Background
Prostate cancer (PC) is the most common cancer diagnosed among males in the US and the second cause of cancer death in men [
1]. The extremely high morbidity and mortality make PC one of the most serious threats to men’s health [
2]. Nowadays, the PC treatments only rely on surgery or radiotherapy when the cancer is still in the localized stage [
3,
4]. Thus the survival rate would be commonly improved if PC could be diagnosed in the early stage. Although there has been vast of progress in understanding PC pathobiology, there is no approved test for the diagnosis and monitoring of PC except for prostate-specific antigen (PSA) test. However, PSA is not used widely as a diagnostic marker for PC due to its low specificity and sensitivity [
5].
Benign prostatic hyperplasia (BPH) is a kind of prostatic nonmalignant hyperplasia and may cause serious symptoms such as lower urinary tract symptoms (LUTS) which undermines patients’ life quality [
6]. Meta-analyses data shows BPH is associated with an increased incidence of prostate cancer and these two prostatic diseases have certain similar traits such as androgen-dependent growth or response to hormonal therapy, which lead to overtreatment or delayed treatment of the diseases [
6,
7]. To judge the state of prostatic disease better, new biomarkers are needed to show some meaningful clues in the process of prostate diseases.
Recently, studies have shown that the dysregulation of homeobox (HOX) gene family occurs in many cancers, including solid and hematological malignancies [
8]. Engrailed-2 (EN2), a member of the HOX gene family, has been found to overexpress in various kinds of cancers like PC, breast cancer and bladder cancer, and play important roles in oncogenesis [
8,
9]. It has been reported that positive detection of EN2 in patients’ urine with ELISA was predictive of PC with high sensitivity and specificity (66 and 88.2% respectively) [
10]. Moreover, a strong positive correlation was shown not only between pre-surgical level of urinary EN2 and the volume of cancerous tissues removed in prostatectomy, but also between EN2 levels and tumor stages [
11]. Since EN2 can be detected in urine after prostate carcinogenesis, intracellular EN2 may change expression form because normal prostate tissue and hypertrophic prostatic cells do not secrete EN2 [
10,
11]. All these results suggest a potential for EN2 as a candidate biomarker in early detection of PC or the differential diagnosis for PC and BPH.
Structurely, the full length of EN2 protein has 333aa, including three alpha helices, with the helix 1 and 2 at the N end binding DNA, and helix 3 at C end, mainly mediating the exocrine and internalization of EN2 protein [
12,
13]. We produced a monoclonal antibody targeting Helix 3 in EN2, and conducted immunohistochemical staining with this homemade antibody to detect EN2 expression patterns in 25 BPH and 25 PC cases. The EN2 expression levels of these cases were confirmed by RT-PCR. We also analyzed the EN2 immunohistochemical scores, the clinical indicators, and their correlation in PC cases and found the expression level of EN2 was positively correlated with PC clinical progress.
Methods
Ethics statement
This study involving human participants was approved by the ethics committee of The First Affiliated Hospital of Zhengzhou University. The audit number of ethics committee was 2019-KY-185. Written consent was obtained from all human participants. Research was carried out according to the principles expressed in the Declaration of Helsinki.
Patients and samples
Clinical samples and patient records corresponding to 50 consecutive patients diagnosed as PC or BPH at the Urology Department of The First Affiliated Hospital of Zhengzhou University between January 2017 and October 2018 were examined. The inclusion criteria were as following: (1) Only patients who came to our hospital for the first time for examination and diagnosis were collected; (2) No other systemic tumors, severe infection and trauma; (3) 1 week before the examination of serum PSA, there was no indwelling catheterization, cystoscopy, digital rectal examination and other operations affecting the result of serum PSA and inflammatory indicators; (4) No endocrine treatment; (5) No coagulation dysfunction, serious cardiovascular and cerebrovascular diseases. Patients underwent Laparoscopic radical prostatectomy and cancer or hyperplasia samples were split in half immediately after resection. One half was embedded with paraffin, and the other half was immediately snap-frozen in liquid nitrogen for RT-PCR analyses. All the samples used were confirmed by a pathologist.
