A novel mutation in the PRPH2 gene in a Chinese pedigree with retinitis pigmentosa and angle-closure glaucoma

The proband (Fig. 1, III: 3) was a 60 years old Han male and presented to us with blurring of vision and recurrent short episodes of pain in the right eye for a period of more than 1 year. The intraocular pressure (IOP) was 31 mmHg oculus dexter (OD) and 16 mmHg oculus sinister (OS), and the anterior chamber of both eyes was shallow with closed angles. Based on this, the patient was initially diagnosed with chronic angle closure glaucoma. During genetic counseling, the patient revealed that his maternal grandfather, mother, elder sister, and himself all suffered with nyctalopia at an early age. The patient and his sister received a clinical diagnosis of RP, and his sister underwent glaucoma surgery, when she was alive. The patient’s elder brother, who was 65 years old at the time of genetic counseling, was considered to be completely healthy, without any clinical indications of RP. The proband underwent a full ophthalmic examination, including fundus photography, visual field testing, optical coherence tomography (OCT), and ultrasound biomicroscopy (UBM). Peripheral blood samples were collected from all participants for genomic DNA extraction using standard protocols [11].

Whole-exome sequencing (WES) was performed on DNA from peripheral blood. After the fragmentation of genomic DNA, ligation of the paired-End adapter, and amplification and purification, all exons and 50 bp regions adjacent to introns were captured using the SeqCap EZ Med Exome Enrichment Kit (Roche NimbleGen). The DNA library was prepared by post-capture amplification and purification, followed by sequencing with the Illumina HiSeq sequencing platform. Sequence data alignments to the human genome reference (hg19) and variant-calling were performed using NextGene V2.3.4 software, further to get the coverage and mean read depth of the target regions. The mean read depth was 249.70×, and read depth reached 20× for 97.202% of the target sequences [12]. Variants were screened as followed: 1) Preference to the variants related to the diseases, small INDEL, canonical splice sites and missense variants. 2) Minor allele frequency in normal populations < 5% (except for the known MAF > =5% pathogenicity). 3) Preference to the variants in HGMD, ClinVar. 4) Preference to the variants in OMIM. The variants of pathogenicity were according to Standards and guidelines for the interpretation of sequence variants published by ACMG in 2015 with HGVS nomenclature.

Sanger sequencing was performed to verify the mutation identified in the PRPH2 gene. The following primers were used for PCR amplifications: PRPH2 forward 5’to 3′:TGTCTTCAGCGCCTAGAACAGTGA; and PRPH2 reverse 5’to 3′:AAGGCTGTTTCCAAAGAGGGAGG.

Analysis including the conservation of nucleotide bases and amino acids, the frequency of the normal population (1000 Genomes Project, ExAC, dbSNP database and locus specific databases), as well as the use of data from Human Gene Mutation Database (HGMD), ClinVar database, and Online Mendelian Inheritance in Man (OMIM), were performed by NextGene V2.3.4 software and lab’s own scripts [13]. The potential deleterious effects and biological function of the mutation were predicted using SIFT (http://​sift.​jcvi.​org), PolyPhen-2 (http://​genetics.​bwh.​harvard.​edu/​pph2/​), and Mutation Taster (http://​www.​mutationtaster.​org/​). The variance of pathogenicity was evaluated according to the Standards and Guidelines for the Interpretation of Sequence Variants, published by American College of Medical Genetics (ACMG) in 2015 with HGVS nomenclature. I-TASSER software was used to model and PyMOL Viewer was used to visualize the protein configuration prediction results.

The pedigree of this family showed an autosomal dominant form of RP (Fig. 1). Physical examination of the proband (III: 3) excluded systemic disorders. Upon ophthalmic examination, uncorrected visual acuity was 20/500 OD and 20/133 OS. Corrected distance visual acuity (CDVA) was 20/200 with a refraction of − 3.50-1.25 × 011 OD, and 20/66 with a refraction of − 2.25-1.50 × 170 OS. The shallow anterior chamber (1.85 mm OD and 2.08 mm OS) with closed angles in both eyes was confirmed by both slit-lamp microscope and UBM (Fig. 2a, b). These results are in accordance with the clinical manifestations of closure glaucoma.

The patient also presented characteristic fundus features of RP, including the waxy pallor optic disc, attenuated retinal vessels, and bone spicule pigment deposits (Fig. 3a). OCT revealed that the continuity of the IS/OS (Inner Segment/Out Segment) layer was destroyed, demonstrating degenerative changes of the photoreceptor cell (Fig. 3b). Tubular visual field was observed in both eyes during visual field testing (Fig. 3c). The results of examination using the slit-lamp microscope, gonioscope, as well as the ophthalmoscope examination of the proband’s elder brother and son, were normal (data not shown). Because of the unsatisfactory effect of antiglaucomatous drugs, the proband underwent trabecular filtration surgery for both eyes, and after a one-year follow-up the vision and visual field was found to be stable for both eyes.

To validate the diagnoses, we applied WES technology to the proband and his family members. Sequence data alignments to the human genome reference (hg19) and variants-calling were used by NextGene V2.3.4 software, further to get the coverage and mean read depth of the target regions. The mean read depth was 249.70×, and read depth reached 20× for 97.202% of the target sequences [12]. Based on current public databases, non-pathogenic variations was filtered out with IFT, Polyphen 2 and MutationTaster and were prioritized for further confirmation and characterization. A single nucleotide heterozygous, transversion mutation (c.626 T > A) of exon 2 in the PRPH2 gene in the proband was identified, resulting in the substitution of a Valine to an aspartic acid in codon 209 (Fig. 4a). The substitution was not detected in 1000 Genomes Project, indicating that it was not a polymorphism. Human PRPH2 has a tetraspanin domain, which is a transmembrane receptor glycoprotein with 4 transmembrane domains. The transversion mutation was found in the tetraspanin domain at position 209 (V209D) (Fig. 4b). Moreover, this mutation was predicted to be damaging using both Polyphen v.2, with a score of 0.998, and SIFT software programs (Fig. 4c). MutationTaster deduced that this mutation had a high probability of affecting protein properties, and was pathogenic. The conservation of p.V209 in various species was demonstrated in multiple amino acid sequence alignments, using the ClustalW tool (Fig. 4d). This novel mutation in PRPH2 is predicted to cause an abnormal connection of nascent outer segment discs, leading to defects in the formation of the photoreceptor outer segment (Fig. 4e). Other variants in genes for IFT172, DFNB31, PDHX, SALL2, BMP4 and GPR179 by WES were excluded as deleterious and pathogenic mutations, and none of them was reported as a stronger/convincing glaucoma causing variant in the literature.