Skip to main content
Erschienen in: BMC Women's Health 1/2021

Open Access 01.12.2021 | Research

Expression levels of MCP-1, HGF, and IGF-1 in endometriotic patients compared with non-endometriotic controls

verfasst von: Sahel Heidari, Roya Kolahdouz-Mohammadi, Sepideh Khodaverdi, Nader Tajik, Ali-Akbar Delbandi

Erschienen in: BMC Women's Health | Ausgabe 1/2021

Abstract

Background

To study the concentrations of monocyte chemoattractant protein-1 (MCP-1), hepatocyte growth factor (HGF), and insulin-like growth factor-1 (IGF-1) in peritoneal fluid (PF) and serum, and to evaluate their expressions by PF and peripheral blood mononuclear cells (PFMCs and PBMCs, respectively), and ectopic and eutopic endometrial stromal cells of patients with endometriosis (EESCs and EuESCs, respectively) compared with controls.

Methods

The concentrations of mentioned cytokines in serum and PF, as well as their expression in PBMCs, PFMCs, EuESCs and EESCs from endometriosis patients and controls were assessed.

Results

The levels of MCP-1, HGF, and IGF-1 in serum and PF in women with endometriosis were significantly higher than the controls (P < 0.05–P < 0.001). Gene expression of MCP-1 and IGF-1 in the PFMCs, PBMCs and EESCs also showed an increased level compared to controls (P < 0.05–P < 0.01). The protein expression of MCP-1 and IGF-1 by PFMCs was statistically higher in endometriotic women (P < 0.05 and P < 0.01, respectively). The gene and protein expression of HGF in PFMCs and its gene expression by EESCs were significantly higher in endometriotic women compared to controls (P < 0.05–P < 0.01).

Conclusions

The higher concentrations of mentioned cytokines in serum and PF and their higher expression by PFMCs and EESCs in endometriosis patients may contribute to the development of endometriosis.
Hinweise

Supplementary Information

The online version contains supplementary material available at https://​doi.​org/​10.​1186/​s12905-021-01560-6.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Abkürzungen
BMDSCs
Bone marrow-derived stem cells
BMI
Body mass index
cDNA
Complementary DNA
CESCs
Control endometrial stromal cells
DIE
Deep infiltrating endometriosis
DMEM-F12
Dulbecco's modified Eagle's medium‐F12
EESCs
Ectopic endometrial stromal cells
ELISA
Enzyme-linked immunosorbent assay
ESCs
Endometrial stromal cells
EuESCs
Eutopic endometrial stromal cells
FBS
Fetal bovine serum
GAPDH
Glyceraldehyde-3-phosphate dehydrogenase
HGF
Hepatocyte growth factor
IGFBP
IGF-1 binding protein
IGF-1
Insulin-like growth factor-1
iNKT
Invariant natural killer T cells
LPS
Lipopolysaccharides
MCP-1
Monocyte chemoattractant protein-1
NF-kb
Nuclear factor kappa B
NK
Natural killer
PBMCs
Peripheral blood mononuclear cells
PF
Peritoneal fluid
PFMCs
Peritoneal fluid mononuclear cells
RPMI
Roswell Park Memorial Institute medium

Background

The presence of endometrial glands and stroma outside its normal site, the uterine cavity, is defined as endometriosis. Endometriosis is a common benign inflammatory disease that causes various symptoms such as chronic pelvic pain, dysmenorrhea, dyspareunia, and infertility [1]. The prevalence of endometriosis appears to have a range between 10 and 15% in the general population [2].
Recent studies have proven that endometriosis has a multifactorial etiology, with possible (epi)genetic, hormonal, and immunological factors as causes [3, 4]. Besides, based on a recent study, the loss of the integrity of the gastrointestinal barrier might contribute to the pathogenesis of endometriosis through an increase in lipopolysaccharides (LPS) concentration [5]. Many genes possibly implicated in different physiopathological molecular mechanisms of endometriosis like steroidogenesis, inflammation and immune response, tissue remodeling and neoangiogenesis, metabolism regulation and DNA reparation [3, 4].
Nevertheless, the most accepted theory for the etiology of endometriosis is Sampson's theory, which suggests endometriosis develops as a result of retrograde menstruation through the fallopian tubes [6]. However, retrograde menstruation occurs physiologically in almost 90% of healthy women, but less than one-fourth of them develop endometriosis. Studies have shown that immunological changes play a significant role in the pathogenesis of endometriosis, leading to incomplete elimination of endometrial cells and the increased ability of endometrial lesions to be created and implant in the peritoneal cavity [7]. However, the exact mechanism of endometriosis is unknown. Several changes in the number and function of various immunological components increase the volume of the peritoneal fluid (PF) in endometriotic patients. Evidence to date indicates mononuclear cells, especially macrophages, which constitute about 85% of the cells in PF, are more likely to cause inflammation and develop the disease rather than control it [8]. In addition to mononuclear cells, endometriosis may cause notable changes in the expression of different genes and proteins by eutopic endometrial stromal cells (EuESCs) and ectopic endometrial stromal cells (EESCs) [9]. Mononuclear cells, as well as EuESCs and EESCs, release cytokines and growth factors that can affect themselves and other cells, such as macrophages. These factors can promote proliferation, angiogenesis, and invasion of endometrial cells, the underlying fundamental mechanisms of the pathogenesis of endometriosis [10]. One of these factors is monocyte chemoattractant protein-1 (MCP-1). This chemokine activates and recruits macrophages and other mononuclear cells to secrete growth factors and cytokines. It also causes the proliferation and maintenance of endometrial cells in ectopic sites, and so, it may be involved in the pathogenesis of endometriosis [11].
Studies in women with endometriosis showed that hepatocyte growth factor (HGF) could also affect monocytes and macrophages and enhance inflammation. In addition to its growth-regulating properties, HGF has diverse impacts on epithelial and endothelial cells, such as proliferation, migration, extracellular matrix production, and tubulogenesis [12, 13]. Another mitogenic factor that is secreted by macrophages and other mononuclear cells is insulin-like growth factor-1 (IGF-1). Based on recent studies, EESCs can express the IGF-1 receptor immunohistochemically [14].
HGF and IGF-1 have several physiological and pathological effects that could contribute to the survival, proliferation, and invasion of endometrial stromal cells (ESCs) associated with endometriosis.
Increased concentrations of MCP-1, HGF, and IGF-1 have been reported in the PF and serum of endometriotic patients compared to controls in some studies [1520]. In contrast, other studies failed to show significant differences in the concentrations of these factors between women with and without endometriosis [2123].
The source of production of these factors is one of the controversial subjects in endometriosis; whether those originating from endometriotic lesions or are secreted by inflammatory mononuclear cells is unknown. These unclear data on MCP-1, HGF, and IGF-1 expression, hinder the understanding of the physiologic role of signaling in women with endometriosis, and no comprehensive study has examined all of the involved cells in endometriosis concurrently. In this study, we compared the concentrations of MCP-1, HGF, and IGF-1 in serum and PF of patients with and without endometriosis. Furthermore, we evaluated the expression of MCP-1, HGF, and IGF-1 by peritoneal fluid mononuclear cells (PFMCs), peripheral blood mononuclear cells (PBMCs), and ESCs in women with endometriosis compared to controls.

Material and methods

Participants

In the first step, 140 reproductive-aged women (24–40 years) took part in this study: 70 women with endometriosis (any stages of I–IV) and 70 patients with other benign gynecological disorders and without any evidence of endometriotic lesions in laparoscopy as a control. The diagnosis of endometriosis was made by laparoscopy and pathology reports, and the stage of disease was determined according to the revised American Fertility Society system [24].
Next, blood samples were taken from the participants, and their serum was stored at − 70 °C until protein expression. The demographic information of participants whose serum samples were collected is displayed in Table 1. In the second step, among mentioned participants, 36 women with stage III and IV endometriosis and 30 patients with benign gynecological disorders and no evidence of endometriotic lesions in laparoscopy were selected for collecting of PF, peripheral blood (to isolate mononuclear cells), and ectopic and eutopic endometrial tissues. The demographic information of participants whose PF samples were collected is displayed in Table 2. Besides, the demographic information of participants whose PFMCs, PBMCs, and ESCs were collected is displayed in Additional file 1: Table S1 and Table S2, respectively. Since some participants were virgins, the eutopic endometrial tissues were not collected from them.
Table 1
Demographic information of participants whose serum samples were collected
Characteristic
Endometriosis (n = 70)
Control (n = 70)
Pvalue
Age (years)
32.7 ± 5.33
32.1 ± 6.98
0.569
BMI (kg/m2)
24.3 ± 3.7
25.7 ± 5.45
0.069
Marital status, n (%)
 Single
18 (25.71)
17 (24.28)
0.845
 Married
52 (74.28)
53 (75.71)
 
