Background
Worldwide mortality due to chronic kidney disease (CKD) has increased markedly over the past 25 years and continues to increase [
1]. CKD has become a serious public-health problem that has caused great suffering and economic burden to people worldwide [
2]. The multifaceted etiology of CKD encompasses various underlying factors, including diabetes, hypertension, inflammation, oxidative stress, and metabolic disorders [
3]. However, efficacious drugs that can slow-down CKD progression are lacking. Studies have shown that the pathologic development of CKD involves progressive glomerulosclerosis, tubular constriction/dilation, death of tubular cells, and interstitial fibrosis. Among them, interstitial fibrosis [
4] is a common pathway for almost all types of CKD to progress to end-stage renal disease. Renal fibrosis is now recognized as a major determinant of renal pathology [
5]. Inflammation is often considered an important initial event in renal fibrosis [
6‐
8]. Various physiologic injuries or inflammatory cytokines can trigger renal fibrosis in the initial stages and eventually cause end-stage renal disease. The sustained inflammatory response induces the release of cytokines and initiates various signaling pathways which, in turn, have a crucial role in enhanced myofibroblast activity and excessive accumulation of the extracellular matrix, and have an important pathologic basis for it [
9]. Experimental studies [
10,
11] have shown that use of specific anti-inflammatory measures in CKD has excellent antifibrotic and nephroprotective effects.
Silent information regulator 3 (SIRT3) belongs to a family of evolutionarily conserved deacetylases that mediate nuclear gene expression, metabolic control, the cell cycle, and cell proliferation [
12,
13]. There is increasing evidence that SIRT3 plays an important part in the development of kidney disease. Increasing the expression and activity of SIRT3 can delay the development of kidney disease. Conversely, deficiency of SIRT3 leads to high levels of oxidative stress, increased chronic inflammation, mitochondrial dysfunction, and defective telomere instability [
14,
15]. These cellular processes are involved in the progression of diseases such as diabetic nephropathy, renal fibrosis, and acute kidney injury, and strongly aggravate the pathologic damage to the kidney.
Diosmin is a glycosylated polyphenolic flavonoid found in
Citrus aurantium (Citrus sinensis) and olive leaves
(Olea europaea) [
16‐
18]. Several clinical studies have demonstrated the anti-inflammatory potential of Diosmin [
19,
20]. Diosmin can inhibite levels of TNF-α, IL-1β, and IL-6 while promoting IL-12 production in patients with chronic venous disease [
19]. In preclinical studies, Diosmin has also shown a range of pharmacological activities including antioxidant, anti-inflammatory and anti-apoptotic [
21]. Diosmin has been shown to attenuate paraquat-induced lung inflammation and fibrosis in mice by increasing glutathione levels and catalase activity and decreasing hydroxyproline levels and malondialdehyde levels [
22]. Gerges et al. [
23] demonstrated that Diosmin ameliorated inflammation, insulin resistance, and fibrosis in a rat model of non-alcoholic steatohepatitis. Furthermore, a preclinical study [
24] showed that Diosmin regulates oxidative stress-mediated renal inflammation and apoptosis via the NF-kB pathway which, in turn, attenuates adriamycin-induced renal injury in rats. However, whether Diosmin provides protection against unilateral ureteral obstruction (UUO)-induced CKD by inhibiting renal inflammation and interstitial fibrosis is not known. We designed in vivo and in vitro experiments to determine the beneficial effects of Diosmin on ameliorating renal fibrosis and the underlying mechanisms involved.
Materials and methods
Reagents
Diosmin (cat no.: HY-N0178) and 3-TYP (HY-108331) were purchased from MedChemExpress (Monmouth Junction, NJ, USA). Human proximal tubular epithelial (HK-2) cells were obtained from American Type Culture Collection (Manaszsas, VA, USA). Fetal bovine serum was sourced from MilliporeSigma (Burlington, MA, USA). Transforming growth factor-β1 (TGF-β1), primary antibodies α-smooth muscle actin (α-SMA), collagen I, NF-κB p65, glyceraldehyde 3-phosphate dehydrogenase (GAPDH)) and secondary rabbit-binding antibodies were purchased from Proteintech (Chicago, IL, USA). Lipofectamine™ 2000 Transfection Reagent (11668019) was from Thermo Fisher Scientific (Waltham, MA, USA). A reverse transcription kit and SYBR™ Green PCR master product was purchased from Vazyme (Nanjing, China).
