, J.; Dunne, A.; Burk, R.D. Oral human papillomavirus detection in older adults who have human immunodeficiency virus infection. Oral Surg. Oral Med. Oral Pathol. 2013, 115, 505–514. [Google Scholar] [CrossRef]
- Forslund, O.; Johansson, H.; Madsen, K.G.; Kofoed, K. The nasal mucosa contains a large spectrum of human papillomavirus types from the Betapapillomavirus and Gammapapillomavirus genera. J. Infect. Dis. 2013, 208, 1335–1341. [Google Scholar] [CrossRef]
- Söderlund-Strand, A.; Carlson, J.; Dillner, J. Modified general primer PCR system for sensitive detection of multiple types of oncogenic human papillomavirus. Modified general primer PCR system for sensitive detection of multiple types of oncogenic human papillomavirus. J. Clin. Microbiol. 2009, 47, 541–546. [Google Scholar] [CrossRef]
- Forslund, O.; Antonsson, A.; Nordin, P.; Stenquist, B.; Hansson, B.G. A broad range of human papillomavirus types detected with a general PCR method suitable for analysis of cutaneous tumours and normal skin. J. Gen. Virol. 1999, 80, 2437–2443. [Google Scholar]
- Lang Kuhs, K.A.; Gonzalez, P.; Struijk, L.; Castro, F.; Hildesheim, A.; van Doorn, L.J.; Rodriguez, A.C.; Schiffman, M.; Quint, W.; Lowy, D.R.; et al. Prevalence of and risk factors for oral human papillomavirus among young women in Costa Rica. J. Infect. Dis. 2013, 208, 1643–1652. [Google Scholar] [CrossRef]
- De Koning, M.; Quint, W.; Struijk, L.; Kleter, B.; Wanningen, P.; van Doorn, L.J.; Weissenborn, S.J.; Feltkamp, M.; ter Schegget, J. Evaluation of a novel highly sensitive, broad-spectrum PCR-reversehybridization assay for detection and identification of beta-papillomavirus DNA. J. Clin. Microbiol. 2006, 44, 1792–1800. [Google Scholar] [CrossRef]
- De Koning, M.N.; ter Schegget, J.; Eekhof, J.A.; Kamp, M.; Kleter, B.; Gussekloo, J.; Feltkamp, M.C.; Bouwes Bavinck, J.N.; Purdie, K.J.; Bunker, C.B.; et al. Evaluation of a novel broad-spectrum PCR-multiplex genotyping assay for identification of cutaneous wart-associated human papillomavirus types. J. Clin. Microbiol. 2010, 48, 1706–1711. [Google Scholar] [CrossRef]
- Paolini, F.; Rizzo, C.; Sperduti, I.; Pichi, B.; Mafera, B.; Rahimi, S.S.; Vigili, M.G.; Venuti, A. Both mucosal and cutaneous papillomaviruses are in the oral cavity but only alpha genus seems to be associated with cancer. J. Clin. Virol. 2013, 56, 72–76. [Google Scholar] [CrossRef]
- Fakhry, C.; Rosenthal, B.T.; Clark, D.P.; Gillison, M.L. Associations between oral HPV16 infection and cytopathology: Evaluation of an oropharyngeal “pap-test equivalent” in high-risk populations. Cancer Prev. Res. 2011, 4, 1378–1384. [Google Scholar] [CrossRef]
- Slebos, R.J.; Jehmlich, N.; Brown, B.; Yin, Z.; Chung, C.H.; Yarbrough, W.G.; Liebler, D.C. Proteomic analysis of oropharyngeal carcinomas reveals novel HPV-associated biological pathways. Int. J. Cancer 2013, 132, 568–579. [Google Scholar] [CrossRef]
- McMurray, H.R.; McCance, D.J. Human papillomavirus type 16 E6 activates TERT gene transcription through induction of c-Myc and release of USF-mediated repression. J. Virol. 2003, 77, 9852–9861. [Google Scholar] [CrossRef]
- Patel, J.H.; Loboda, A.P.; Showe, M.K.; Showe, L.C.; McMahon, S.B. Analysis of genomic targets reveals complex functions of MYC. Nat. Rev. Cancer. 2004, 4, 562–568. [Google Scholar] [CrossRef]
- Descamps, G.; Wattiez, R.; Saussez, S. Proteomic study of HPV-positive head and neck cancers: Preliminary results. Biomed. Res. Int. 2014. [Google Scholar] [CrossRef]
- De Nooij-van Dalen, A.G.; van Dongen, G.A.; Smeets, S.J.; Nieuwenhuis, E.J.; Stigter-van Walsum, M.; Snow, G.B.; Brakenhoff, R.H. Characterization of the human Ly-6 antigens, the newly annotated member Ly-6K included, as molecular markers for head-and-neck squamous cell carcinoma. Int. J. Cancer 2003, 103, 768–774. [Google Scholar] [CrossRef]
- Martinez, I.; Wang, J.; Hobson, K.F.; Ferris, R.L.; Khan, S.A. Identification of differentially expressed genes in HPV-positive and HPV-negative oropharyngeal squamous cell carcinomas. Eur. J. Cancer 2007, 43, 415–432. [Google Scholar] [CrossRef]