Cell culture and experimental reagents
Human PC cell lines, LNCaP clone FGC cells (LNCaP) (ATCC CRL-1740 cells), DU145 (ATCC HTB-81 cells) and PC3 (ATCC CRL-1435 cells), and human embryonic kidney cell line (293 T) (ATCC CRL-11268 cells) were bought from ATCC in January 2017. All these cells were authenticated with short tandem repeat (STR) analysis by ATCC. Mycoplasma contamination test was done with PCR Detection Kit for Mycoplasma Contamination (#Myco-P-20, Shanghai Yanxi biotechnology co., LTD, China). LNCap cells were cultured with Roswell Park Memorial Institute (RPMI) 1640 medium (#11875093, Gibco, USA), DU145 cells were cultured with Dulbecco’s Modified Eagle’s Medium (DMEM) (#11995040, Gibco, USA), PC3 cells were cultured with DMEM/F12 (#11330057, Gibco, USA), and 293 T cells were cultured with DMEM (#11995040, Gibco, USA). The culture medium was supplemented with 10% fetal bovine serum (#16140089, Gibco, USA), 100 U/ml penicillin and 100 μg/ml streptomycin (#15070063, Gibco, USA) when used and cells were incubated at 37 °C in a humidified incubator with 5% CO2. Ethical clearance to use these human cell lines was obtained from the Ethics Committee for Research Involving Human Subjects, The First Affiliated Hospital of Zhengzhou University. [No. 2019-KY-185].
Preparation of monoclonal antibodies against Engrailed-2
C-terminal 114aa of EN2 was selected according to EN2 mRNA sequence (NCBI Reference Sequence: NM_001427.3) to prepare the EN2 monoclonal antibodies. Briefly, the gene encoding C-terminal 114aa of EN2 was synthesized in Sangon Biotech (Shanghai, China) Co., Ltd. A hexahistidine tag was added to the carboxyl terminus to aid in the detection and purification of the final protein product. The resulting gene was cloned into the expression vector pET30a and transformed into E. coli strain BL21(λDE3). Single bacterial colony was inoculated into LB medium and grown at 37 °C to OD600 of 0.6. Expression of the recombinant EN2C protein was induced with 0.1 mM isopropyl β-D-1-thiogalactopyranoside at 37 °C for 4 h. The culture mixture was centrifuged at 2000×g for 15 min, and supernatant was collected. Soluble EN2 C-terminal 114aa was purified by Ni + affinity column and used to immunize Balb/c mice. The spleenocytes from the immunized Balb/c mice were obtained and fused with Balb/c mouse myeloma cells by hybridoma technique, and monoclonal antibodies were obtained by screening. The affinity and specificity of EN2 monoclonal antibodies were identified through ELISA, WB, immunofluorescence and immunohistochemistry.
Western blotting
EN2 protein or cell total protein were run WB to identify specificity of EN2 monoclonal antibody. Three prostate cancer cell lines, PC3, DU145, LNcap and transfected 293 T cell were used. Cells grown in a 100 mm cell culture dish were rinsed with PBS buffer prior to harvesting. Total proteins were extracted with Cell Culture Lysis 1 × Reagent (#53711–5399, Promega Inc., USA) according to the product instruction and incubated on ice for 10 min. The cell lysate was separated by centrifugation at 12,000 x g for 2 min. The protein concentation was measured by BCA Protein Assay Reagent (#PC0020, Solarbio Inc., China). For SDS-PAGE, a total of 20 μg of protein was loaded per well. Polyvinylidenedifluoride (PVDF) membranes (Roche Diagnostics, USA) were used for the transfer process. For WB, PVDF membranes after protein transfer were incubated in 5% skimmed milk blocking buffer for 1 h, followed by washing 3 times with PBST (buffered saline plus 0.05% Tween 20). EN2 was detected using the monoclonal antibody and horseradish peroxidase-conjugated goat anti-mouse IgG secondary antibody (1:10,000; #ZB-2305; ZSGB-BIO Inc., China).
