Introduction
Hepatocellular carcinoma (HCC), referred to as liver cancer, ranks as the second most prevalent cancer globally and is marked by a high recurrence rate and high mortality rate [
1‐
4]. Chronic infection of hepatitis B, fatty liver, obesity, smoking, and alcohol consumption are known risk factors for liver cancer [
5,
6]. Treatment approaches for HCC include surgical resection, liver transplantation, chemotherapy, and immunotherapy [
7,
8]. However, HCC is often diagnosed at advanced stages, where surgical and chemotherapeutic interventions have limited efficacy, and the prognosis is poor, with potential for metastasis [
7]. HCC treatment also includes drug therapies such as Sorafenib, which has been shown to increase the likelihood of survival for patients with advanced HCC, and Lenvatinib, which has demonstrated the potential to enhance the chances of survival for patients with unresectable HCC [
9,
10]. Nevertheless, Sorafenib can lead to side effects, including diarrhea and hypertension, while Lenvatinib treatment may be associated with thyroid toxicity concerns [
11,
12]. Therefore, it is necessary to identify new therapeutic targets.
Regorafenib is a type II kinase inhibitor [
13]. By inhibiting the activity of vascular endothelial growth factor receptor (VEGFR) and RAF proto-oncogene serine/threonine-protein kinase (RAF), Regorafenib effectively blocks cell proliferation and angiogenesis [
14,
15]. Regorafenib has demonstrated significant anti-tumor activity in a series of preclinical models, and studies have shown its effectiveness in patients who experience HCC reappearance following liver transplantation [
15‐
17]. However, there is limited research on the mechanism of action of Regorafenib in HCC, and our understanding of its mechanism remains incomplete. Therefore, further investigation into the mechanism of action of Regorafenib in HCC is necessary.
C/EBP-homologous protein (CHOP), referred to as DNA injury-inducible transcript 3 (DDIT3), is a 29kD protein and a significant marker of endoplasmic reticulum stress, which can induce cell cycle arrest [
18‐
20]. Evidence supports the role of CHOP in regulating the hypoxic mechanism in liver cancer cells [
21]. Moreover, we discovered an upregulation of CHOP expression through mRNA sequencing analysis following the administration of Regorafenib. Additionally, Regorafenib intervention has been shown to trigger apoptosis and cell cycle arrest in cancer cells [
17]. Therefore, we speculate that Regorafenib and CHOP may be involved in the cell cycle arrest process in HCC.
N6-methyladenosine (m6A) is one of the most abundant modifications in mammalian messenger RNAs (mRNAs) and is considered a promising target for diagnosis and therapeutic intervention in cancer [
22‐
25]. m6A modification is regulated by proteins termed as “writer,” “eraser,” and “reader.” [
26]. Of these, the primary mediator responsible for m6A modification is the m6A methyltransferase enzyme (writer), such as METTL14 [
27,
28]. According to reports, METTL14 has been shown to promote the decay of CHOP mRNA through m6A methylation modification [
22]. Furthermore, METTL14 has been found to exhibit an inhibitory effect in HCC and colorectal cancer [
27,
29]. We observed a downregulation in the expression of METTL14 after the administration of Regorafenib. However, it is still unclear whether Regorafenib affects HCC through the modulation of the m6A mechanism mediated by METTL14.
To validate this speculation, we first screened Regorafenib-sensitive HCC cells. Subsequently, these selected cells were injected subcutaneously into mice after Regorafenib intervention, while also transfecting them with oe-CHOP, to investigate the impact of Regorafenib and CHOP on tumor growth. Furthermore, we investigated the detailed mechanisms of the actions of Regorafenib, CHOP, and METTL14-m6A in the selected HCC cells, providing valuable insights for the treatment of HCC.
Materials and methods
Cell culture
The four HCC cell lines, Huh-7 (AW-CCH089), SK-Hep-1 (AW-CCH036), HCC-LM3 (AW-CCH036), and HepG2 (AW-CCH024), were all purchased from Abiowell. Huh-7 cells and HCC-LM3 cells were cultivated in Dulbecco’s modified Eagle medium (DMEM, D5796-500ML, Sigma, USA), and SK-Hep-1 and HepG2cells were cultivated in a minimal essential medium (MEM, 11,095,080, Gibco, USA). These media were supplemented with 10% fetal bovine serum (FBS, 10,099,141, Gibco, USA) and 1% Penicillin/Streptomycin (AWI0070a, Abiowell, China). Cells were cultured in a saturated humidity incubator (DH-160I, SANTN, China) with 5% CO2 at 37℃. The sh-METTL14, oe-METTL14, sh-CHOP, and oe-CHOP plasmids, along with their respective control plasmids, were procured from HonorGene. They were transfected into SK-Hep-1 and HCC-LM3 cells by using Lipofectamine 2000 (11,668,019, Invitrogen, USA).