Infertility among married, n (%)
18 (34.61)
12 (22.64)
0.174
Cycle phase, n (%)
 Secretory
29 (41.43)
32 (45.71)
0.609
 Proliferative
41 (58.57)
38 (54.28)
 
Stage, n (%)
 I & II
22 (31.42)
  
 III & IV
48 (68.57)
  
Endometriosis type, n (%)
 Ovarian endometriosis (pure)
3 (4.29)
  
 Peritoneal endometriosis (pure)
8 (11.43)
  
 Tubo-ovarian & peritoneal endometriosis (including DIE)
59 (84.28)
  
Data are mean ± SD
Comparison was performed with Student’s t-test, or χ2- test, as appropriate
Abbreviations: BMI: Body mass index; DIE: Deep infiltrating endometriosis; n: Number
Table 2
Demographic information of participants whose peritoneal fluid samples were collected
Characteristic
Endometriosis (n = 36)
Control (n = 30)
Pvalue
Age (years)
32.8 ± 5.64
33.4 ± 5.69
0.656
BMI (kg/m2)
24.3 ± 3.46
25.2 ± 4.22
0.371
Marital status, n (%)
 
 Single
10 (27.78)
2 (6.67)
0.027
 Married
26 (72.22)
28 (93.33)
 
Infertility among married, n (%)
7 (26.92)
4 (14.28)
0.249
Cycle phase, n (%)
 
 Secretory
0 (0)
9 (30)
 < 0.001
 Proliferative
36 (100)
21 (70)
 
Stage, n (%)
 
 I & II
0 (0)
  
 III & IV
36 (100)
  
Endometriosis type, n (%)
 
 Tubo-ovarian & peritoneal endometriosis (including DIE)
36 (100)
  
Data are mean ± SD
Comparison was performed with Student’s t-test, or χ2- test, as appropriate
Abbreviations: BMI: Body mass index; DIE: Deep infiltrating endometriosis; n: Number
All subjects had a regular menstrual cycle, and patients with a history of malignancy, any acute or chronic diseases (especially autoimmune diseases), and using immunosuppressive drugs, hormones, or GnRH agonists for at least three months before sampling were excluded. We missed some samples due to gross bloody PF, culture contamination, not obtained the desired cells, or inconsistent pathology reports.
The study protocol was approved by the Ethics Committee of Medical Research of Iran University of Medical Sciences (Code: IR.IUMS.REC 1394.26098) and all methods were performed in accordance with the relevant guidelines and regulations. All subjects had written informed consent for participation in the study. The study was conducted regarding the privacy rights of all participants.

Sample collection

Under sterile conditions, peritoneal ectopic endometrial patches were obtained through laparoscopic surgery, and eutopic endometrium samples were collected by uterine biopsy curettage. Endometrial tissues were placed in Dulbecco's modified Eagle's medium‐F12 (DMEM-F12) (Gibco, UK) culture medium containing 1% penicillin–streptomycin antibiotics (Gibco, Thermo Fisher Scientific, Waltham, MA, USA). Blood and PF samples were collected into EDTA-coated falcons. All samples were immediately transferred to a laboratory for analysis in the cold chain. To confirm endometriosis, parts of ectopic endometrial tissues were sent for pathologic evaluation.

Mononuclear cell culture

PFMCs and PBMCs were isolated by density gradient centrifugation using Ficoll-Hypaque (Sigma-Aldrich, St. Louis, MO, USA). About 1 × 106 cells/mL PFMCs or PBMCs were cultured in Roswell Park Memorial Institute medium (RPMI-1640) (Gibco, UK) supplemented with 10% fetal bovine serum (FBS) (Gibco, UK) and 1% penicillin–streptomycin antibiotic (Gibco, Thermo Fisher Scientific, Waltham, MA, USA).

ESC culture

Endometrial tissues obtained from participants in both groups (endometriotic and non-endometriotic patients) were cut up into smaller pieces in dimension. Then tissue digestion was performed using collagenase-A (2 mg/mL) and DNase (300 µg/mL) (Roche, USA) for 120 min at 37 °C in 5% CO2 atmosphere with intermittent vortexing every 15 min. In an attempt to remove clots and undigested tissues, the suspension was filtered through a 100 µm mesh (BD Biosciences, San Jose, CA, USA). Then, cells were cultured in T25 culture flasks containing DMEM-F12 (Gibco, UK) supplemented with 10% FBS (Gibco, UK) plus 1% penicillin–streptomycin antibiotic (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) for 6 h. Next, to remove non-adherent cells, they were washed twice with a warm medium, and adherent stromal cells were allowed to propagate. The cells in passage three were used for flow cytometry, immunofluorescence, RNA extraction, and enzyme-linked immunosorbent assay (ELISA). Also, 3 × 105 cells/mL were cultured in a 24-well plate according to our previous study [25].
Flow cytometry and immunofluorescence were used to investigate the purity of the ESCs, and these cells were identified as vimentin+, nestin+ cytokeratin, CD10+, CD44+, CD73+, CD105+, CD34, and CD45 (data not shown) [25].

Total RNA extraction, complementary DNA (cDNA) synthesis, and quantitative real-time PCR reaction

RNA extraction was performed by QIAzol solution (Qiagen, Hilden, Germany) following the manufacturer's instructions. The Picodrop apparatus (Picopetol, Cambridge, UK) was applied to measure the concentration of total RNA at 260/280 nm. RNA integrity was confirmed by electrophoresis on 1% agarose gel. For cDNA synthesis, 1 μg RNA was used, and the cDNA was synthesized according to the Revert Aid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA) protocol.
Real-time PCR was performed using the Syber premix Extaq (Biofact, Daejeon, Korea) and Rotor-Gene Q (QIAGEN, USA). Each reaction was made up of 10 μL of Syber premix (Biofact, Daejeon, Korea), 1 μL of primer pairs, 1 μL of synthesized cDNA, and 8 µL of DNase-free water with a final volume of 20 μL. The concentration of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primer was equal to the amount of the same primer for each reaction. Each PCR reaction was as follows: 95 °C for 15 min (holding step), 40 cycles of 95 °C for 20 s and 60 °C for 40 s (extension step), and finally, the melting step from 60 °C to 99 °C. To verify the real-time PCR results, melting curve analysis, and electrophoresis on 2% agarose gel were used. To increase the accuracy of real-time PCR, all analyses were performed in duplicate, and positive and negative controls were tested every time. The GAPDH gene was used as an internal control. The sequence of primers for GAPDH, MCP-1, HGF, and IGF-1 genes are shown in Table 3.
Table 3
The MCP-1, HGF, IGF-1, and GAPDH primers sequences
Gene
Forward primer
Reverse primer
Amplicon size (bp)
MCP-1
5′- GAAAGTCTCTGCCGCCCTT -3′
5′- TTGATTGCATCTGGCTGAGCG -3′
84
HGF
5′- GCAATTAAAACATGCGCTGACA -3′
5′- TCCCAACGCTGACATGGAAT -3′
140
IGF-1
5′- CTCTTCAGTTCGTGTGTGGAGAC -3′
5′- CAGCCTCCTTAGATCACAGCTC -3′
134
GAPDH
5′-GCACCGTCAAGGCTGAGAAC-3′
5′-TGGTGAAGACGCCAGTGGA-3′
138
Abbreviations: bp: Base pair; GAPDH: Glyceraldehyde 3-phosphate dehydrogenase; HGF: Hepatocyte growth factor; IGF-1: Insulin-like growth factor-1; MCP-1: Monocyte chemoattractant protein-1

ELISA procedure

The method used to measure the concentrations of MCP-1, HGF, and IGF-1 in PFMCs, PBMCs, and ESCs supernatant, as well as in serum and PF was sandwich ELISA (R&D Systems, Minneapolis, MN). The detection limit for MCP-1, HGF and IGF-1 were 15.6 pg/mL, 125 pg/mL, and 31.2 pg/mL, respectively. Each sample was analyzed in duplicate. The absorbance was measured at 570 nm using a microplate reader (Bio‐Rad, Hercules, CA, USA).

Statistical analysis

All statistical analyses were conducted using GraphPad Prism software 8. The normality of distributions was evaluated by the Kolmogorov–Smirnov test. The independent t-test and Mann–Whitney U test were employed to compare two independent groups based on the normality distribution assumption and the chi-square test was used to assess categorical variables. For the comparison of three groups, Kruskal–Wallis test with Dunn post hoc analysis was used.
After normalization to GAPDH control, the quantitative analysis of mRNA expression was performed using the 2−ΔΔCt method. P value < 0.05 was considered statistically significant.

