Background
In recent years, vital pulp therapy (VPT) has been reinvigorated due to the advent of bioactive calcium silicate cements and improvements in the understanding of pulpal immunity and biology. The position statements of the European Society of Endodontology (ESE) and American Association of Endodontists (AAE) have suggested that VPT may be used in mature teeth even with symptomatic pulp [
1,
2]. Several studies have also verified the efficacy of VPT for mature teeth with irreversible pulpitis caused by caries [
3,
4]. In these cases, precise removal of infected pulp tissue and preservation of healthy pulp are the critical steps of VPT. However, this procedure can be a challenge for practitioners, as the depth of infected pulp tissues is difficult to assess [
5]. Earlier findings and our previous study have shown that biomarkers for pulp inflammation may help identify specific pathological conditions associated with pulpitis [
6,
7]. However, direct correlations between biomarkers and histologic diagnoses have not been established. Recently, the question of how to control pulp inflammation and promote pulp tissue repair using pulp capping materials has attracted substantial interest in this field [
8].
Ideal pulp capping materials should have excellent biocompatibility, good sealing ability, ease of handling, and the ability to stimulate dentin bridge formation [
9]. Calcium silicate cements, including mineral trioxide aggregate (MTA), iRoot BP Plus, and Biodentine, have been used as pulp capping materials in VPT [
10,
11]. For carious exposed pulp diagnosed with reversible pulpitis, calcium silicate cements were reported to have a high success rate with direct pulp capping (DPC) [
12]. Nevertheless, pulpotomy with calcium silicate cements has been suggested for symptomatic irreversible pulpitis, which involves removal of infected and irreversibly inflamed pulp tissue [
2]. In comparison with pulpotomy, DPC preserves the structural integrity and immunological functions of the tooth, thus resulting in more predictable healing and pulp sensitivity responses after treatment [
13]. We hypothesized that if pulp inflammation can be reversed or arrested in cases of irreversible pulpitis, DPC may be advantageous. Recently, newly developed and refined biologically based wound-healing strategies have been proposed to improve the outcomes of VPT [
8]. The optimization of pulp capping agents is imperative for VPT outcomes. Therefore, successful DPC treatment under unpredictable inflammatory conditions in pulp tissue requires pulp capping materials with greater efficacy to modulate the inflammatory response and reestablish normal pulp.
Concentrated growth factor (CGF), the latest generation of platelet concentrate products, has been used as a bioscaffold for tissue regeneration [
14‐
17]. CGF has a relatively stiff structure similar to that of natural fibrin endowed with white blood cells, red blood cells and blood platelets [
18,
19]. It contains abundant growth factors, including platelet-derived growth factor-BB (PDGF-BB), transforming growth factor β-1 (TGF-β1), insulin-like growth factor-1 (IGF-1), vascular endothelial growth factor (VEGF), and basic fibroblast growth factor (bFGF) [
20,
21], which are involved in the regulation of cell migration, proliferation, differentiation, and angiogenesis and vital for tissue regeneration. Xu et al. found that CGF could reduce the expression of IL-8 and TNF-α in hDPSCs in vitro [
22], indicating that CGF may regulate the inflammatory response of dental pulp. However, CGF has certain solubility and poor stability, which is not sufficient to continuously support tissue repair and regeneration [
23]. In recent years, some studies have applied platelet concentrates combined with bioceramic materials as pulp capping materials [
24,
25]. An in vitro study showed that compared with MTA or platelet-rich fibrin (PRF) alone, the composite pulp capping material of PRF combined with MTA could promote the expression of dentin sialophosphoprotein (DSPP) and dentin matrix protein-1 (DMP-1), enhance alkaline phosphatase (ALP) activity, and induce mineralization of human dental pulp cells [
24]. When used as a DPC agent for rat molars with mechanical pulp exposure, the combination of PRF and MTA promoted the formation of reparative dentin [
25], suggesting that this kind of new composite material that combines platelet concentrates with bioactive calcium silicate cements has potential as a pulp capping material. However, there are few reports about the effects of this new type of composite pulp capping material on the inflammatory response in dental pulp in an inflamed microenvironment.