Cell grouping and treatment
Group 1 consists of SK-Hep-1 and HCC-LM3 cells that were treated with different concentrations of Regorafenib (0, 5, 10, 15, 30, 60 µM) for 24 h to assess the anti-tumor activity of Regorafenib (S86421, Shyuanye, China) [
14]. Group 2 consists of three subgroups: Control, vehicle, and Regorafenib. The two cells were cultured under normal conditions. In the vehicle group, 0.5 µL of DMSO was added to the culture medium of the two cells. In the Regorafenib group, the two cells were exposed to a concentration of 10 µM Regorafenib for 24 h. Group 3 consists of four subgroups: sh-NC, sh-METTL14, oe-NC, and oe-METTL14. In each subgroup of the two cells, transfection was performed with sh-NC, sh-METTL14, oe-NC, and oe-METTL14, respectively. Group 4 consists of four subgroups: vehicle + oe-NC, vehicle + oe-METTL14, Regorafenib + oe-NC, and Regorafenib + oe-METTL14. Group 5 consists of four subgroups: vehicle + sh-NC, vehicle + sh-CHOP, Regorafenib + sh-NC, and Regorafenib + sh-CHOP. Group 5 consists of four subgroups: Regorafenib + Control, Regorafenib + sh-NC, Regorafenib + sh-CHOP, Regorafenib + oe-NC, Regorafenib + oe-CHOP. Group 5 consists of four subgroups: Regorafenib + oe-NC + oe-NC, Regorafenib + oe-NC + oe-CHOP, Regorafenib + oe-METTL14 + oe-NC, Regorafenib + oe-METTL14 + oe-CHOP.
Cell counting kit-8 (CCK8) assay
Cells were digested using trypsin (AWC0232, Abiowell, China) and cultured at 37℃. After cell attachment, they were treated according to the group requirement for 24 h. Next, 100 µL of medium containing 10% CCK8 reagent (NU679, DOJINDO, Japan) was utilized to replace the drug-containing medium. Finally, the cells were incubated for an additional 4 h before measuring the optical density (OD) at 450 nm using a multifunctional microplate reader (MB-530, HEALES, China).
5-Ethynyl-2’-deoxyuridine (EdU) staining
The logarithmically growing cells were seeded onto a well plate and then were treated according to the requirements of each group for 24 h. Following the guidelines provided by the EdU detection kit (C10310, RIBOBIO, China), cells in each group were subjected to EdU labeling, immobilization, Apollo staining, and DNA staining, and images were collected by fluorescence microscope (BA410T, Motic, Singapore).
The two cells (SK-Hep-1 and HCC-LM3) were seeded onto plates, and cultured for two weeks in a humidified incubator at 37℃ with 5% CO2. Following PBS wash, each well was treated with 1 mL of 4% paraformaldehyde (N1012, NCM Biotech, China) solution for cell fixation. Following that, 1 mL of crystal violet (G1062, Solarbio, China) was introduced and allowed to incubate at room temperature for 30 min to facilitate staining. Finally, the stained cells were photographed and counted.
Flow cytometry (FCM)
To conduct cell cycle detection, the two cells were treated with 1.2 mL of pre-cooled 100% ethanol, resulting in a final concentration of 75%. Subsequently, the cells were fixed by overnight incubation at 4℃. After the cells were washed with PBS, they were centrifuged. Then, they were mixed with 150 µL of propidium iodide (PI, MB2920, Meilune, China) and stained for 30 min at 4℃. Different stages of the cell cycle have different DNA content, and PI can label DNA to determine which cycle the cell is in. Detection of stained cells with a flow cytometer (A00-1-1102, Beckman, USA), PI was excited by a 488 nm argon laser and detected through a 630 nm bandpass filter, collecting around 15,000 cells in FSC/SSC dot plots, and analyzing the percentage of cells in each cell cycle phase on the PI fluorescence histogram to determine positive cell staining. For apoptosis detection, SK-Hep-1 and HCC-LM3 cells were treated with trypsin (AWC0232, Abiowell, China). Following digestion, after washing the cells with PBS, approximately 3.2 × 105 cells were collected for further analysis. Following the instruction provided by the apoptosis detection kit (KGA1030, KeyGEN BioTECH, Nanjing, China), the cell suspension was treated with Annexin V-FITC (5 µL) and PI (5 µL) successively. The mixture was then incubated at room temperature for 10 min in the absence of light before further analysis.