- Forslund, O. Genetic diversity of cutaneous human papillomaviruses. J. Gen. Virol. 2007, 88, 2662–2669. [Google Scholar] [CrossRef]
- Antonsson, A.; Hansson, B.G. Healthy skin of many animal species harbors papillomaviruses which are closely related to their human counterparts. J. Virol. 2002, 76, 12537–12542. [Google Scholar] [CrossRef]
- Forslund, O.; Ly, H.; Higgins, G. Improved detection of cutaneous human papillomavirus DNA by single tube nested “hanging droplet” PCR. J. Virol. Methods 2003, 110, 129–136. [Google Scholar] [CrossRef]
- Li, J.; Pan, Y.; Xu, Z.; Wang, Q.; Hang, D.; Shen, N.; Liu, M.; Zhang, C.; Abliz, A.; Deng, Q.; et al. Improved detection of human papillomavirus harbored in healthy skin with FAP6085/64 primers. J. Virol. Methods 2013, 193, 633–638. [Google Scholar] [CrossRef]
- Sasagawa, T.; Mitsuishi, T. Novel polymerase chain reaction method for detecting cutaneous human papillomavirus DNA. J. Med. Virol. 2012, 84, 138–144. [Google Scholar] [CrossRef]
- Berkhout, R.J.; Tieben, L.M.; Smits, H.L.; Bavinck, J.N.; Vermeer, B.J.; ter Schegget, J. Nested PCR approach for detection and typing of epidermodysplasia verruciformis-associated human papillomavirus types in cutaneous cancers from renal transplant recipients. J. Clin. Microbiol. 1995, 33, 690–695. [Google Scholar]
- Berkhout, R.J.; Bouwes Bavinck, J.N.; ter Schegget, J. Persistence of human papillomavirus DNA in benign and (pre)malignant skin lesions from renal transplant recipients. J. Clin. Microbiol. 2000, 38, 2087–2096. [Google Scholar]
- Surentheran, T.; Harwood, C.A.; Spink, P.J.; Sinclair, A.L.; Leigh, I.M.; Proby, C.M.; McGregor, J.M.; Breuer, J. Detection and typing of human papillomaviruses in mucosal and cutaneous biopsies from immunosuppressed and immunocompetent patients and patients with epidermodysplasia verruciformis: A unified diagnostic approach. J. Clin. Pathol. 1998, 51, 606–610. [Google Scholar] [CrossRef]
- Shamanin, V.; Delius, H.; de Villiers, E.M. Development of a broad spectrum PCR assay for papillomaviruses and its application in screening lung cancer biopsies. J. Gen. Virol. 1994, 75, 1149–1156. [Google Scholar] [CrossRef]
- Harwood, C.A.; Spink, P.J.; Surentheran, T.; Leigh, I.M.; de Villiers, E.M.; McGregor, J.M.; Proby, C.M.; Breuer, J. Degenerate and nested PCR: A highly sensitive and specific method for detection of human papillomavirus infection in cutaneous warts. J. Clin. Microbiol. 1999, 37, 3545–3555. [Google Scholar]
- Nindl, I.; Köhler, A.; Gottschling, M.; Forschner, T.; Lehmann, M.; Meijer, C.J.; Snijders, PJ.; Stockfleth, E. Extension of the typing in a general-primer-PCR reverse-line-blotting system to detect all 25 cutaneous beta human papillomaviruses. J. Virol. Method. 2007, 146, 1–4. [Google Scholar] [CrossRef]
- Michael, K.M.; Forslund, O.; Bacevskij, O.; Waterboer, T.; Bravo, I.G.; Pawlita, M.; Schmitt, M. Bead-based multiplex genotyping of 58 cutaneous human papillomavirus types. J. Clin. Microbiol. 2011, 49, 3560–3567. [Google Scholar] [CrossRef]
- Antonsson, A.; Michael, K.M.; Pawlita, M.; Lehmann, M.D.; Nindl, I. Detection and typing of cutaneous human papillomavirus types—A comparison of three different methods. J. Virol. Methods 2013, 189, 305–310. [Google Scholar] [CrossRef]
- Ikenberg, H. Laboratory diagnosis of human papillomavirus infection. Curr. Probl. Dermatol. 2014, 45, 166–174. [Google Scholar] [CrossRef]
- Mirghani, H.; Amen, F.; Moreau, F.; Guigay, J.; Ferchiou, M.; Melkane, A.E.; Hartl, D.M.; Lacau St Guily, J. Human papilloma virus testing in oropharyngeal squamous cell carcinoma: What the clinician should know. Oral Oncol. 2014, 50, 1–9. [Google Scholar] [CrossRef]
© 2014 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Garbuglia, A.R. Human Papillomavirus in Head and Neck Cancer. Cancers 2014, 6, 1705-1726. https://doi.org/10.3390/cancers6031705
Garbuglia AR. Human Papillomavirus in Head and Neck Cancer. Cancers. 2014; 6(3):1705-1726. https://doi.org/10.3390/cancers6031705
Chicago/Turabian StyleGarbuglia, Anna Rosa. 2014. "Human Papillomavirus in Head and Neck Cancer" Cancers 6, no. 3: 1705-1726. https://doi.org/10.3390/cancers6031705