The present study aimed to evaluate the effects of CGF combined with iRoot BP Plus on the inflammatory response and odontogenic differentiation ability of human dental pulp stem cells (hDPSCs) under inflamed conditions in vitro and the potential role of this composite biomaterial in inflamed rat dental pulp in vivo.
Methods
The present study was approved by the Ethics Committee of the Affiliated Hospital of Stomatology, Sun Yat-sen University (protocol code: KQEC-2022–32-01) and the Institutional Animal Care and Use Committee of Sun Yat-Sen University (protocol code: SYSU-IACUC-2022–000,691).
Isolation, culture and characterization of human dental pulp stem cells
Healthy impacted third molars were obtained from patients between 16 and 25 years old with informed consent at the Hospital of Stomatology, Sun Yat-sen University. DPSCs were isolated by enzyme digestion according to a previously described method [
26]. The separated cells were cultured in α-minimum essential medium (αMEM; Gibco, USA) supplemented with 10% foetal bovine serum (FBS; Gibco BRL, USA), 100 U/ml penicillin-G (Sigma‒Aldrich, USA) and streptomycin in a humidified atmosphere of 5% CO
2 at 37 °C. The cells started to grow out within 2 weeks. After the cells reached 90% confluence, they were dissociated and regarded as primary cells. Cells at passages 3–5 (P3-5) were used in this study.
Flow cytometry was performed to identify DPSCs. In brief, typical positive and negative surface markers of MSCs, including CD29-FITC, CD105-PE, CD90-PE, CD34-FITC and CD45-PE (BD Bioscience, USA), were evaluated. The isotype served as the negative control. Third-passage DPSCs were suspended at 5 × 105 cells/mL in phosphate-buffered saline (PBS, Sigma‒Aldrich, USA), stained with different antibodies for 30 min at 4 °C, washed with PBS, resuspended in FACS buffer, and analysed using a MOFlo™ high-performance cell sorter (Beckman Coulter, USA). For the multilineage differentiation assay, alizarin red S staining and oil red O staining were used to identify mineralized nodules and lipid droplets after the cells were incubated with differentiation induction medium for 3 weeks.
Conditioned medium preparation
Venous blood (10 mL) was collected from each participant who was a nonsmoker and in good general health after informed consent was obtained. Tubes of blood were processed in a Medifuge centrifuge device (Silfradent Srl, Sofia, Italy) to obtain CGF, following the manufacturer’s instructions: 30 s acceleration, 2 min at 2700 rpm (600 g), 4 min at 2400 rpm (400 g), 4 min at 2700 rpm (600 g), 3 min at 3000 rpm, and 36 s deceleration. After centrifugation, 3 layers were observed in the blood: the upper platelet-poor plasma layer, the middle fibrin-rich gel with aggregated platelets and concentrated growth factors, and the lower red blood cell layer. Then, the isolated CGF membrane was cut into small pieces and placed in a − 80 °C freezer for 1 h. After thawing at 4 °C and centrifugation for 10 min at 230 g, the exudates were harvested and immersed in 5 mL αMEM, which was defined as 100% CGF. Following incubation at 37 °C for 24 h and centrifugation for 5 min at 400 g, the supernatant was frozen at − 80 °C [
27]. The 100% CGF was diluted with αMEM to produce 50% CGF for use in the in vitro study.
As previously reported [
28], iRoot BP Plus (Innovative Bioceramix, Vancouver, Canada) was stored in a 100% humidified atmosphere at 37 °C for 3 days. After solidification, the materials were ground into a powder. Then, 1.0 g powder was dissolved in 50 mL αMEM for 1 day and centrifuged for 5 min at 3000 g. The obtained medium was defined as 100% iRoot BP Plus extract, and 25% iRoot BP Plus extract was obtained by dilution with αMEM. The medium was stored at 4 °C and applied in the following study.