Animals and experimental procedures
The protocol for animal experimentation was approved (LLSC20210354) by the Animal Care and Use Committee of Anhui Medical University (Hefei, China). The study was conducted in accordance with the Experimental Animal Administration regulations issued by the State Committee of Science and Technology of the People′ s Republic of China. All the procedures for the care of the mice were in accordance with the institutional guidelines for animal use in research. Renal fibrosis was induced by UUO surgery. UUO model is a classic and rapid model to simulate renal fibrosis [
25]. In the UUO model, ligation of the ureter resulted in obstruction of the renal outflow tract on the ligation side, hydronephrosis with tubule dilation, and subsequent immune cell infiltration and fibrosis. Mechanical stretching of tubular epithelial cells leads to cell damage and death, which recruits large numbers of immune cells and causes an inflammatory response. The result is activation and proliferation of myofibroblasts. C57BL/6 mice (8 weeks; 20 ~ 25 g) were housed in SPF (Specific Pathogen Free) grade animal houses on an ad libitum diet at a temperature of 22–24 degrees Celsius and a humidity of approximately 60%. Mice were divided into four groups of five [
22,
26]: sham operation (Sham), UUO, UUO + Dios-1 (Diosmin 50 mg/kg), and UUO + Dios-2 (Diosmin 100 mg/kg).
Diosmin was dissolved in dimethyl sulfoxide (0.5%
v/v) and administered by gavage for 14 days after UUO surgery [
27,
28]. Changes in bodyweight, food intake, and water intake were recorded every week. Mice were sacrificed by intraperitoneal injection of sodium pentobarbital (50 mg/kg). Serum was collected before mice were killed. Levels of alanine transaminase (ALT), aspartate transaminase (AST), alkaline phosphatase (ALP), blood urea nitrogen (BUN), and serum creatinine (Scr) were measured using an automated biochemical analyzer (Roche, Basel, Switzerland). Kidney tissue was fixed with 4% paraformaldehyde, embedded in paraffin, and sectioned to a thickness of 5 mm. Paraffin sections were stained with hematoxylin and eosin (H&E) or Masson's trichrome for morphology studies. Masson trichrome-stained fibrotic areas and positive areas were analyzed using ImageJ 1.47 (US National Institutes of Health, Bethesda, MD, USA).
RNA sequencing analysis
The mRNA of the kidneys was extracted and sent to Gene Denovo Technology Co., Ltd. for mRNA sequencing. Differential gene expression analysis was completed using the R package limma (version 3.44.3). The fold change (FC) of each gene was log2 transformed and further analyzed using the R package clusterProfiler (version 3.16.1). Then, gene set enrichment analysis of canonical pathways was conducted to find differentially regulated pathways.
Cell-viability assay
To assess cell viability, HK-2 cells were cultured at 1 × 104 cells per well in 96-well plates. After treatment with Diosmin for 3 h, they were incubated with 0.5 mg/mL of 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide solution (100 μL/well) for 4 h. After washing with 1 × PBS, dimethyl sulfoxide (150 μL/well) was added to dissolve purple crystals. The absorbance of the sample was measured at 570 nm with a microplate reader (BioTek Instruments, Winooski, USA).
Small interfering RNA (siRNA) transfection
Human SIRT3-specific siRNA was synthesized by QingkeBio (Beijing, China). The target nucleotide sequence of the siRNA was CATCGATGGGCTTGAGAGA. HK-2 cells were added to a six-well plate at 2 × 104 cells/well. After cells had become attached, the medium was changed 1 h before transfection. Then, siRNA (50 nM) was transfected for 24 h using Lipofectamine 2000 (Thermo Fisher Scientific) according to manufacturer instructions.
Elisa
Elisa kits for interleukin (IL)-6 (RX203049M), IL-1β (RX203063M), and tumor necrosis factor (TNF)-α (RX202412M) were obtained from Quanzhou Ruixin Yijian Biotechnology (Quanzhou, China). Levels of IL-1β, IL-6, and TNF-α in kidney and the supernatant of HK-2 cell-culture medium were detected using Elisa kits according to standard protocols, respectively.
Assay to measure the activity of SIRT3
The activity of SIRT3 in mouse kidneys was measured by a SIRT3 enzyme activity detection kit (KL-SIRT3-Hu02, Shanghai, China). The activity of SIRT3 in specimens was measured by the double-antibody sandwich method. Results were obtained from three replicate experiments.
Western blotting
Western blotting was used to measure the protein expression in HK-2 cells or mouse kidney tissue after treatment (Part of the the blots were cut prior to hybridisation with antibodies during blotting). Antibody binding was detected using a western blotting detection kit (Thermo Fisher Scientific). Captured western blotting bands using an ultrasensitive multifunction imager (AI600RGB; General Electric, Boston, MA, USA). Bands were quantified with ImageJ and normalized to GAPDH expression.