Results

In this study, serum concentrations of MCP-1, HGF, and IGF-1 were measured in 70 endometriotic and 70 non-endometriotic participants. Demographic data of the participants whose serum samples were collected are presented in Table 1. Based on our findings, no significant differences were observed between groups regarding age, body mass index (BMI), marital status, infertility, and menstrual phase. Besides, most patients who underwent surgery had stages III & IV of disease with deep infiltrative endometriosis, cul-de-sac obliteration, ovarian endometriosis, and dense adhesions. Superficial ovarian and peritoneal endometriosis or firm adhesions were observed in approximately 31 percent of patients who were in stages I & II. Regarding demographic information of participants whose PF, PFMC, PBMC, and ESCs were collected, no significant differences were observed between groups with concerning age, BMI, and infertility. All endometriotic patients were at the proliferative phase of the menstrual cycle and were at stage III & IV of endometriosis and had tubo-ovarian and peritoneal endometriosis (including deep infiltrating endometriosis (DIE)). The basal gene and protein expression of mentioned factors were measured in PFMCs (n = 10), PBMCs (n = 10), EESCs (n = 8), and EuESCs (n = 10) from endometriotic patients and PFMCs (n = 7), PBMCs (n = 10), and control endometrial stromal cells (CESCs) (n = 10) from non-endometriotic women. The relative expressions of MCP-1, HGF, and IGF-1 were measured by quantitative real-time PCR, and the protein levels of these factors were evaluated by ELISA in PFMCs, PBMCs, and ESCs samples.

Serum and PF concentrations of MCP-1 and its gene and protein expression by PFMCs, PBMCs, and ESCs

The levels of MCP-1 in serum and PF were significantly higher in women with endometriosis than in controls (P < 0.001 and P < 0.05, respectively) (Figs. 1Aa and Ab). Also, the levels of MCP-1 in the serum were more remarkable in women with late-stages (III & IV) endometriosis than those with the early-stages (I and II) (P < 0.05) (Fig. 1Ac). Although, according to the menstrual phase, no significant difference in serum MCP-1 concentrations was noted in the endometriosis and control groups (Fig. 1Ad).
We further examined the gene and protein expressions of MCP-1 by PFMCs, PBMCs, and ESCs. There was a significantly higher MCP-1 expression at the level of mRNA and protein by PFMCs in women with endometriosis compared with non-endometriotic women (P < 0.05) (Figs. 1Ba and Bb). The increment in the mRNA expression of MCP-1 in PBMCs in the patient group was significant, as well (P < 0.05) (Fig. 1Bc), while MCP-1 protein expression in PBMCs had no significant difference between women with and without endometriosis (Fig. 1Bd). EESCs showed increased gene expression of MCP-1 compared to EuESCs and CESCs (P < 0.01) (Fig. 1Be), whereas MCP-1 protein expression was not different between EuESCs and CESCs (Fig. 1Bf).

Serum and PF concentrations of HGF and its gene and protein expression by PFMCs, PBMCs, and ESCs

The results showed that the level of HGF was significantly higher in the serum and PF in women with endometriosis than in controls (P < 0.001 and P < 0.05, respectively) (Figs. 2Aa and Ab). Additionally, there was a significantly higher difference in the serum concentration of HGF in women at the stages III-IV of endometriosis compared to the patients with the stages I-II of the disease (P < 0.01) (Fig. 2Ac). No difference between the follicular or luteal phases in terms of serum levels of HGF was detected in the patient and control groups (Fig. 2Ad).
The expression of HGF gene and protein by PFMCs was significantly higher in the patient's group compared to the controls (P < 0.05 and P < 0.01, respectively) (Figs. 2Ba and Bb). However, there was no notable difference in their expression by PBMCs in both groups (Figs. 2Bc and Bd). HGF gene expression was significantly higher in EESCs compared with the EuESCs and CESCs (P < 0.05) (Fig. 2Be). However, we did not find any difference in the HGF protein expression between EuESCs and CESCs (Fig. 2Bf).

Serum and PF concentrations of IGF-1 and its gene and protein expression by PFMCs, PBMCs, and ESCs

Results obtained showed that the IGF-1 level in serum and PF in women with endometriosis was higher than in women without endometriosis (P < 0.05) (Figs. 3Aa and Ab). An increase in the serum levels of IGF-1 in women with stages III-IV endometriosis was observed compared to women with stages I-II endometriosis, but it was not statistically significant (Fig. 3Ac). Also, no obvious difference was detected among the IGF-1 serum concentrations in the different phases of the menstrual cycle of women with endometriosis and controls (Fig. 3Ad).
It is demonstrated that a substantial amount of IGF-1 was also produced by PFMCs at the level of mRNA and protein in women with endometriosis (P < 0.05 and P < 0.01, respectively) (Figs. 3Ba and Bb). IGF-1 gene expression by PBMCs in endometriosis patients was significantly higher than in women without endometriosis (P < 0.05) (Fig. 3Bc). However, there was no difference in the secretion of IGF-1 by PBMCs in the two groups (Fig. 3Bd). The IGF-1 gene expression by EuESCs and CESCs was significantly lower than EESCs (P < 0.05 and P < 0.01, respectively) (Fig. 3Be). But, the levels of IGF-1 protein expression did not significantly differ between the EuESCs and CESCs (Fig. 3Bf).