LPS treatment
The hDPSCs were seeded in a 12-well plate (Corning, USA) at a density of 1 × 10
5 cells per well and treated with 0.1, 1 and 10 μg/mL LPS (Escherichia coli 0111:B4, Sigma) for 24 h when the cells grew to 80% confluence. Only culture medium was used as a negative control. Cell Counting Kit-8 (Dojindo, Japan) assays and real-time quantitative polymerase chain reaction (PCR) were performed to analyse cell proliferation and the expression of inflammation-related genes (IL-6, IL-1β and TNF-α). The primer sequences for IL-6, IL-1β, and TNF-α (BGI, Shenzhen, China) are listed in Table
1. After comprehensive analysis of the results, we selected 1 μg/mL LPS for the assays with inflamed hDPSCs.
Table 1
Primers used for real-time quantitative PCR
IL-4 | CCAACTGCTTCCCCCTCTG | TCTGTTACGGTCAACTCGGTG |
IL-6 | ACTCACCTCTTCAGAACGAATTG | CCATCTTTGGAAGGTTCAGGTTG |
IL-10 | GACTTTAAGGGTTACCTGGGTTG | TCACATGCGCCTTGATGTCTG |
IL-1β | ATGATGGCTTATTACAGTGGCAA | GTCGGAGATTCGTAGCTGGA |
TNF-α | CGTGGAGCTGGCCGAGGAG | AGGAAGGAGAAGAGGCTGAGGAAC |
OCN | AGCAAAGGTGCAGCCTTTGT | GCGCCTGGGTCTCTTCACT |
ALP | GTTGACACCTGGAAGAGCTT | GTTCCTGTTCAGCTCGTACTG |
RUNX2 | TGGTTACTGTCATGGCGGGTA | TCTCAGATCGTTGAACCTTGCTA |
GAPDH | GGAGCGAGATCCCTCCAAAAT | GGCTGTTGTCATACTTCTCATGG |
Cell proliferation assay
The hDPSCs were seeded in a 96-well plate (Corning, USA) at a density of 2 × 103 cells per well and treated with or without 1 μg/mL LPS for 24 h. The medium was then changed to 50% CGF, 25% iRoot BP Plus extract or their combination, which was defined as CGF-iRoot BP Plus, and replaced with fresh culture medium every 2 days. The proliferation of hDPSCs on days 1, 4, and 7 was evaluated using the Cell Counting Kit-8 assay. The absorbance at a wavelength of 450 nm was determined.
Cell cycle analysis and apoptosis assay
The hDPSCs were seeded in a 6-well plate (Corning, USA) at a density of 2 × 105 cells per well. The medium was changed to 50% CGF, 25% iRoot BP Plus or CGF-iRoot BP Plus and replaced with fresh culture medium every 2 days. The cell cycle distribution was analysed on day 1, and the populations of apoptotic and nonapoptotic cells were evaluated on days 1, 4, and 7.
For the cell cycle assay, the cells were collected and fixed in 70% ethanol. After washing with PBS, the hDPSCs were dissolved in a hypotonic buffer containing propidium iodide (PI) and collected via flow cytometry. The acquired data were analysed with Cell Quest version 3.1 software (BD Biosciences, USA) according to the manufacturer’s instructions.
For the apoptosis assay, the hDPSCs were suspended in 1 × binding buffer. The suspension was stained with 5 μl of annexin V and PI, gently vortexed and incubated for 15 min at room temperature in the dark. After staining, flow cytometry was performed.
Real-time quantitative polymerase chain reaction
The hDPSCs were treated with 1 μg/mL LPS for 24 h and divided into four groups, in which the medium was changed to 50% CGF (CGF group), 25% iRoot BP Plus extract (BP group), CGF-iRoot BP Plus, or αMEM (normal control group, NC) for 24 h. The gene expression levels of TNF-α, IL-1β, IL-6, IL-4 and IL-10 (BGI, Shenzhen, China) were determined by real-time quantitative PCR using SYBR Green Mix (Thermo Fisher, Waltham, MA, USA). The primer sequences are listed in Table
1.
In addition, LPS-induced inflammatory hDPSCs from the four groups were collected to evaluate osteo/odontogenic differentiation on day 14. The RNA-Quick Purification Kit (Yishan, Baoshan, Shanghai, China) was used to extract total RNA according to the manufacturer’s instructions. cDNA was then synthesized using the PrimeScriptTM RT Reagent Kit (TaKaRa Co., Kyoto, Japan). Real-time quantitative PCR was performed using Fast SYBR Green Master Mix (Thermo Fisher, Waltham, MA, USA) and gene-specific primers. The messenger RNA expression levels of ALP, runt-related transcription factor 2 (RUNX2), and osteocalcin (OCN) were measured and calculated using the “ΔCt” method. GAPDH was chosen as a housekeeping gene, and the relative expression levels of mRNAs were normalized to that of GAPDH. Primer sequences (BGI, Shenzhen, China) are also shown in Table
1.