RNA-sequencing (RNA-seq)
Total RNA extraction from SK-Hep-1 cells, HCC-LM3 cells, and tumor tissues was performed using Trizol reagent (15,596,026, Thermo, USA). cDNA was obtained by reverse transcription using a reverse transcription kit (CW2569, CWBIO, China). Subsequently, proceed with the steps of RNA library preparation, sequencing, and data analysis.
Real-time fluorescence quantitative polymerase chain reaction (RT-qPCR)
Total RNA extraction from SK-Hep-1 cells, HCC-LM3 cells, and tumor tissues was treated with Trizol reagent (15,596,026, Thermo, USA). Reverse transcription was performed by using an mRNA reverse transcription kit, followed by RT-qPCR with UltraSYBR Mixture (CW2601, CWBIO, China). The gene expression was quantified using the 2
−ΔΔCt method using β-actin as the internal reference. Detailed primer sequences can be found in Table
1.
CHOP | F GCCCTCACTCTCCAGATTCCA | 134 bp |
R TTTCTCCTTCATGCGCTGCT |
METTL14 | F GTAGCACAGACGGGGACTTC | 195 bp |
R TTGGTCCAACTGTGAGCCAG |
β-actin | F ACCCTGAAGTACCCCATCGAG | 224 bp |
R AGCACAGCCTGGATAGCAAC | |
RNA immunoprecipitation (RIP)
The cell pellet (approximately 100 µL) was mixed gently by pipetting with an equal volume of pre-configured RIP Lysis buffer (RIP-12RXN, Sigma, USA) and incubated on ice for 5 min before storing at -80 °C. Subsequently, 50 µL of magnetic beads (20,164, Thermo, USA) were added to each centrifuge tube labeled with IP and Normal IgG. After adding 500 µL of RIP Wash Buffer to the tubes, they were briefly vortexed and centrifuged using a vortex mixer. Then, the centrifuge tubes were placed in the magnetic field to discard the supernatant. The magnetic beads were resuspended in 100 µL of RIP Wash Buffer in each tube, followed by the addition of 5 µg of antibody and thorough mixing. The tubes were rotated at room temperature for 30 min, followed by brief centrifugation and removal of the supernatant using the magnetic field. This washing step was repeated twice. Finally, 500 µL of RIP Wash Buffer was added to each tube, briefly vortexed, and placed on ice. The RNA Immunoprecipitation Kit (RIP-12RXN, Sigma, USA) was utilized following the instructions provided. RNA was purified using TRIzol (15,596,026, Sigma, USA), and cDNA was generated utilizing the mRNA reverse transcription kit with mRNA as a template. The resulting products were used for RT-qPCR experiments.
Western blot (WB)
Extract total proteins from cells and tumor tissues using Radio immunoprecipitation assay (RIPA) lysate (AWB0136, Abiowell, China). After separation by SDS-PAGE, the protein was tranferred to the nitrocellulose (NC) membranes. Following the blocking step using 5% skimmed milk (AWB0004, Abiowell, China) for 1.5 h, the NC membranes were subjected to incubation with primary antibodies at 4℃ overnight. The NC membranes were subsequently incubated with secondary antibodies. The NC membranes were subjected to incubation with Super ECL Plus detection reagent (AWB0005, Abiowell, China) to facilitate chemiluminescence imaging. The gray values of bands were read by Quantity One 4.6.6 (Bio-Rad Inc., USA). Finally, protein expression was calculated with β-actin as the internal reference. Detailed information for the primary and secondary antibodies can be found in Table
2. Full uncropped Blots images are shown in Figure
S4, Figure
S5, Figure
S6, Figure
S7, Figure
S8, Figure
S9.