Discussion

Endometriosis is a complex disease with systemic and topical immune system defects. Sampson’s theory of retrograde menstruation is well accepted theory for intraperitoneal and ovarian endometriosis [6]. However, it cannot account for the less common locations of endometriosis, like remote areas. Remote endometriosis is likely caused by bone marrow-derived stem cells (BMDSCs) [26] and epigenetics play a major role in modulating the key factors involved in BMDSCs recruitment and differentiation [27]. Besides, microbiome may be involved in the pathogenesis of endometriosis as increased Proteobacteria, Bacteroidetes, and Negativicutes levels were shown in a recent systematic review [28]. On the other hand, macrophages are involved in tissue remodeling during the development of endometriosis. Lagana et al. for the first time showed a progressive decrease in M1 macrophages from stage I to stage IV; in contrast, M2 macrophages showed a progressive increase from stage I to stage IV. These findings may contribute to pro-inflammatory microenvironment typical of the early stages of the disease and pro-fibrotic nature of the advanced stages of endometriosis [29]. Besides, invariant natural killer T cells (iNKT) which are capable of secreting Th1 and Th2 cytokine patterns, may be involved in the pathogenesis of endometriosis [30]. Many studies have noted that changes in chemokines and immune receptors result in the development and progression of this disease in features such as increased proliferation, angiogenesis, invasion, and decreased apoptosis of ectopic cells [7]. Some essential chemokines are MCP-1, HGF, and IGF-1, which play a crucial role in the proliferation and invasion of ESCs.
In the current study, the serum and peritoneal levels of MCP-1 were higher in women with endometriosis than in control subjects, and the severity of the disease, unlike the menstrual cycle, was directly related to the concentration of this factor. These results are consistent with the findings of some previous studies [15, 16, 31, 32], although there are studies that have shown no difference between the two groups of patients and controls [3335]. However, Margari et al. reported remarkably lower concentrations of MCP-1 in the PF of patients with endometriosis [36]. The findings of this study showed that MCP-1 gene and protein expression in PFMCs increased more markedly in patients with endometriosis compared to controls. Also, MCP-1 gene expression was substantially higher in EESCs and PBMCs of women with endometriosis compared to EuESCs, CESCs, and PBMCs of control groups. These results are in line with other studies which showed that endometrial epithelial cells of women with endometriosis express high levels of MCP-1 [37, 38], and EESCs expressed more MCP-1 than EuESCs and CESCs [39].
MCP-1 is one of the critical factors that have the potent ability not only in the infiltration of monocytes into the inflammatory site and their differentiation, but also in stimulating macrophages to secrete chemokines and cytokines. So, increased macrophage activation and recruitment into the peritoneal cavity of patients with endometriosis are considered to progress chronic inflammation and inflammatory cytokines production [40]. Increased MCP-1 secretion has been demonstrated by PF macrophages in patients with endometriosis compared with controls that affect monocytes and macrophages via autocrine manner [41]. In addition to macrophages, MCP-1 is secreted by endometrial, peritoneal mesothelium, mononuclear cells, endothelial cells, and fibroblasts. It can lead to the infiltration of monocytes, macrophages, eosinophils, natural killer (NK), and T cells and may contribute to the shift to TH2 response [40, 42]. MCP-1 directly contributes to the proliferation and survival of cancer cells [43], and the similarity of endometriosis with malignant diseases has been noted in features such as increased proliferation, angiogenesis, invasion, and decreased apoptosis of ectopic cells [44]. So, we suggest that MCP-1 may be involved in proliferation, survival, and invasion of EESCs, and it can increase the expression of CCR2 and MCP-1 and result in a defective cycle and more activation and recruitment of peritoneal macrophages in PF via autocrine and paracrine mechanisms.
HGF is a multi-functional and essential growth factor that, by binding to its receptor (c-Met), results in various effects, several of which are potentially related to growth and proliferation, invasion, and metastasis in cancer cells [18, 45]. We observed higher concentrations of HGF in serum and PF of patients with endometriosis compared to controls, and its concentrations were higher at the late stages of endometriosis. No difference was noted regarding HGF serum levels with the menstrual cycle. Many studies have indicated increased HGF levels in PF and serum of endometriotic patients and evidenced that this elevation was significant in the late stages of the disease [15, 18, 20, 46]. Besides, no significant difference was observed in HGF serum concentrations in endometriotic women in the follicular or luteal phases in those studies. In contrast, in one study, no significant difference was observed between the two groups of patients and controls [21]. In one study, it has been illustrated that the expression of c-Met is related to the different stages of endometriosis [47].
Our current study showed that PFMCs in women with endometriosis could produce HGF considerably more than controls, and EESCs expressed substantially high levels of HGF than EuESCs and CESCs.
So far, few studies have been conducted regarding the production of HGF by PFMCs and PBMCs in patients with endometriosis, and some available studies have demonstrated the release of HGF by ESCs of endometriosis patients. Sugawara et al. showed increased HGF secretion by EuESCs in women with endometriosis compared with controls [48]. However, in this research, EESCs were not studied. Nasu et al. investigated HGF secretion in endometrial cell culture media and showed that HGF secretion was probably via the protein kinase C pathway [49]. According to other studies, it was revealed that HGF expression and c-Met in eutopic endometrium in patients with endometriosis increased compared to controls [50]. In line with our results, other studies have shown a significant increase in the gene expression of HGF in EESCs compared to EuESCs and CESCs [25, 51].
HGF plays a significant physiological role in the proliferation of various cell types. Other studies have also proven that the proliferation of ESCs and macrophages in patients with endometriosis in response to HGF in the culture medium had a more significant increase than the control group. The enhanced capacity of ESCs and macrophages proliferation may reflect more co-expression between HGF and its receptor in the cells of endometriosis patients [52]. The relationship between high expression of fibroblast activation protein and HGF with angiogenesis and metastasis in gastric cancer has been reported [53]. HGF also plays a crucial role in the development and progression of many tumor cells. Noguchi and colleagues showed that binding HGF to its receptor increased angiogenesis in tumor cells, which ultimately leads to increased cell proliferation, migration, and invasion of gastric cancer cells [54].
Regarding the malignancy-like nature of endometriosis and the high concentration of HGF in the PF of patients with endometriosis, it is reasonable to speculate that HGF can play a role in the pathogenesis and progression of the endometriosis. Consequently, increasing HGF secretion by PFMCs and EESCs leads to increased inflammation in the region, proliferation, and invasion of ESCs.
IGF-1 is another important factor involved in the growth and proliferation of ESCs, which, along with increased estrogen receptor B and aromatase expression, lead to the progression of endometriosis [55]. This study also showed increased IGF-1 concentration in serum and PF of patients with endometriosis, but no correlation was found regarding the stage of disease or the phase of the menstrual cycle with serum levels of IGF-1. Previous studies consistent with ours showed increased concentrations of IGF-1 in serum and PF in patients with endometriosis compared with controls [17, 56]. Although, some studies reported no significant difference in IGF-1 levels in the serum of women with endometriosis compared to control subjects [23, 57]. According to our literature review, no studies have ever been done on the production of IGF-1 by PFMCs and PBMCs in patients with endometriosis. One study revealed an increased IGF-1 gene and protein expression in EESCs of patients with endometriosis [25]. Rutanen et al. showed that ESCs produced IGF-1 and IGF-1 binding protein (IGFBP), and that was associated with levels of sex hormones and the menstrual cycle [58].
Milingos and colleagues examined IGF-I isoforms in ESCs and showed that the CESCs expressed lower IGF-1 compared to EuESCs and EESCs [59].
We demonstrated that the probable source of IGF-1 is PFMCs and EESCs in women with endometriosis resulted in increased levels of this factor in PF and the uncontrolled growth of EESCs.
It has been reported that the peritoneal IGF-1 level is about 60% of its serum level. Studies have shown that IGF-1 affects on ESCs in the culture, and it is an influential factor in the growth and proliferation of ectopic endometrium. Therefore, IGF-1 might be one of the most critical factors in women with endometriosis [60].
So increased IGF-1 levels in the peritoneum of these patients appear to be involved in the pathogenesis of endometriosis, and in particular, in infertility.
Our study revealed that the primary sources of MCP-1, HGF, and IGF-1 are probably PFMCs and EESCs, which lead to a regional inflammatory environment and, by creating a defective cycle, contribute to the progression of the disease. As based on the recent findings it has been shown that, after retrograde menstruation, refluxed endometrial cells located outside the uterus stimulate the infiltration of immune cells into lesions, which secrete inflammatory mediators (like, pro-inflammatory cytokines, and chemokines) and these factors activate the nuclear factor kappa B (NF-κB) pathway, and NF-κB further increases transcription of multiple genes encoding pro-inflammatory cytokines, chemokines and angiogenic factors like MCP-1, HGF, and IGF-1, finally resulting in an inflammatory peritoneal microenvironment. So this cocktail of secretions in PF leads to intensification of inflammation [61, 62]. In this study, despite the increased expression of MCP-1 and IGF-1 in PBMCs of patients with endometriosis compared to controls, we observed no significant difference in their protein levels, and this can be due to post-transcriptional changes in mRNA and RNA degradation for various reasons [52].
This contradiction at the level of transcription and protein production requires future studies.
One limitation we faced within this study was the inability to evaluate MCP-1, HGF, and IGF-1 proteins in EESCs, because of the small number of EESCs that was due to the specific nature of EESCs and their difficult growth condition, so it should be examined in other studies. Furthermore, in future studies, other factors associated with growth, invasion, and angiogenesis in endometriosis and different materials with the suppressive effect on those, could be evaluated.

Conclusion

We conclude that PFMCs, as well as ESCs in women with endometriosis, can express a large amount of MCP-1, HGF, and IGF-1 factors, indicating the important role of these factors in the pathology of endometriosis and their possible involvement in the development of endometrial lesions in the ectopic site.

Acknowledgements

We thank all the patients for participating in our study.

Declarations

The study protocol was approved by the Ethics Committee of Medical Research of Iran University of Medical Sciences (Code: IR.IUMS.REC 1394.26098) and all participants signed written informed consent before participating in the study. All methods were carried out in accordance with relevant guidelines and regulations.
Not applicable.