In vivo study
Preparation of CGF from rats
CGF from rats was used in the in vivo study. Venous blood (10 mL) was collected from the rats and immediately centrifuged in a centrifuge device as described above to prepare CGF. The CGF membrane was then cut into 1 mm2 fragments, soaked in iRoot BP Plus extract for 24 h and defined as CGF-iRoot BP Plus.
Scanning electron microscopy and energy-dispersive X-ray analysis
Both CGF and CGF-iRoot BP Plus were fixed in 2.5% glutaraldehyde solution for 3 h and dehydrated serially with ethanol solutions. The ultrastructure was observed at 6000 × magnification, and the elemental composition was analysed by scanning electron microscopy-energy-dispersive X-ray spectrometry (SEM–EDX) (Gemini 500; ZEISS, Oberkochen, Baden-Württemberg, Germany).
Vital pulp therapy assay
Thirty eight-week-old male S-D rats weighing 180–250 g were purchased from the Laboratory Animal Center of Sun Yat-sen University, and the left and right maxillary first molars were used for experimental pulpitis (total teeth N = 60). The sixty teeth were randomly divided into 5 experimental groups, the LPS group (exposed pulp with LPS treatment, N = 12 from 6 rats), CGF group (LPS-exposed pulp with CGF treatment, N = 12 from 6 rats), BP group (LPS-exposed pulp with iRoot BP Plus extract treatment, N = 12 from 6 rats) and CGF-iRoot BP Plus group (LPS-exposed pulp with CGF-iRoot BP Plus, N = 12 from 6 rats), and the PBS group (exposed pulp with PBS treatment, N = 12 from 6 rats) was used as a control. Each group was divided into 3 subgroups according to 3 different time points (1, 7 and 28 days, N = 4 from 2 rats at each time point).
Rat pulpitis was induced according to a previous study [
29]. After the induction of anaesthesia via intraperitoneal injection of 10% chloral hydrate, the surfaces of the maxillary first molars were disinfected with 5.25% sodium hypochlorite. The pulp of all experimental teeth was mechanically exposed on the occlusal surface using a high-speed handpiece and a round diamond bur (MANI, Japan). Pulp exposure was confirmed with a sterile size 10 K-file and enlarged to a size 30 K-file. Haemostasis was achieved with 5.25% sodium hypochlorite, and 2 μL LPS solution (10 mg/mL) was injected into the pulp. Then, the injured sites were filled with PBS, CGF membrane, iRoot BP Plus extract and CGF-iRoot BP Plus. The site was sealed with light-cured glass ionomer cement (3 M, USA), followed by flowable resin (3 M, USA) restoration.
Histologic evaluation
On days 1, 7 and 28 after vital pulp therapy, the animals were sacrificed. The involved teeth and adjacent alveolar bone were isolated and fixed in 4% paraformaldehyde (Servicebio, Wuhan, China) for 24 h at 4 °C. The samples were demineralized in 10% EDTA for 2–3 months at 37 °C and then embedded in paraffin. Sections with a thickness of 4 μm were prepared in the mesiodistal direction for haematoxylin–eosin (HE) staining. Histologic sections were independently evaluated by 2 examiners in a blinded manner. Inflammation was scored according to the Dentistry-Evaluation of Biocompatibility of Medical Devices Used in Dentistry (ISO-7405–2018). Before grading, the interrater reliability test showed that the intraclass correlation coefficient was higher than 0.75 (P < 0.05), demonstrating good consistency between the two examiners.