Immunofluorescence
The recombinant pcDNA3.1-EN2-Red fluorescent protein (RFP) was transfected into 293 T or prostate cancer cell lines PC-3, DU-145 or LNCap, using PEI (polyethylenimine linear, #23966, Polysciences Inc., USA). After incubating at 37 °C, 5% CO2 for 6 h, the culture medium was replaced with DMEM complete medium and cultured for another 24 h. The culture medium was aspirated, and cells were fixed by incubating with 4% paraformaldehyde (#P1110,Solarbio Inc., China) for 15 min at room temperature. After washing twice in PBS buffer, freshly prepared 0.2% Triton X-100 (#T8200, Solarbio Inc., China) was added and incubated for 10 min at room temperature. Block with 5% BSA for 30 min. The monoclonal antibody of EN2 was added and incubated at 37 °C for 2 h. The Goat anti-mouse IgG/FITC (#SF131, Solarbio Inc., China) was added and incubated for 35 min at 37 °C in the dark. After washing twice with PBS, it was observed under a fluorescence microscope.
Immunohistochemical staining of EN2 in PC or BPH tissues
Briefly, all paraffin embed PC tissues were cut into 3 μm sections. The slides were deparaffinized by heating at 60 °C and then immersed in xylene and rehydrated. The sections were boiled in 1 mM EDTA buffer solution (pH 9.0) for 20 min in a pressure cooker. Subsequently, endogenous peroxidase activity was quenched by immersing the samples in 3% hydrogen peroxide for 10 min. Each section was blocked in Tris-buffered saline with Tween20/5% normal goat serum (#ZLI-9022, ZSGB-Bio Inc., China) for 1 h at room temperature to block nonspecific binding. Then the sections were incubated with anti–EN2 monoclonal antibody at 37 °C for 60 min. Subsequently, a secondary biotinylated horse anti-mouse IgG solution (#ZB-2020, ZSGB-Bio Inc., China) and an avidin-biotin peroxidase reagent (#SPN9002, ZSGB-Bio Inc., China) were added onto the slides. The negative control sample was treated identically but with the isotype antibody. The color reaction was visualized by incubating with DAB solution (#ZLI-9017, ZSGB-Bio Inc., China) for 5 min. After washed thoroughly, the slides were placed in hematoxylin for redyeing. After dehydration with xylene and ethanol, the slides were sealed with neutral gum. For HE staining, the slides were placed in xylene and ethanol solution for dewaxing and hydration. After staining with hematoxylin for 5 min, the slides were rinsed for 10 min, and stained with 0.5% eosin aqueous solution for 1 min. After dehydration with xylene and ethanol, the slides were sealed with neutral gum.
Evaluation of Immunohistochemical staining
Images were captured by a fluorescence microscope (Olympus DP74) and analyzed with the assistance of a histopathologist. The observer was blinded to the clinical diagnosis of the tissues at the time of assessment. A total of 100 cells were counted in 10 random fields (with × 400 objectives) and the percentage of positive cells was calculated. The semi-quantitative immunoreaction scoring system was evaluated based on the percentage of positive cells and the stain intensity. Regarding stain intensity, negative staining was defined as 0, mild positive was defined as 1, moderate positive as 2 and strong positive as 3. The scores of immunopositive cells were defined as follows: < 5% immunopositive cells was defined as 0 (negative); 5–25% immunopositive cells as 1 (mild); 25–75% immunopositive cells as 2 (moderate); and > 75% immunopositive cells as 3 (strong). The immunohistochemical score of each section is the sum of the stain intensity and positive cell scores.
RT-qPCR
The EN2 gene expression was measured by reverse transcription quantitative polymerase chain reaction (RT-qPCR). The reverse transcription reaction was performed according to the manufacturer’s instructions by PrimeScript™ RT reagent Kit (#RR047A, TAKARA, Japan) and the qPCR reactions were performed at 94 °C for 5 min, 94 °C for 20 s, 55 °C for 20 s and 72 °C 15 s for 30 cycles, followed by 72 °C for 5 min using 7500 Fast Real-Time PCR System (Applied Biosystems, ThermoFisher Inc., USA). The sequences of the primers are presented in Table
1.