Quantitative PCR
Total RNA was extracted from HK-2 cells or mice kidney tissue using TRIzol® Reagent. Complementary-DNA was synthesized by Hiscript Q RT SuperMix and used for a qPCR (+ gDNA wiper) reverse transcriptase kit (Vazyme). Real-time PCR was undertaken on primers, the sequences of which are shown in Table
1. Messenger (m)RNA expression of the corresponding samples was normalized with GAPDH mRNA.
Table 1
Primer sequences used for RT-qPCR
Mus Collagen I | GACGCCATCAAGGTCTACTG | ACGGGAATCCATCGGTCA |
Mus α-SMA | ACTGGGACGACATGGAAAAG | GTTCAGTGGTGCCTCTGTCA |
Mus SIRT3 | CACGTTTACAAACATGAACC | CATGCTAGATTGCCCTAGT |
Mus IL-6 | GAGGATACCACTCCCAACAGACC | AAGTGCATCATCGTTGTTCATACA |
Mus IL-1β | GACCTTCCAGGATGAGGACA | AGCTCATATGGGTCCGACAG |
Mus TNF-α | CGTCGTAGCAAACCACCAAG | TTGAAGAGAACCTGGGAGTAGACA |
Mus GAPDH | ACCCAGAAGACTGTGGATGG | ACACATTGGGGGTAGGAACA |
Hum Collagen I | TGACCTCAAGATGTGCCACT | ACCAGACATGCCTCTTGTCC |
Hum α-SMA | CCCGGGACTAAGACGGGAAT | CCATCACCCCCTGATGTCTG |
Hum SIRT3 | GAGGTTCTTGCTGCATGTGGTTG | AGTTTCCCGCTGCACAAGGTC |
Hum IL-6 | CTGCAGCCACTGGTTCTGT | CCAGAGCTGTGCAGATGAGT |
Hum IL-1β | CGATGCACCTGTACGATCAC | TCTTTCAACACGCAGGACAG |
Hum TNF-α | TGCACTTTGGAGTGATCGGC | ACTCGGGGTTCGAGAAGATG |
Hum GAPDH | TGATGACATCAAGAAGGTGGTGAAG | TCCTTGGAGGCCATGTGGGCCAT |
Statistical analyses
Values are the mean ± SEM. Quantitative data were tested for normality. Two-tailed unpaired t-test and one-way ANOVA were used to compare differences between two groups and multiple groups, respectively. Prism 9.0 (GraphPad, San Diego, CA, USA) was used for statistical analyses. p < 0.05 was designated significant.
Discussion
Anti-inflammatory therapy is an effective strategy for treating fibrosis [
29,
30]. We demonstrated that Diosmin prevented UUO- or TGF-β1-induced renal fibrosis mainly by inhibiting inflammation. Decreased levels of inflammatory cytokines were documented. In particular, SIRT3 was involved in the anti-inflammatory effect of Diosmin-induced renal fibrosis. Diosmin promoted SIRT3 expression, and deletion of SIRT3 abolished the inhibitory effect of Diosmin upon inflammation. Interestingly, SIRT3 was involved in the regulation of nuclear expression of NF-κB p65, and silencing SIRT3 expression increased the nuclear expression of NF-κB p65 in HK-2 cells. Thus, our data clearly demonstrate that anti-inflammatory effects against Diosmin-induced renal fibrosis can be promoted by regulating SIRT3-mediated nuclear NF-κB p65 expression.
Renal fibrosis is considered to be an inflammation-related disease [
31,
32]. Inflammatory cells secrete many inflammatory cytokines and further infiltrate renal tissue, making the kidney in an “inflammatory microenvironment”. Without efficacious treatment, persistent inflammatory stimulation can further aggravate irreversible kidney damage. NF-κB p65 is a key regulator mediating the regulation of inflammation. Phosphorylation and nuclear translocation of p65 are the main modes of activation of the NF-kB pathway. Therefore, p65-nuclear localization sequence is often used to reflect the expression of active p65. Several studies have shown that regulation of nuclear NF-κB p65 expression can control inflammation effectively [
33‐
35]. Studies have reported that Liuweiwuling tablets can alleviate bile-duct ligation-induced liver fibrosis mainly by inhibiting the expression of the inflammatory cytokines IL-1β1, TNF-α, and IL-6 [
36]. The anti-hepatic-fibrosis effect of the novel oridonin analog CYD0618 is accomplished mainly by blockade of the nuclear translocation of NF-κB p65 and preventing the phosphorylation of the NF-κB inhibitory protein IκBα [
37]. Recently, Chen et al. [
37] found that, in a carbon tetrachloride-induced model of liver fibrosis in rats, increased expression of SIRT3 attenuated inflammation and fibrosis by inhibiting NF-κB p65 nuclear translocation. Consistent with the results of other studies, our results indicated that TGF-β1 increased the expression of nuclear NF-κB p65, whereas Diosmin decreased the expression of nuclear NF-κB p65 significantly. Therefore, the anti-inflammatory effect of Diosmin is also dependent upon NF-κB.