Immunohistochemistry
Tissue sections were dewaxed and washed with PBS 3 times. To perform antigen repair, the slides were placed in 0.01 M citrate acid buffer and boiled for 20 min using a microwave oven. After cooling to room temperature, the sections were treated with 3% BSA and 0.3% Triton-100 × in PBS for 1 h. Then, the slides were incubated overnight with an iNOS (1:200, Proteintech, China) or Arg-1 (1:50, Cell Signaling Technology, USA) primary antibody at 4 °C. After washing with PBS, the sections were reacted with species-specific horseradish peroxidase (HRP)-conjugated secondary antibodies (1:10,000, Cell Signaling Technology, USA) for 40 min at room temperature. HRP staining was visualized with the DAB chromogen, and haematoxylin was used to stain nuclei. Images were captured using an Aperio AT2 slide scanner (Leica, Germany).
Statistical analysis
Quantitative data are presented as the means ± standard deviations (SDs). All data were analysed using SPSS Statistics 26.0 for Windows. All the data coincided with a normal distribution, and one-way analysis of variance (ANOVA) was used for statistical analysis. Dunnett’s t test was performed for post hoc contrasts to compare multiple experimental groups and control groups. For all analyses, P < 0.05 was regarded as statistically significant.
Discussion
CGF is the third generation of platelet concentrates, and it contains more growth factors and a harder fibrin structure than previous platelet concentrates [
30,
31], exhibiting superior regenerative capacity and biomaterial potential [
32‐
34]. During dentin/pulp regeneration, various growth factors work synergistically rather than individually [
35]. Thus, the presence of multiple growth factors in CGF may be of greater importance than a single bioactive protein. Several studies have elucidated the potential of CGF as a pulp capping material for VPT [
31,
36,
37]. However, the lack of temporal degradation control and the limitation of inadequate mechanical strength to support coronal restoration further restrict the application of CGF [
38,
39]. In the present study, the ultrastructure of CGF was confirmed as a dense fibrin network with porous structures, which was in good agreement with a previous report [
31].
As a novel calcium silicate–based nanoparticulate bioceramic putty, iRoot BP Plus exhibits excellent sealing properties, comparable or superior biocompatibility, osteoconductive potential [
40‐
42] and significantly less discolouration than the traditional calcium silicate cement MTA [
43]. When CGF was immersed in iRoot BP Plus extract, the ions released from iRoot BP Plus, such as Si and Na, were detected in CGF, indicating that CGF combined with iRoot BP Plus may synergistically act as a biological scaffold in which dental pulp cells can be embedded for functional effects. To further demonstrate the biological effect of the composite material on hDPSCs, 50% CGF and 25% iRoot BP Plus extract were selected for the in vitro study based on our pilot study.
Pulp capping materials directly contact vital pulp tissue, and suitable biological properties are one of the most clinically relevant factors. Previous studies have reported negligible cytotoxicity of CGF and iRoot BP Plus to various cells in vitro [
31,
37,
44]. In the present study, the results further revealed that CGF combined with iRoot BP Plus significantly increased the proportion of cells in S stage and did not induce apoptosis in hDPSCs, suggesting that the combination of these two materials may preserve cell viability and have the potential to promote self-renewal of dental pulp.
The hypothesis that reparative processes occur in the dental pulp only when infection and inflammation are under control is generally accepted [
45]. Thus, it is crucial to control inflammation with pulp capping materials to achieve odontogenic differentiation of hDPSCs and the formation of dentin bridges via VPT [
46]. TNF-α, IL-1β, and IL-6 are well-known proinflammatory cytokines and can be elicited by LPS in hDPSCs [
22,
47]. In the present study, LPS was used to stimulate an inflammatory microenvironment during pulpitis. As expected, LPS treatment significantly increased the levels of TNF-α, IL-1β, and IL-6 mRNA in hDPSCs. However, the expression of these cytokines was decreased, while the expression of the anti-inflammatory factors IL-4 and IL-10 was increased by treatment with CGF, iRoot BP Plus and their combination. Moreover, the above changes in the combination group were significantly different from those in the iRoot BP Plus group, implying that the combination of CGF and iRoot BP Plus may regulate the inflammatory response of injured pulp.
