Identification of ANXA3 as a biomarker associated with pyroptosis in ischemic stroke

The Gene Expression Omnibus (GEO) database (http://​www.​ncbi.​nlm.​nih.​gov/​geo) was used to obtain gene expression profiles of IS, including GSE58294, GSE22255, GSE66724, GSE16561, and GSE37587. The details of the dataset are presented in Additional file 1: Table S1. Among them, GSE58294, GSE22255, and GSE66724 are all GPL570 platforms integrated into one dataset. GSE16561 and GSE37587 are GPL6883 platforms integrated into one dataset. The corresponding dataset is represented by the platform number. For multiple probes corresponding to a gene, the average expression value was taken as the gene expression value. ComBat was utilized to eliminate batch-to-batch variation in the "sva" R package. Distribution patterns of IS and control samples (before and after batch correction using ComBat) were observed by principal component analysis (PCA).

The two datasets were analyzed for differences using the limma package. The filter condition was |logFC|> log₂(1.5) and p < 0.05. The filtered DEGs were used for random forest analysis to obtain the important common genes of the two datasets. The pyroptosis-associated gene set, including 44 genes, is shown in Additional file 2: Table S2. After gene set variation analysis (GSVA), pyroptosis scores were obtained. Correlation analysis was performed using the obtained important common genes and pyroptosis scores in the two datasets. The genes with R > 0.2 and p < 0.05 were included in the next analysis, and the intersection of the two data sets was taken as potential pyroptosis-related genes in IS.

A total of 48 adult male Sprague–Dawley rats (250–280 g) were purchased from the Hunan Slack Jingda Experimental Animal Co., Ltd. All rats underwent a 12 h light–dark cycle in a room with constant humidity (40–70%) and temperature (22–26 °C). Rats were allowed to eat and drink freely before the experiment and fasted for 12 h before surgery. Animals were randomly divided into 2 groups, including the sham operation group (Sham, n = 8) and the middle cerebral artery occlusion/reperfusion (MCAO/R) model group (n = 8). The MCAO/R model was constructed as previously described [11]. Rats were anesthetized by intraperitoneal injection of sodium pentobarbital (35 mg/kg). Rats were fixed in the supine position. Nylon (0.26 mm in diameter, 40 mm in length) was used to suture the internal carotid artery. The indwelling sutures were maintained for 2 h, and the filaments were removed to allow reperfusion for 24 h. During MCAO/R, the body temperature of the rats was maintained at 37 ± 0.5 °C. In the sham group, the same surgical induction was performed, but the artery was not ligated.

As previously described [12, 13], 3 days before the MCAO/R intervention, rat brains were targeted for slow injection of 10 µl of 4 × 10⁹ TU/ml sh-NC and sh-ANXA3 lentiviral suspensions further to explore the effects of ANXA3 on the animal model. The injection process was carried out at 0.2 μl/min. Following the injection, the rats were subjected to MCAO/R treatment. The rats in the model and sham-operated groups were treated as described above.

All experiments were performed in accordance with institutional guidelines. Rats were sacrificed by intraperitoneal injection of 150 mg/kg sodium pentobarbital. Brain tissue and peripheral blood were obtained for subsequent experimental detection. This study was approved by the Animal Ethical and Welfare Committee of Hunan University of Traditional Chinese Medicine (LL2021091501).

The neurological function of rats was scored according to Bederson's method [14]. The rat tail was suspended. Forelimb flexion was observed. A score of 0 points indicated that the activity of the rat was normal; 1 point indicated that when the rat was lifted vertically, the left forelimb could not be fully extended; 2 points indicated that the lateral thrust resistance of the rat was reduced; 3 points indicated unilateral rotation when the rat walked freely; and 4 points indicated that the rat was unable to walk due to flaccid paralysis. A higher score indicates worse neurological function.

Brain tissue was cut into 5 consecutive coronal brain sections. Afterward, brain slices were incubated with 1% 2,3,5 triphenyltetrazolium chloride (TTC, Sangon Biotech Co., Ltd.) for 15 min at 37 °C in the dark [15]. With reference to previous work [16, 17], the formula for calculating the percentage of infarcted area was calculated as follows: infarct rate (%) = (volume of the unlesioned hemisphere—volume of the lesioned hemisphere that is not infarcted)/volume of the unlesioned hemisphere × 100%.