SIRT3 is a promising target for treatment of inflammation-related diseases [
38,
39]. Kurundkar et al. [
40] reported that SIRT3 expression was reduced significantly in mouse lungs upon activation of the NLR family pyrin domain during lipopolysaccharide-induced acute lung injury. Activation of SIRT3 with vinferin reduced activation of the NLRP3 inflammasome and production of inflammatory cytokines, and attenuated lung-tissue damage. However, the protection mentioned above was abolished in SIRT3-knockout mice [
40]. Zhang et al. [
41] demonstrated that melatonin could exhibit anti-inflammatory, anti-oxidative stress, and anti-apoptotic renoprotective effects via activation of SIRT3 in models of acute renal failure in vivo and in vitro. Wu et al. [
42] showed that Rhein has antioxidant capacity and anti-fibrosis effects in a model of chronic kidney disease because it can activate the SIRT3/Fxo3α signaling pathway. Palomer et al. [
43] found that SIRT3-knockout mice developed myocardial inflammation and fibrosis. In contrast, SIRT3 overexpression in the cardiomyocytes of neonatal rats prevented (at least in part) TNF-α-induced inflammatory responses and attenuated fibrotic responses. We found that UUO or TGF-β1 decreased the activity and expression of SIRT3 significantly, while increasing the secretion of inflammatory cytokines and the expression of NF-κB p65 in activated hematopoietic stem cells. In addition, SIRT3 overexpression reduced the expression of NF-κB p65, suggesting that SIRT3 mediates the regulation of TGF-β1-induced inflammation mainly by regulating the expression of NF-κB p65 during renal fibrosis, data which are consistent with the results of other reports [
44,
45]. Therefore, our data suggest that SIRT3 may be a potential therapeutic target of inflammation-related diseases such as renal fibrosis. In the absence of TGF-β1 stimulation, 3-TYP alone or SIRT3 siRNA alone did not have a significant effect on the secretion of inflammatory cytokines, but they significantly promoted secretion of inflammatory cytokines. This phenomenon may be due to TGF-β1 stimulation leading to the formation of some pathologic microenvironments characterized by excessive secretion of inflammatory cytokines, whereas SIRT3 siRNA or 3-TYP exerted their effects only in such pathologic microenvironments. SIRT3 siRNA or 3-TYP enhanced TGF-β1-induced secretion of inflammatory cytokines.
As a flavonoid compound, Diosmin has anti-inflammatory, anti-oxidative stress, anti-fibrotic, and other effects [
21‐
23]. Tahir et al. [
46] found that Diosmin could protect against ethanol-induced liver injury by attenuating the inflammatory response and regulating activation of TNF-α and NF-κB. Yang et al. created a mouse model of renal ischemia by non-traumatic microvascular clipping of the left renal pedicle combined with resection of the right renal pedicle. After perfusion, Diosmin treatment inhibited nuclear NF-κB and mitochondrial apoptotic pathways and activated the Nrf2/HO-1 pathway to protect the kidneys [
47]. Fattori et al. [
48] applied Diosmin to block NF-κB activation in the treatment of lipopolysaccharide-induced inflammatory pain and peritonitis in mice. We found that Diosmin can suppress the level of inflammation and inhibit the progression of renal fibrosis by upregulating the expression of SIRT3.
Diosmin may increase SIRT3 expression and activity through multiple pathways. However, exactly how Diosmin regulates SIRT3 is not known. Our research team will further explore the potential mechanisms. Furthermore, to investigate further the role of SIRT3 in Diosmin-induced anti-fibrotic effects, we will use SIRT3-knockout mice in future studies. The Smad protein [
49,
50] has been studied widely as a transcription factor and key intracellular effector of TGF-β1. Smad4 and Smad3 are pro-fibrotic, whereas Smad2 and Smad7 protect against fibrosis [
51,
52]. As a key mediator in the pathogenesis of renal fibrosis, TGF-β1 can activate Smad-dependent and non-dependent pathways to express its biological activity. Therefore, we will explore the function of TGF-β1/Smad signaling in Diosmin-induced renal fibrosis in future studies.
However, it is important to acknowledge certain limitations in our study. First, our research primarily focused on preclinical models, and the transition to clinical studies in human subjects is warranted to confirm the safety and efficacy of Diosmin in a real-world setting. Second, while our investigation provides insights into the mechanism of action of Diosmin, additional in-depth studies are needed to elucidate the complete signaling pathways involved. Furthermore, a more comprehensive assessment of the potential adverse effects and side effects of Diosmin should be undertaken as part of future research, considering its translational potential.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.