Table 2
The information on antibody
METTL14 | 1: 1000 | ab300104 | Rabbit | Abcam | UK |
METTL3 | 1: 1000 | 15073-1-AP | Rabbit | Proteintech | USA |
ALKBH5 | 1: 5000 | 16837-1-AP | Rabbit | Proteintech | USA |
FTO | 1: 2000 | 27226-1-AP | Rabbit | Proteintech | USA |
CHOP | 1: 1000 | 15204-1-AP | Rabbit | Proteintech | USA |
CDK2 | 1: 1000 | 10122-1-AP | Rabbit | Proteintech | USA |
CDK4 | 1: 4000 | 11026-1-AP | Rabbit | Proteintech | USA |
CyclinD1 | 1: 10,000 | 26939-1-AP | Rabbit | Proteintech | USA |
Ki67 | 1: 50 | Ab16667 | Rabbit | Abcam | UK |
β-actin | 1: 5000 | 66009-1-Ig | Mouse | Proteintech | USA |
HRP goat anti-mouse IgG (H + L) | 1: 5000 | AWS0001 | / | Proteintech | USA |
HRP goat anti- Rabbit IgG (H + L) | 1: 5000 | AWS0002 | / | Proteintech | USA |
CoraLite488-conjugated Affinipure Goat Anti-Rabbit IgG (H + L) | 1: 100 | SA00013-2 | / | Proteintech | USA |
15 male BALB/c nude mice were purchased at 4 weeks of age from SJA Laboratory Animal Co., Ltd. in Hunan Province, China. After one week of acclimatization, the nude mice were randomly divided into 5 groups (n = 3): Control, vehicle + oe-NC, vehicle + oe-CHOP, Regorafenib + oe-NC, and Regorafenib + oe-CHOP. The Control group was injected with untreated SK-Hep-1 cells. The vehicle + oe-NC group and Regorafenib + oe-NC group were injected with SK-Hep-1 cells transfected with oe-NC. vehicle + oe-CHOP group and Regorafenib + oe-CHOP group were injected with SK-Hep-1 cells transfected with oe-CHOP. The vehicle + oe-NC group and Regorafenib + oe-NC group were injected with 2 × 106 SK-Hep-1 cells transfected with oe-NC. The injection volume was 100 µL, and the injection site was the right axillary region. After tumor establishment, tumor volume was measured and observed twice a week. On the 17th day after tumor establishment, intervention was initiated. The Regorafenib + oe-NC group and Regorafenib + oe-CHOP group were intraperitoneally injected with regorafenib (10 mg/kg). The vehicle + oe-NC and vehicle + oe-CHOP groups were intraperitoneally injected with an equal volume of regorafenib solvent (10 mL/kg). The Control group was intraperitoneally injected with an equal volume of physiological saline. The intervention was performed every 2 days for a total duration of 20 days. On the 38th day after tumor establishment, pentobarbital sodium was used to anesthetize mice (at a dose of 50 mg/kg body weight). Then the tumors were collected, and measurements for tumor mass and volume were conducted. Tumor volume is determined by applying the formula: tumor volume = (longest axis) × (shortest axis) × (shortest axis) / 2. Finally, euthanasia was performed by cervical dislocation on the anesthetized mice, to minimize their pain as much as possible. All animal experimental procedures were approved by the ethical committee of the Hunan SJA Laboratory Animal Co., Ltd.
Immunofluorescence (IF) staining
The harvested tumors were fixed in 4% paraformaldehyde for subsequent paraffin embedding and sectioning, to be used for immunofluorescence staining analysis. The sections were deparaffinized in xylene and dehydrated in a graded ethanol series (75–100%). Subsequently, the sections were immersed in EDTA buffer (pH 9.0) and boiled for antigen retrieval. The sections underwent a sequential treatment process, including immersion in a sodium borohydride solution, followed by 75% ethanol, a Sudan Black dye solution, and finally followed by rinsing with tap water. The sections were blocked with 5% BSA for 1 h and then incubated overnight at 4℃ with the Ki67. Next, 100 µL of was secondary antibodies added and incubated for 1.5 h. Nuclei staining was performed with 4’,6-diamidino-2-phenylindole (DAPI) reagent (AWI0331a, Abiowell, China) for 20 min. The slices were sealed using buffered glycerol (AWI0178a, Abiowell, China) and examined under a fluorescence microscope. Detailed information for the primary and secondary antibodies can be found in Table
2.
Statistical analysis
The experimental data were subjected to analysis using GraphPad Prism 8.0 software. The data is presented as mean ± standard deviation (SD). To compare multiple groups, we utilized the one-way analysis of variance (ANOVA) followed by Tukey’s posthoc test. We conducted a statistical analysis using a two-way ANOVA with Bonferroni post hoc test to compare groups at different time points. A significance level of P < 0.05 was used.