Tissue sections were grilled as previously described [18] and then deparaffinized to water. After heat antigen repair and routine pre-treatments, sections were incubated overnight at 4 °C with primary antibody (caspase1, 22915–1-AP, 1:100, Proteintech, USA). Then, the sections were incubated with a secondary antibody (Goat Anti-Rabbit IgG(H + L), SA00013-2, Proteintech, USA) for 90 min at 37 °C. After nucleation and sealing, the sections were placed under a fluorescence microscope (XD-202, Ningbo Jiangnan Instrument Factory, China) for observation. Image J (ImageJ, National Institutes of Health, USA) was used to analyze the fluorescence intensity.

A rat pheochromocytoma cell line (PC12, CL-0412, Pricella, China) was cultured in Dulbecco's modified Eagle's medium (D5796, DMEM, Gibco, USA) containing 10% fetal bovine serum (FBS, 10,099,141, Gibco, USA). Cells were cultured at 37 °C in a 5% CO₂ environment.

Cells were first divided into control, oxygen–glucose deprivation/reoxygenation (OGD/R), and OGD/R + lipopolysaccharide (LPS) groups. The cells in the OGD/R group were placed in sugar-free DMEM under hypoxia (95% N2, 5% CO₂) for 2 h and then reoxygenated for 2 h. The cells in the OGD/R + LPS group were placed in sugar-free DMEM containing LPS (1 μg/mL, 82857-67-8, Sigma, USA) under hypoxia (95% N2, 5% CO₂) for 2 h and then reoxygenated for 2 h [11].

Cells were divided into the control, OGD/R + LPS, OGD/R + LPS + silencing of negative control (si-NC, Invitrogen, USA), and OGD/R + LPS + silencing of Annexin A3 (si-ANXA3) groups. Cells in the OGD/R + LPS group were treated as above. Cells in the OGD/R + LPS + si-NC and OGD/R + LPS + si-ANXA3 groups were treated as follows. After cells were transfected with si-NC and si-ANXA3 with Lipofectamine 2000 (2028090, Invitrogen, USA), they were treated with OGD/R and LPS.

The cell viability was assessed using CCK-8 solution (10%) following the manufacturer’s instructions (AWC0114a, Abiowell, China). After incubating the cells at 37 °C with 5% CO₂ for 4 h, the absorbance (OD) value at 450 nm was measured using an enzyme marker (MB-530, HEALES, China).

The above total RNA from peripheral blood, tissue, or cells was extracted and quantitatively analyzed. One microgram of RNA was used to synthesize cDNA. An UltraSYBR Mixture kit (CW2601, CWBIO, China) was utilized as a template for PCR. The primers are as follows. ANXA3, forward primer: TCAGCTCTCTGAGCCTTAGGT; reverse primer: CTCGTGGGGTGACCATTTCG; ANKRD22, forward primer: CAAAGCAGAATGAGGCTCTCG; reverse primer: GTAGCCGTAGCAGTCGGTAG; ADM, forward primer: TTGGACTTTGCGGGTTTTGC, reverse primer: GCTCCGATACCCTGCTGAAA; GAPDH, forward primer: ACAGCAACAGGGTGGTGGAC; reverse primer: TTTGAGGGTGCAGCGAACTT. The expression level of the target gene was analyzed by the 2^−ΔΔCT method. Amplified PCR products were quantified and normalized to GAPDH as a control.

The total protein from the tissues or cells described above was extracted and quantitatively analyzed. Protein homogenates were run on SDS‒PAGE gels and transferred to PVDF membranes. After the membrane was blocked with 5% milk, it was incubated overnight in the primary antibody (Additional file 3: Table S3). β-actin was conducted as an internal reference. The secondary antibody was incubated for 90 min at 37 °C. Membranes were subjected to enhanced chemiluminescence for signal intensity quantification. A chemiluminescence imaging system (ChemiScope 6100, China) was adopted for analysis.

The GSVA package was used for Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses. Correlations between ANXA3 expression and pathways were analyzed. Important pathways among them were screened. Correlations between ANXA3 expression and all genes were analyzed. A gene set of 22 immune cells was utilized for immune cell analysis.

Quantitative analysis was performed using Prism 8.0. A Pearson's coefficient correlation test was used to measure correlations. The level of significance was set at *p < 0.05. The error bar represents mean ± standard deviation.