Competing interests

The authors declare that they have no competing interests.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creativecommons.​org/​licenses/​by/​4.​0/​. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Literatur
3.
Zurück zum Zitat Angioni S, D’Alterio MN, Coiana A, Anni F, Gessa S, Deiana D. Genetic characterization of endometriosis patients: review of the literature and a prospective cohort study on a mediterranean population. Int J Mol Sci. 2020;21:1765.PubMedCentralCrossRef Angioni S, D’Alterio MN, Coiana A, Anni F, Gessa S, Deiana D. Genetic characterization of endometriosis patients: review of the literature and a prospective cohort study on a mediterranean population. Int J Mol Sci. 2020;21:1765.PubMedCentralCrossRef
4.
Zurück zum Zitat Deiana D, Gessa S, Anardu M, Daniilidis A, Nappi L, D’Alterio MN, et al. Genetics of endometriosis: a comprehensive review. Gynecol Endocrinol. 2019;35:553–8.PubMedCrossRef Deiana D, Gessa S, Anardu M, Daniilidis A, Nappi L, D’Alterio MN, et al. Genetics of endometriosis: a comprehensive review. Gynecol Endocrinol. 2019;35:553–8.PubMedCrossRef
5.
Zurück zum Zitat Viganó D, Zara F, Pinto S, Loddo E, Casula L, Soru MB, et al. How is small bowel permeability in endometriosis patients? A case control pilot study. Gynecol Endocrinol. 2020;36:1010–4.PubMedCrossRef Viganó D, Zara F, Pinto S, Loddo E, Casula L, Soru MB, et al. How is small bowel permeability in endometriosis patients? A case control pilot study. Gynecol Endocrinol. 2020;36:1010–4.PubMedCrossRef
6.
Zurück zum Zitat Sampson JA. Metastatic or embolic endometriosis, due to the menstrual dissemination of endometrial tissue into the venous circulation. Am J Pathol. 1927;3:93–110.PubMedPubMedCentral Sampson JA. Metastatic or embolic endometriosis, due to the menstrual dissemination of endometrial tissue into the venous circulation. Am J Pathol. 1927;3:93–110.PubMedPubMedCentral
7.
Zurück zum Zitat .Ahn SH, Monsanto SP, Miller C, Singh SS, Thomas R, Tayade C. Pathophysiology and immune dysfunction in endometriosis. Biomed Res Int. 2015;2015:795976. .Ahn SH, Monsanto SP, Miller C, Singh SS, Thomas R, Tayade C. Pathophysiology and immune dysfunction in endometriosis. Biomed Res Int. 2015;2015:795976.
8.
Zurück zum Zitat Vinatier D, Dufour P, Oosterlynck D. Immunological aspects of endometriosis. Hum Reprod Update. 1996;2:371–84.PubMedCrossRef Vinatier D, Dufour P, Oosterlynck D. Immunological aspects of endometriosis. Hum Reprod Update. 1996;2:371–84.PubMedCrossRef
9.
Zurück zum Zitat Delbandi AA, Mahmoudi M, Shervin A, Akbari E, Jeddi-Tehrani M, Sankian M, et al. Eutopic and ectopic stromal cells from patients with endometriosis exhibit differential invasive, adhesive, and proliferative behavior. Fertil Steril. 2013;100:761–9.PubMedCrossRef Delbandi AA, Mahmoudi M, Shervin A, Akbari E, Jeddi-Tehrani M, Sankian M, et al. Eutopic and ectopic stromal cells from patients with endometriosis exhibit differential invasive, adhesive, and proliferative behavior. Fertil Steril. 2013;100:761–9.PubMedCrossRef
10.
Zurück zum Zitat Lousse JC, Van Langendonckt A, Defrere S, Ramos RG, Colette S, Donnez J. Peritoneal endometriosis is an inflammatory disease. Front Biosci (Elite Ed). 2012;4:23–40.CrossRef Lousse JC, Van Langendonckt A, Defrere S, Ramos RG, Colette S, Donnez J. Peritoneal endometriosis is an inflammatory disease. Front Biosci (Elite Ed). 2012;4:23–40.CrossRef
11.
Zurück zum Zitat Arici A, Oral E, Attar E, Tazuke SI, Olive DL. Monocyte chemotactic protein-1 concentration in peritoneal fluid of women with endometriosis and its modulation of expression in mesothelial cells. Fertil Steril. 1997;67:1065–72.PubMedCrossRef Arici A, Oral E, Attar E, Tazuke SI, Olive DL. Monocyte chemotactic protein-1 concentration in peritoneal fluid of women with endometriosis and its modulation of expression in mesothelial cells. Fertil Steril. 1997;67:1065–72.PubMedCrossRef
12.
Zurück zum Zitat Khan KN, Kitajima M, Hiraki K, Fujishita A, Sekine I, Ishimaru T, et al. Immunopathogenesis of pelvic endometriosis: role of hepatocyte growth factor, macrophages and ovarian steroids. Am J Reprod Immunol. 2008;60:383–404.PubMedCrossRef Khan KN, Kitajima M, Hiraki K, Fujishita A, Sekine I, Ishimaru T, et al. Immunopathogenesis of pelvic endometriosis: role of hepatocyte growth factor, macrophages and ovarian steroids. Am J Reprod Immunol. 2008;60:383–404.PubMedCrossRef
13.
Zurück zum Zitat Molnarfi N, Benkhoucha M, Funakoshi H, Nakamura T, Lalive PH. Hepatocyte growth factor: A regulator of inflammation and autoimmunity. Autoimmun Rev. 2015;14:293–303.PubMedCrossRef Molnarfi N, Benkhoucha M, Funakoshi H, Nakamura T, Lalive PH. Hepatocyte growth factor: A regulator of inflammation and autoimmunity. Autoimmun Rev. 2015;14:293–303.PubMedCrossRef
14.
Zurück zum Zitat Chang SY, Ho YS. Immunohistochemical analysis of insulin-like growth factor I, insulin-like growth factor I receptor and insulin-like growth factor II in endometriotic tissue and endometrium. Acta Obstet Gynecol Scand. 1997;76:112–7.PubMedCrossRef Chang SY, Ho YS. Immunohistochemical analysis of insulin-like growth factor I, insulin-like growth factor I receptor and insulin-like growth factor II in endometriotic tissue and endometrium. Acta Obstet Gynecol Scand. 1997;76:112–7.PubMedCrossRef
15.
Zurück zum Zitat Jorgensen H, Hill AS, Beste MT, Kumar MP, Chiswick E, Fedorcsak P, et al. Peritoneal fluid cytokines related to endometriosis in patients evaluated for infertility. Fertil Steril. 2017;107:1191-99 e2.PubMedCrossRef Jorgensen H, Hill AS, Beste MT, Kumar MP, Chiswick E, Fedorcsak P, et al. Peritoneal fluid cytokines related to endometriosis in patients evaluated for infertility. Fertil Steril. 2017;107:1191-99 e2.PubMedCrossRef
16.
Zurück zum Zitat Borrelli GM, Kaufmann AM, Abrao MS, Mechsner S. Addition of MCP-1 and MIP-3beta to the IL-8 appraisal in peritoneal fluid enhances the probability of identifying women with endometriosis. J Reprod Immunol. 2015;109:66–73.PubMedCrossRef Borrelli GM, Kaufmann AM, Abrao MS, Mechsner S. Addition of MCP-1 and MIP-3beta to the IL-8 appraisal in peritoneal fluid enhances the probability of identifying women with endometriosis. J Reprod Immunol. 2015;109:66–73.PubMedCrossRef
17.
Zurück zum Zitat Kim JG, Suh CS, Kim SH, Choi YM, Moon SY, Lee JY. Insulin-like growth factors (IGFs), IGF-binding proteins (IGFBPs), and IGFBP-3 protease activity in the peritoneal fluid of patients with and without endometriosis. Fertil Steril. 2000;73:996–1000.PubMedCrossRef Kim JG, Suh CS, Kim SH, Choi YM, Moon SY, Lee JY. Insulin-like growth factors (IGFs), IGF-binding proteins (IGFBPs), and IGFBP-3 protease activity in the peritoneal fluid of patients with and without endometriosis. Fertil Steril. 2000;73:996–1000.PubMedCrossRef
18.
Zurück zum Zitat Yoshida S, Harada T, Mitsunari M, Iwabe T, Sakamoto Y, Tsukihara S, et al. Hepatocyte growth factor/Met system promotes endometrial and endometriotic stromal cell invasion via autocrine and paracrine pathways. J Clin Endocrinol Metab. 2004;89:823–32.PubMedCrossRef Yoshida S, Harada T, Mitsunari M, Iwabe T, Sakamoto Y, Tsukihara S, et al. Hepatocyte growth factor/Met system promotes endometrial and endometriotic stromal cell invasion via autocrine and paracrine pathways. J Clin Endocrinol Metab. 2004;89:823–32.PubMedCrossRef
19.
Zurück zum Zitat Pizzo A, Salmeri FM, Ardita FV, Sofo V, Tripepi M, Marsico S. Behaviour of cytokine levels in serum and peritoneal fluid of women with endometriosis. Gynecol Obstet Invest. 2002;54:82–7.PubMedCrossRef Pizzo A, Salmeri FM, Ardita FV, Sofo V, Tripepi M, Marsico S. Behaviour of cytokine levels in serum and peritoneal fluid of women with endometriosis. Gynecol Obstet Invest. 2002;54:82–7.PubMedCrossRef
20.
Zurück zum Zitat Zong LL, Li YL, Ha XQ. Determination of HGF concentration in serum and peritoneal fluid in women with endometriosis. Di Yi Jun Yi Da Xue Xue Bao. 2003;23:757–60.PubMed Zong LL, Li YL, Ha XQ. Determination of HGF concentration in serum and peritoneal fluid in women with endometriosis. Di Yi Jun Yi Da Xue Xue Bao. 2003;23:757–60.PubMed
21.
Zurück zum Zitat Malutan A, Drugan T, Georgescu C, Ciortea R, Bucuri C, Bobric A, et al. Vascular endothelial growth factor serum levels in women with advanced endometriosis. Acta Endocrinol (Buchar). 2016;12:7–13.CrossRef Malutan A, Drugan T, Georgescu C, Ciortea R, Bucuri C, Bobric A, et al. Vascular endothelial growth factor serum levels in women with advanced endometriosis. Acta Endocrinol (Buchar). 2016;12:7–13.CrossRef
22.
Zurück zum Zitat Rakhila H, Al-Akoum M, Bergeron ME, Leboeuf M, Lemyre M, Akoum A, et al. Promotion of angiogenesis and proliferation cytokines patterns in peritoneal fluid from women with endometriosis. J Reprod Immunol. 2016;116:1–6.PubMedCrossRef Rakhila H, Al-Akoum M, Bergeron ME, Leboeuf M, Lemyre M, Akoum A, et al. Promotion of angiogenesis and proliferation cytokines patterns in peritoneal fluid from women with endometriosis. J Reprod Immunol. 2016;116:1–6.PubMedCrossRef
23.