EGFR | ACGGGGTGACTGTTTGGGAGTT | ACTTTGGGCGACTATCTGCGTCT |
VEGF | GGCAGAAGGAGGAGGGCAGAAT | CATCGCATCAGGGGCACACA |
EN2 | CTACTGTACGCGCTACTCGG | CCCGTGGCCTTCTTGATCTT |
mTOR | TGGACACCAACAAGGACGAC | GTCCCACTGACCTAAACCCC |
pTEN | TGGGGAAGTAAGGACCAGAGACAAAA | TGGCAGACCACAAACTGAGGATTG |
GAPDH | TCGGAGTCAACGGATTTGGT | TTCCCGTTCTCAGCCTTGAC |
The relative transcription level was presented as 2-△△Ct of each target in PC tissues relative to BPH tissues. For the first step, we subtracted the transcription level of each target in BPH tissues from the corresponding target level in PC tissues, and got a value asΔCt. The 2-△△Ct value was then be calculated at the second step. In BPH tissues, the relative transcription level of each target was obtained by subtracting the transcription level of an internal reference (GAPDH) from the level of each target in BPH tissues to getΔCt, and the relative transcription levels, represented as 2-△△Ct, was then be calculated at the second step.
Statistics and methods
Data were expressed as mean ± standard deviation (SD). Data that follow the normal distribution were compared using the t-test, otherwise Mann Whitney U test was used. Counting data was expressed as composition ratio or rate (%), and comparison was made by chi-square test. EN2 immunohistochemical scores in 25 PC and 25 BPH cases were analyzed using Fisher’s Exact Test. The correlation between EN2 immunohistochemical score and clinical indicators was analyzed using spearman rank correlation. Data analysis was performed using SPSS 23 software. P < 0.05 was considered statistically significant.
Discussion
BPH and PC are progressive diseases [
16]. Accurate diagnosis can not only improve the cancer treatment but also avoid clinical overtreatment. EN2 had been well studied in the field of neurodevelopment. More and more studies were shown its potential association with tumorigenesis. In this study, we found that EN2 expression pattern and level changed as the prostatic disease progresses. Continuous monitoring of EN2 might be a helpful method for prognosis judgment.
The EN2 Helix 3 has been confirmed to be the main functional structural domain of the protein, mediating its exocrine and internalization [
17,
18]. Some studies have reported that antibodies against this domain of EN2 could identify the concentration of EN2 in PC patients’ urine [
10,
11]. In this study, we used monoclonal antibody against EN2 Helix 3 could distinguish the distribution difference between PC and BPH. We found EN2 mostly localized in the nuclei of cerebellar tissue. Interestingly, EN2 in PC mainly expressed on cytomembrane or expressed as an exocrine expression, while EN2 in BPH mostly expressed in cytoplasm and nuclei. Furthermore, the expression level of EN2 in PC was higher than that in BPH. This interesting finding can help doctors to judge the progress of prostatic diseases and help scientists to understand the characteristics of EN2 in different tissues. However, the precise criteria of EN2 to define PC or BPH can’t been given from this study because of the limited samples.
It is noteworthy that the subcellular distribution of EN2 in PC cell lines and PC tissues were not exactly the same. Cytoplasm staining pattern was observed in all three PC cell lines which was usually seen in BPH tissues. Weak nucleus staining pattern in all three PC cell lines was usually in PC tissues. But strong cytomembrane staining pattern was only observed in prostatic malignant tissues. EN2 itself is a transcription factor that interacts with DNA and is supposed to exist in the nucleus for normal cells. Because the expression and characteristic of EN2 could change due to the change of cell proliferation, EN2 could be secreted into the cytoplasm and even extracellular in cancer cells [
13,
19]. Some studies have reported that LNCap, DU145 and PC3 cells represent three different stages of prostate cancer [
20‐
22], but in this study, no significant differences of EN2 in the subcellular localization was found among these three cell lines. It is possible that the number of passages and the artificial medium conditions in vitro led to changes in the original tumor malignancy of the cell lines.
Limited to the sample number, no statistical difference between any two clinical indexes was found, except for significant difference between EN2 and the clinical staging of PC. This result further confirmed the difference of EN2 expression level and patterns between BPH and PC could suggest the progress and prognosis of prostatic diseases. Studies with more clinical samples are needed to confirm our new finding and set up a precise criteria for using EN2 as a biomarker in prostatic diseases.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.