Discussion
In developing countries, such as China, HCC has emerged as the second most prevalent cause of cancer-related deaths among males [
30]. Despite progress in the early detection and specialized treatment methods for HCC, patients continue to face challenges such as poor prognosis and high rates of tumor recurrence [
31]. It remains a topic of significant interest in clinical research, warranting the exploration of new therapeutic targets. Regorafenib, an orally administered targeted therapy with a broad spectrum of action, has shown efficacy in treating multiple cancer types [
32,
33]. While Arai
et al. have evaluated the safety and effectiveness of Regorafenib, the specific mechanism underlying its action remains unclear [
34]. Currently, research on Regorafenib in cancer primarily relies on clinical experiments, with limited studies investigating its specific mechanisms, predominantly in the context of colorectal cancer. We investigated to explore the impact of Regorafenib on HCC and elucidated its underlying mechanism, thereby contributing to the understanding of its therapeutic potential.
Following a similar research approach to Subramonian
et al., who investigated the treatment of neuroblastoma with Regorafenib, we conducted screenings using multiple cancer cell lines to identify Regorafenib-sensitive strains and determine the optimal intervention concentration [
17]. Four cell lines were selected for screening, revealing that SK-Hep-1 and HCC-LM3 cell lines exhibited higher sensitivity to Regorafenib. Notably, Regorafenib demonstrated a significant inhibitory effect on cancer cell proliferation, echoing the findings reported by Subramanian
et al. [
17].
Subsequently, we investigated the mechanism underlying Regorafenib’s action in HCC. Research findings have shown the involvement of CHOP in the regulation of the hypoxic mechanism in HCC cells [
21]. Moreover, we discovered an upregulation of CHOP expression through mRNA sequencing analysis following the administration of Regorafenib. Further, RIP experiments unveiled the m6A methylation modification on CHOP in HCC. m6A methylation serves as a prevalent epigenetic modification, with METTL14 acting as a key writer protein that enhances m6A methylation levels [
27,
28]. Notably, in renal cancer, METTL14 suppresses the migration and invasion capabilities of renal cancer cells through m6A modification [
35]. Our research uncovered a significant downregulation of METTL14 expression following Regorafenib intervention. Knockdown of METTL14 through shRNA transfection induced a significant reduction in m6A levels of CHOP mRNA, concomitant with an upregulation of CHOP expression levels. According to reports, METTL14 has been shown to promote the decay of CHOP mRNA through m6A methylation modification [
22]. These findings suggested that Regorafenib can promote the expression of CHOP by weakening the m6A methylation mediated by METTL14. Wei
et al. found that METTL14-mediated m6 modification inhibits the expression of CHOP, and our results are consistent with theirs [
22].
Regorafenib intervention has been shown to induce apoptosis and cell cycle arrest in cancer cells [
17]. Moreover, our study elucidated that Regorafenib intervention exerted notable effects on cell cycle progression in the cells (SK-Hep-1 and HCC-LM3), leading to a prominent extension of the G1 phase alongside a concurrent reduction in the S phase. Importantly, transfection with sh-CHOP prominently mitigated the effects of Regorafenib intervention. Our results indicated that Regorafenib exerts effects on cell cycle arrest in cancer cells through the regulation of CHOP via the METTL14-m6A pathway. Consistent with the findings reported by Subramonian
et al., Regorafenib treatment was observed to significantly lengthen the G1 phase, while transfection of CHOP plasmids induced G1/S arrest in proliferating NIH3T3 cells [
17,
36]. Our findings corroborated these studies’ conclusions. In our subsequent experiments, we observed that transfection with oe-CHOP significantly increased sensitivity to regorafenib, leading to a decrease in cell proliferation activity, reduced clone formation, and an increase in apoptosis in the cells. On the other hand, oe-METTL14 weakened the enhancing effect of oe-CHOP transfection on regorafenib intervention. Our findings provided compelling evidence that the METTL14/CHOP axis significantly influences the sensitivity of HCC cells to Regorafenib. In vivo, our findings showed that the enhancement of CHOP significantly potentiated the anticancer effects of Regorafenib, resulting in a notable reduction in tumor volume and mass in mice, which is consistent with our in vitro cell experiment results. In contrast to Fang study, which did not provide a clear explanation for how ATF4 and ATF3 regulate CHOP to induce apoptosis in human lens epithelial cells, our experiments successfully elucidated the mechanism through which Regorafenib regulates the expression of CHOP [
37]. We elucidated the mechanism of Regorafenib in regulating CHOP through our experiments and demonstrated that the METTL14/CHOP axis also contributes to the effects of Regorafenib.
However, this study presents several limitations that should be acknowledged. Specifically, our research was limited to animal experiments and did not include validation of the effectiveness in clinical settings.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.