Zurück zum Zitat Steff AM, Gagne D, Page M, Rioux A, Hugo P, Gosselin D. Serum concentrations of insulin-like growth factor-1, soluble tumor necrosis factor receptor-1 and angiogenin in endometriosis patients. Am J Reprod Immunol. 2004;51:166–73.PubMedCrossRef Steff AM, Gagne D, Page M, Rioux A, Hugo P, Gosselin D. Serum concentrations of insulin-like growth factor-1, soluble tumor necrosis factor receptor-1 and angiogenin in endometriosis patients. Am J Reprod Immunol. 2004;51:166–73.PubMedCrossRef
24.
Zurück zum Zitat Revised American Society for Reproductive Medicine classification of endometriosis: 1996. Fertil Steril. 1997;67:817–21. Revised American Society for Reproductive Medicine classification of endometriosis: 1996. Fertil Steril. 1997;67:817–21.
25.
Zurück zum Zitat Arablou T, Delbandi AA, Khodaverdi S, Arefi S, Kolahdouz-Mohammadi R, Heidari S, et al. Resveratrol reduces the expression of insulin-like growth factor-1 and hepatocyte growth factor in stromal cells of women with endometriosis compared with nonendometriotic women. Phytother Res. 2019;33:1044–54.PubMedCrossRef Arablou T, Delbandi AA, Khodaverdi S, Arefi S, Kolahdouz-Mohammadi R, Heidari S, et al. Resveratrol reduces the expression of insulin-like growth factor-1 and hepatocyte growth factor in stromal cells of women with endometriosis compared with nonendometriotic women. Phytother Res. 2019;33:1044–54.PubMedCrossRef
26.
Zurück zum Zitat Pluchino N, Taylor HS. Endometriosis and stem cell trafficking. Reprod Sci. 2016;23:1616–9.PubMedCrossRef Pluchino N, Taylor HS. Endometriosis and stem cell trafficking. Reprod Sci. 2016;23:1616–9.PubMedCrossRef
27.
Zurück zum Zitat Laganà AS, Salmeri FM, Vitale SG, Triolo O, Götte M. Stem Cell Trafficking During Endometriosis: May Epigenetics Play a Pivotal Role? Reprod Sci. 2018;25:978–9.PubMedCrossRef Laganà AS, Salmeri FM, Vitale SG, Triolo O, Götte M. Stem Cell Trafficking During Endometriosis: May Epigenetics Play a Pivotal Role? Reprod Sci. 2018;25:978–9.PubMedCrossRef
28.
Zurück zum Zitat D’Alterio MN, Giuliani C, Scicchitano F, Laganà AS, Oltolina NM, Sorrentino F, et al. Possible role of microbiome in the pathogenesis of endometriosis. Minerva Obstet Gynecol. 2021;73:193–214.PubMed D’Alterio MN, Giuliani C, Scicchitano F, Laganà AS, Oltolina NM, Sorrentino F, et al. Possible role of microbiome in the pathogenesis of endometriosis. Minerva Obstet Gynecol. 2021;73:193–214.PubMed
29.
Zurück zum Zitat Laganà AS, Salmeri FM, Frangež HB, Ghezzi F, Vrtačnik-Bokal E, Granese R. Evaluation of M1 and M2 macrophages in ovarian endometriomas from women affected by endometriosis at different stages of the disease. Gynecol Endocrinol. 2020;36:441–4.PubMedCrossRef Laganà AS, Salmeri FM, Frangež HB, Ghezzi F, Vrtačnik-Bokal E, Granese R. Evaluation of M1 and M2 macrophages in ovarian endometriomas from women affected by endometriosis at different stages of the disease. Gynecol Endocrinol. 2020;36:441–4.PubMedCrossRef
30.
Zurück zum Zitat Laganà AS, Triolo O, Salmeri FM, Granese R, Palmara VI, Frangež HB, et al. Natural Killer T cell subsets in eutopic and ectopic endometrium: a fresh look to a busy corner. Arch Gynecol Obstet. 2016;293:941–9.PubMedCrossRef Laganà AS, Triolo O, Salmeri FM, Granese R, Palmara VI, Frangež HB, et al. Natural Killer T cell subsets in eutopic and ectopic endometrium: a fresh look to a busy corner. Arch Gynecol Obstet. 2016;293:941–9.PubMedCrossRef
31.
Zurück zum Zitat Gmyrek GB, Sozanski R, Jerzak M, Chrobak A, Wickiewicz D, Skupnik A, et al. Evaluation of monocyte chemotactic protein-1 levels in peripheral blood of infertile women with endometriosis. Eur J Obstet Gynecol Reprod Biol. 2005;122:199–205.PubMedCrossRef Gmyrek GB, Sozanski R, Jerzak M, Chrobak A, Wickiewicz D, Skupnik A, et al. Evaluation of monocyte chemotactic protein-1 levels in peripheral blood of infertile women with endometriosis. Eur J Obstet Gynecol Reprod Biol. 2005;122:199–205.PubMedCrossRef
32.
Zurück zum Zitat Malutan AM, Drugan T, Ciortea R, Bucuri C, Rada MP, Mihu D. Endometriosis-associated changes in serum levels of interferons and chemokines. Turk J Med Sci. 2017;47:115–22.PubMedCrossRef Malutan AM, Drugan T, Ciortea R, Bucuri C, Rada MP, Mihu D. Endometriosis-associated changes in serum levels of interferons and chemokines. Turk J Med Sci. 2017;47:115–22.PubMedCrossRef
33.
Zurück zum Zitat Drosdzol-Cop A, Skrzypulec-Plinta V, Stojko R. Serum and peritoneal fluid immunological markers in adolescent girls with chronic pelvic pain. Obstet Gynecol Surv. 2012;67:374–81.PubMedCrossRef Drosdzol-Cop A, Skrzypulec-Plinta V, Stojko R. Serum and peritoneal fluid immunological markers in adolescent girls with chronic pelvic pain. Obstet Gynecol Surv. 2012;67:374–81.PubMedCrossRef
34.
Zurück zum Zitat Kim JY, Kim H, Suh CS, Kim SH, Choi YM, Kim JG. The G(-2518)A polymorphism of monocyte chemotactic protein-1 (MCP-1) and its serum and peritoneal fluid levels in Korean women with endometriosis. Eur J Obstet Gynecol Reprod Biol. 2008;139:106–10.PubMedCrossRef Kim JY, Kim H, Suh CS, Kim SH, Choi YM, Kim JG. The G(-2518)A polymorphism of monocyte chemotactic protein-1 (MCP-1) and its serum and peritoneal fluid levels in Korean women with endometriosis. Eur J Obstet Gynecol Reprod Biol. 2008;139:106–10.PubMedCrossRef
35.
Zurück zum Zitat Vodolazkaia A, El-Aalamat Y, Popovic D, Mihalyi A, Bossuyt X, Kyama CM, et al. Evaluation of a panel of 28 biomarkers for the non-invasive diagnosis of endometriosis. Hum Reprod. 2012;27:2698–711.PubMedCrossRef Vodolazkaia A, El-Aalamat Y, Popovic D, Mihalyi A, Bossuyt X, Kyama CM, et al. Evaluation of a panel of 28 biomarkers for the non-invasive diagnosis of endometriosis. Hum Reprod. 2012;27:2698–711.PubMedCrossRef
36.
Zurück zum Zitat Margari KM, Zafiropoulos A, Hatzidaki E, Giannakopoulou C, Arici A, Matalliotakis I. Peritoneal fluid concentrations of beta-chemokines in endometriosis. Eur J Obstet Gynecol Reprod Biol. 2013;169:103–7.PubMedCrossRef Margari KM, Zafiropoulos A, Hatzidaki E, Giannakopoulou C, Arici A, Matalliotakis I. Peritoneal fluid concentrations of beta-chemokines in endometriosis. Eur J Obstet Gynecol Reprod Biol. 2013;169:103–7.PubMedCrossRef
37.
Zurück zum Zitat Akoum A, Lemay A, Brunet C, Hebert J. Secretion of monocyte chemotactic protein-1 by cytokine-stimulated endometrial cells of women with endometriosis. Le groupe d’investigation en gynecologie. Fertil Steril. 1995;63:322–8.PubMedCrossRef Akoum A, Lemay A, Brunet C, Hebert J. Secretion of monocyte chemotactic protein-1 by cytokine-stimulated endometrial cells of women with endometriosis. Le groupe d’investigation en gynecologie. Fertil Steril. 1995;63:322–8.PubMedCrossRef
38.
Zurück zum Zitat Ulukus M, Ulukus EC, Tavmergen Goker EN, Tavmergen E, Zheng W, Arici A. Expression of interleukin-8 and monocyte chemotactic protein 1 in women with endometriosis. Fertil Steril. 2009;91:687–93.PubMedCrossRef Ulukus M, Ulukus EC, Tavmergen Goker EN, Tavmergen E, Zheng W, Arici A. Expression of interleukin-8 and monocyte chemotactic protein 1 in women with endometriosis. Fertil Steril. 2009;91:687–93.PubMedCrossRef
39.
Zurück zum Zitat Kolahdouz-Mohammadi R, Shidfar F, Khodaverdi S, Arablou T, Heidari S, Rashidi N, et al. Resveratrol treatment reduces expression of MCP-1, IL-6, IL-8 and RANTES in endometriotic stromal cells. J cell Mol Med. 2021;25:1116–27.PubMedCrossRef Kolahdouz-Mohammadi R, Shidfar F, Khodaverdi S, Arablou T, Heidari S, Rashidi N, et al. Resveratrol treatment reduces expression of MCP-1, IL-6, IL-8 and RANTES in endometriotic stromal cells. J cell Mol Med. 2021;25:1116–27.PubMedCrossRef
40.
Zurück zum Zitat Deshmane SL, Kremlev S, Amini S, Sawaya BE. Monocyte chemoattractant protein-1 (MCP-1): an overview. J Interferon Cytokine Res. 2009;29:313–26.PubMedPubMedCentralCrossRef Deshmane SL, Kremlev S, Amini S, Sawaya BE. Monocyte chemoattractant protein-1 (MCP-1): an overview. J Interferon Cytokine Res. 2009;29:313–26.PubMedPubMedCentralCrossRef
41.
Zurück zum Zitat Akoum A, Kong J, Metz C, Beaumont MC. Spontaneous and stimulated secretion of monocyte chemotactic protein-1 and macrophage migration inhibitory factor by peritoneal macrophages in women with and without endometriosis. Fertil Steril. 2002;77:989–94.PubMedCrossRef Akoum A, Kong J, Metz C, Beaumont MC. Spontaneous and stimulated secretion of monocyte chemotactic protein-1 and macrophage migration inhibitory factor by peritoneal macrophages in women with and without endometriosis. Fertil Steril. 2002;77:989–94.PubMedCrossRef
42.
Zurück zum Zitat Gu L, Tseng S, Horner RM, Tam C, Loda M, Rollins BJ. Control of TH2 polarization by the chemokine monocyte chemoattractant protein-1. Nature. 2000;404:407–11.PubMedCrossRef Gu L, Tseng S, Horner RM, Tam C, Loda M, Rollins BJ. Control of TH2 polarization by the chemokine monocyte chemoattractant protein-1. Nature. 2000;404:407–11.PubMedCrossRef
43.