A rat model of experimental pulpitis was established as previously reported [
29] and subjected to direct pulp capping. The inflammatory scores of the rat pulp in the early stage indicated the anti-inflammatory effects of iRoot BP Plus and CGF, which may be partly attributed to the antibacterial activity of both materials [
48,
49]. Furthermore, iRoot BP Plus may have a favourable effect on the crosstalk between MSCs and macrophages and convert DPSCs to an anti-inflammatory and prorepair phenotype [
50]. The IHC results after staining for iNOS and Arg-1 suggested that CGF may be capable of regulating macrophage polarization of hDPSCs to the M2 phenotype, which was similar to a recent report demonstrating that CGF extract promoted THP-1 macrophage polarization towards the M2 phenotype, with upregulated CD163 expression [
33]. Notably, our results also showed that the inflammation score tended to increase in the iRoot BP Plus group in the late stage, suggesting the limited anti-inflammatory effect of the single pulp capping material. In addition, the inflammation score was sustained in the CGF group and continued to decrease in the combination group, which may be due to the slow release of various growth factors in CGF [
51]. Comprehensively, CGF and iRoot BP Plus may have a synergistic anti-inflammatory effect on injured pulp.
Cell proliferation and odonto/osteogenic differentiation of the incorporated cells are critical steps for pulp regeneration and dentin formation. Human dental pulp stem cells isolated from inflamed pulp (I-DPSCs) derived from carious teeth with symptomatic irreversible pulpitis were reported to have stemness and multidifferentiation potential [
52], highlighting the possibility of successful VPT for inflamed pulp. Previous studies have confirmed the ability of CGF and iRoot BP Plus to promote the proliferation and differentiation of various odontogenic cells [
37,
53]. In our study, CGF combined with iRoot BP Plus extract was verified to promote the proliferation of hDPSCs whether under LPS stimulation or not. Although CGF or iRoot BP Plus extract alone was found to promote the proliferation of hDPSCs, the effect of their combination on LPS-stimulated hDPSCs was significantly stronger, implying that these two materials can work synergistically and accelerate the proliferation of hDPSCs under LPS-stimulated conditions.
The odonto/osteogenic differentiation of hDPSCs may be identified by the expression of several genes, including ALP, Runx2, and OCN [
22]. As shown in the present study, LPS treatment suppressed the expression of the odontoblastic-related genes ALP, Runx2, and OCN in hDPSCs, which was consistent with a previous report showing that LPS inhibited the upregulation of RUNX2 and reduced the expression of odontoblast-associated proteins [
54]. Cotreatment with LPS and CGF has been revealed to increase the mRNA expression of Runx2 and OCN compared with LPS treatment alone [
22]. Consistently, the present study demonstrated that the gene expression levels of ALP, Runx2, and OCN were upregulated by CGF and iRoot BP Plus, especially when both materials were combined under LPS stimulation. These results demonstrated that the detrimental effect on the odontogenic differentiation capability of hDPSCs caused by LPS may be rescued by the combination of CGF and iRoot BP Plus. The in vivo study further clarified that a continuous dentin bridge was formed to seal the injury site on the 28th day after the application of CGF combined with iRoot BP Plus. Interestingly, on the 7th day, a small amount of reparative dentin was observed in the iRoot BP Plus group but not in the CGF group or the combination group. On the 28th day, all three experimental groups showed calcification underneath the injury site. We speculated that this may be due to the different mechanisms of odonto/osteogenic differentiation in hDPSCs treated with CGF and iRoot BP Plus. The osteogenic/odontogenic potential of iRoot BP Plus has been attributed to Ca and Si ion release [
55‐
57], and the specific release kinetics of a variety of growth factors from CGF, including PDGF-BB, TGF-β1, BMP-2 and VEGF, may account for the mineralization of hDPSCs. These growth factors were released slowly and reached their maximum on day 14 (VEGF) or day 21 (TGF-β1 and BMP-2) after CGF preparation. TGF-β1 and BMP-2 levels may remain high for up to 28 days [
51].
Overall, we confirmed that compared with CGF or iRoot BP Plus alone, the combination of CGF and iRoot BP Plus can regulate the inflammatory response and facilitate hard tissue formation in inflamed pulp, inducing synergistic effects on pulp cell activity. Further research exploring the response of stem cells in vivo and the mechanisms of this synergistic effect will shed light on the application of this composite material for dental pulp repair.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.