Zurück zum Zitat Salcedo R, Ponce ML, Young HA, Wasserman K, Ward JM, Kleinman HK, et al. Human endothelial cells express CCR2 and respond to MCP-1: direct role of MCP-1 in angiogenesis and tumor progression. Blood. 2000;96:34–40.PubMedCrossRef Salcedo R, Ponce ML, Young HA, Wasserman K, Ward JM, Kleinman HK, et al. Human endothelial cells express CCR2 and respond to MCP-1: direct role of MCP-1 in angiogenesis and tumor progression. Blood. 2000;96:34–40.PubMedCrossRef
44.
Zurück zum Zitat Varma R, Rollason T, Gupta JK, Maher ER. Endometriosis and the neoplastic process. Reproduction. 2004;127:293–304.PubMedCrossRef Varma R, Rollason T, Gupta JK, Maher ER. Endometriosis and the neoplastic process. Reproduction. 2004;127:293–304.PubMedCrossRef
45.
Zurück zum Zitat Gao F, Deng G, Liu W, Zhou K, Li M. Resveratrol suppresses human hepatocellular carcinoma via targeting HGF-c-Met signaling pathway. Oncol Rep. 2017;37:1203–11.PubMedCrossRef Gao F, Deng G, Liu W, Zhou K, Li M. Resveratrol suppresses human hepatocellular carcinoma via targeting HGF-c-Met signaling pathway. Oncol Rep. 2017;37:1203–11.PubMedCrossRef
46.
Zurück zum Zitat Osuga Y, Tsutsumi O, Okagaki R, Takai Y, Fujimoto A, Suenaga A, et al. Hepatocyte growth factor concentrations are elevated in peritoneal fluid of women with endometriosis. Hum Reprod. 1999;14:1611–3.PubMedCrossRef Osuga Y, Tsutsumi O, Okagaki R, Takai Y, Fujimoto A, Suenaga A, et al. Hepatocyte growth factor concentrations are elevated in peritoneal fluid of women with endometriosis. Hum Reprod. 1999;14:1611–3.PubMedCrossRef
47.
Zurück zum Zitat KhoshdelRad N, Salehi Z, Mashayekhi F, Abbasi O, Mirzajani E. Soluble c-Met expression in the peritoneal fluid and serum of patients with different stages of endometriosis. Arch Gynecol Obstet. 2014;289:1107–12.PubMedCrossRef KhoshdelRad N, Salehi Z, Mashayekhi F, Abbasi O, Mirzajani E. Soluble c-Met expression in the peritoneal fluid and serum of patients with different stages of endometriosis. Arch Gynecol Obstet. 2014;289:1107–12.PubMedCrossRef
48.
Zurück zum Zitat Sugawara J, Fukaya T, Murakami T, Yoshida H, Yajima A. Increased secretion of hepatocyte growth factor by eutopic endometrial stromal cells in women with endometriosis. Fertil Steril. 1997;68:468–72.PubMedCrossRef Sugawara J, Fukaya T, Murakami T, Yoshida H, Yajima A. Increased secretion of hepatocyte growth factor by eutopic endometrial stromal cells in women with endometriosis. Fertil Steril. 1997;68:468–72.PubMedCrossRef
49.
Zurück zum Zitat Nasu K, Sugano T, Matsui N, Narahara H, Kawano Y, Miyakawa I. Expression of hepatocyte growth factor in cultured human endometrial stromal cells is induced through a protein kinase C-dependent pathway. Biol Reprod. 1999;60:1183–7.PubMedCrossRef Nasu K, Sugano T, Matsui N, Narahara H, Kawano Y, Miyakawa I. Expression of hepatocyte growth factor in cultured human endometrial stromal cells is induced through a protein kinase C-dependent pathway. Biol Reprod. 1999;60:1183–7.PubMedCrossRef
50.
Zurück zum Zitat Khan KN, Masuzaki H, Fujishita A, Kitajima M, Sekine I, Ishimaru T. Immunoexpression of hepatocyte growth factor and c-Met receptor in the eutopic endometrium predicts the activity of ectopic endometrium. Fertil Steril. 2003;79:173–81.PubMedCrossRef Khan KN, Masuzaki H, Fujishita A, Kitajima M, Sekine I, Ishimaru T. Immunoexpression of hepatocyte growth factor and c-Met receptor in the eutopic endometrium predicts the activity of ectopic endometrium. Fertil Steril. 2003;79:173–81.PubMedCrossRef
51.
Zurück zum Zitat Delbandi AA, Mahmoudi M, Shervin A, Heidari S, Kolahdouz-Mohammadi R, Zarnani AH. Evaluation of apoptosis and angiogenesis in ectopic and eutopic stromal cells of patients with endometriosis compared to non-endometriotic controls. BMC Womens Health. 2020;20:3.PubMedPubMedCentralCrossRef Delbandi AA, Mahmoudi M, Shervin A, Heidari S, Kolahdouz-Mohammadi R, Zarnani AH. Evaluation of apoptosis and angiogenesis in ectopic and eutopic stromal cells of patients with endometriosis compared to non-endometriotic controls. BMC Womens Health. 2020;20:3.PubMedPubMedCentralCrossRef
52.
Zurück zum Zitat Khan KN, Masuzaki H, Fujishita A, Kitajima M, Kohno T, Sekine I, et al. Regulation of hepatocyte growth factor by basal and stimulated macrophages in women with endometriosis. Hum Reprod. 2005;20:49–60.PubMedCrossRef Khan KN, Masuzaki H, Fujishita A, Kitajima M, Kohno T, Sekine I, et al. Regulation of hepatocyte growth factor by basal and stimulated macrophages in women with endometriosis. Hum Reprod. 2005;20:49–60.PubMedCrossRef
53.
Zurück zum Zitat Gao LM, Wang F, Zheng Y, Fu ZZ, Zheng L, Chen LL. Roles of Fibroblast Activation Protein and Hepatocyte Growth Factor Expressions in Angiogenesis and Metastasis of Gastric Cancer. Pathol Oncol Res. 2019;25:369–76.PubMedCrossRef Gao LM, Wang F, Zheng Y, Fu ZZ, Zheng L, Chen LL. Roles of Fibroblast Activation Protein and Hepatocyte Growth Factor Expressions in Angiogenesis and Metastasis of Gastric Cancer. Pathol Oncol Res. 2019;25:369–76.PubMedCrossRef
54.
Zurück zum Zitat Noguchi E, Saito N, Kobayashi M, Kameoka S. Clinical significance of hepatocyte growth factor/c-Met expression in the assessment of gastric cancer progression. Mol Med Rep. 2015;11:3423–31.PubMedPubMedCentral Noguchi E, Saito N, Kobayashi M, Kameoka S. Clinical significance of hepatocyte growth factor/c-Met expression in the assessment of gastric cancer progression. Mol Med Rep. 2015;11:3423–31.PubMedPubMedCentral
55.
Zurück zum Zitat Zhou Y, Zeng C, Li X, Wu PL, Yin L, Yu XL, et al. IGF-I stimulates ERβ and aromatase expression via IGF1R/PI3K/AKT-mediated transcriptional activation in endometriosis. J Mol Med (Berl). 2016;94:887–97.CrossRef Zhou Y, Zeng C, Li X, Wu PL, Yin L, Yu XL, et al. IGF-I stimulates ERβ and aromatase expression via IGF1R/PI3K/AKT-mediated transcriptional activation in endometriosis. J Mol Med (Berl). 2016;94:887–97.CrossRef
56.
Zurück zum Zitat Gurgan T, Bukulmez O, Yarali H, Tanir M, Akyildiz S. Serum and peritoneal fluid levels of IGF I and II and insulinlike growth binding protein-3 in endometriosis. J Reprod Med. 1999;44:450–4.PubMed Gurgan T, Bukulmez O, Yarali H, Tanir M, Akyildiz S. Serum and peritoneal fluid levels of IGF I and II and insulinlike growth binding protein-3 in endometriosis. J Reprod Med. 1999;44:450–4.PubMed
57.
Zurück zum Zitat Matalliotakis IM, Goumenou AG, Koumantakis GE, Neonaki MA, Koumantakis EE, Dionyssopoulou E, et al. Serum concentrations of growth factors in women with and without endometriosis: the action of anti-endometriosis medicines. Int Immunopharmacol. 2003;3:81–9.PubMedCrossRef Matalliotakis IM, Goumenou AG, Koumantakis GE, Neonaki MA, Koumantakis EE, Dionyssopoulou E, et al. Serum concentrations of growth factors in women with and without endometriosis: the action of anti-endometriosis medicines. Int Immunopharmacol. 2003;3:81–9.PubMedCrossRef
58.
Zurück zum Zitat Rutanen EM. Insulin-like growth factors in endometrial function. Gynecol Endocrinol. 1998;12:399–406.PubMedCrossRef Rutanen EM. Insulin-like growth factors in endometrial function. Gynecol Endocrinol. 1998;12:399–406.PubMedCrossRef
59.
Zurück zum Zitat Milingos DS, Philippou A, Armakolas A, Papageorgiou E, Sourla A, Protopapas A, et al. Insulinlike growth factor-1Ec (MGF) expression in eutopic and ectopic endometrium: characterization of the MGF E-peptide actions in vitro. Mol Med. 2011;17:21–8.PubMedCrossRef Milingos DS, Philippou A, Armakolas A, Papageorgiou E, Sourla A, Protopapas A, et al. Insulinlike growth factor-1Ec (MGF) expression in eutopic and ectopic endometrium: characterization of the MGF E-peptide actions in vitro. Mol Med. 2011;17:21–8.PubMedCrossRef
60.
Zurück zum Zitat Giudice LC, Dsupin BA, Gargosky SE, Rosenfeld RG, Irwin JC. The insulin-like growth factor system in human peritoneal fluid: its effects on endometrial stromal cells and its potential relevance to endometriosis. J Clin Endocrinol Metab. 1994;79:1284–93.PubMed Giudice LC, Dsupin BA, Gargosky SE, Rosenfeld RG, Irwin JC. The insulin-like growth factor system in human peritoneal fluid: its effects on endometrial stromal cells and its potential relevance to endometriosis. J Clin Endocrinol Metab. 1994;79:1284–93.PubMed
61.
Zurück zum Zitat Kaponis A, Iwabe T, Taniguchi F, Ito M, Deura I, Decavalas G, et al. The role of NF-kappaB in endometriosis. Front Biosci (Schol Ed). 2012;4:1213–34. Kaponis A, Iwabe T, Taniguchi F, Ito M, Deura I, Decavalas G, et al. The role of NF-kappaB in endometriosis. Front Biosci (Schol Ed). 2012;4:1213–34.
62.
Zurück zum Zitat Chapron C, Marcellin L, Borghese B, Santulli P. Rethinking mechanisms, diagnosis and management of endometriosis. Nat Rev Endocrinol. 2019;15:666–82.PubMedCrossRef Chapron C, Marcellin L, Borghese B, Santulli P. Rethinking mechanisms, diagnosis and management of endometriosis. Nat Rev Endocrinol. 2019;15:666–82.PubMedCrossRef
Metadaten
Titel
Expression levels of MCP-1, HGF, and IGF-1 in endometriotic patients compared with non-endometriotic controls
verfasst von
Sahel Heidari
Roya Kolahdouz-Mohammadi
Sepideh Khodaverdi
Nader Tajik
Ali-Akbar Delbandi
Publikationsdatum
01.12.2021
Verlag
BioMed Central
Erschienen in
BMC Women's Health / Ausgabe 1/2021
Elektronische ISSN: 1472-6874
DOI
https://doi.org/10.1186/s12905-021-01560-6

Weitere Artikel der Ausgabe 1/2021

BMC Women's Health 1/2021 Zur Ausgabe

Mehr Brustkrebs, aber weniger andere gynäkologische Tumoren mit Levonorgestrel-IUS

04.06.2024 Levonorgestrel Nachrichten

Unter Frauen, die ein Levonorgestrel-freisetzendes intrauterines System (IUS) verwenden, ist die Brustkrebsrate um 13% erhöht. Dafür kommt es deutlich seltener zu Endometrium-, Zervix- und Ovarialkarzinomen.

Prämenstruelle Beschwerden mit Suizidrisiko assoziiert

04.06.2024 Suizidalität Nachrichten

Manche Frauen, die regelmäßig psychische und körperliche Symptome vor ihrer Menstruation erleben, haben ein deutlich erhöhtes Suizidrisiko. Jüngere Frauen sind besonders gefährdet.

Alter der Mutter beeinflusst Risiko für kongenitale Anomalie

28.05.2024 Kinder- und Jugendgynäkologie Nachrichten

Welchen Einfluss das Alter ihrer Mutter auf das Risiko hat, dass Kinder mit nicht chromosomal bedingter Malformation zur Welt kommen, hat eine ungarische Studie untersucht. Sie zeigt: Nicht nur fortgeschrittenes Alter ist riskant.

Fehlerkultur in der Medizin – Offenheit zählt!

28.05.2024 Fehlerkultur Podcast

Darüber reden und aus Fehlern lernen, sollte das Motto in der Medizin lauten. Und zwar nicht nur im Sinne der Patientensicherheit. Eine negative Fehlerkultur kann auch die Behandelnden ernsthaft krank machen, warnt Prof. Dr. Reinhard Strametz. Ein Plädoyer und ein Leitfaden für den offenen Umgang mit kritischen Ereignissen in Medizin und Pflege.

Update Gynäkologie

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert – ganz bequem per eMail.