The flow diagram of the study is shown in Additional file 4: Fig. S1. The scatter plots of PCA for the two datasets showed two different distribution patterns for the control and IS groups. The IS group was mainly distributed on the upper side of the figure, while the control group was mainly distributed on the lower side of the figure (Fig. 1A). The two datasets GPL570 and GPL6883 (samples from a total of 170 IS patients and 109 healthy individuals) were subjected to differential analysis using the limma package. The filter range was |logFC|> log2(1.5) and p < 0.05. Volcano plot results revealed DEGs (Fig. 1B). Subsequently, random forest analysis was used to screen important DEGs (Fig. 1C). Then, these genes were intersected to obtain 25 upregulated and 5 downregulated important DEGs (Fig. 1D). Next, these 30 genes were used for subsequent analysis.

The results of the above 30 DEGs in the control and IS groups are shown in the heatmap (Fig. 2A). The pyroptosis-related gene set was subjected to GSVA to obtain a pyroptosis score. In the GPL570 and GPL6883 datasets, the expression correlation between the pyroptosis-related gene set and the pyroptosis score is shown in Additional file 5: Fig. S2A and B. Correlation analysis was performed with the obtained important DEGs and pyroptosis scores in the two datasets, and 6 and 19 important genes related to pyroptosis were obtained. As shown in Fig. 2B, C, the expression of all the abovementioned important pyroptosis-related genes, such as ADM, CLEC4D, SIPA1L2, SLC22A4, and MCEMP1, significantly changed with the change in pyroptosis scores. The correlation analysis showed that the expression of all the above genes, such as CLEC4D (R = 0.38, p = 0.0002), SIPA1L2 (R = 0.52, p = 1.23e−08), SLC22A4 (R = 0.41, p = 1.74e−05), and MCEMP1 (R = 0.39, p = 3.94e−05), was positively correlated with the pyroptosis score. Genes with R > 0.2 and p < 0.05 were included in the next analysis. The intersection of the two datasets included three pyroptosis-related DEGs, ANXA3, ANKRD22, and ADM (Fig. 3A). ANXA3, ANKRD22, and ADM were significantly higher in the IS group than in the control group (Fig. 3B, p < 0.0001). In the GPL570 dataset, pyroptosis was positively correlated with the ANXA3 (R = 0.42, p = 3.9e−05), ANKRD22 (R = 0.27, p = 0.012), and ADM (R = 0.31, p = 0.0029) genes. Similarly, in the GPL6883 dataset, pyroptosis was positively correlated with the ANXA3 (R = 0.59, p = 2.3e−11), ANKRD22 (R = 0.35, p = 0.00019), and ADM (R = 0.29, p = 0.0023) genes (Fig. 3C). The above results suggest that the DEGs (ANXA3, ANKRD22, and ADM) in IS may be related to pyroptosis.

To further verify whether the above genes were differentially expressed in IS, we constructed a rat MCAO/R model. Compared with the rats in the sham group, the rats in the MCAO/R group developed large-area cerebral infarction. Neurological scores of the rats in the MCAO/R group were significantly higher than those of the sham group (Fig. 4A, B). After modeling, the expression levels of ADM and ANXA3 in peripheral blood and brain tissue were overtly increased (p < 0.05), and the fold difference in ANXA3 expression was larger. However, the expression of ANKRD22 was not significantly different (Fig. 4C–F), suggesting that the expression of ANXA3 and ADM might be associated with the development of IS.

To further explore the association of ANXA3 with pyroptosis-related pathways, we analyzed the association of ANXA3 with the genes in the pyroptosis-related gene set. In both datasets, the expression of ANXA3 was significantly changed with changes in pyroptosis scores, such as those in NLRP12, NAIP, IFI16, NLRC4, CASP8, and AIM2 (Fig. 5A). The protein expression levels of NLRP3, NLRC4, AIM2, GSDMD-N, caspase-8, pro-caspase-1, cleaved caspase-1, caspase-1, IL-1β, and IL-18 were significantly increased in the rats in the MCAO/R group (Fig. 5B–D, p < 0.05), suggesting that pyroptosis occurred in the brain tissue of the model group.

Next, we conducted in vitro studies. Cell activity was significantly inhibited in both the OGD/R + LPS and OGD/R groups compared to the control group, with the OGD/R + LPS group showing a greater level of inhibition (Additional file 6: Fig. S3A). Furthermore, both OGD/R and OGD/R + LPS induced the expression of GSDMD-N and IL-1β, with the highest expression observed in the OGD/R + LPS group (Additional file 6: Fig. S3B). Consequently, the OGD/R + LPS group was chosen for constructing in vitro cell models in the subsequent experiments. To further explore whether ANXA3 regulates pyroptosis-related pathways, we interfered with ANXA3 in cells. Si-ANXA3 inhibited the OGD/R combined with an LPS-induced increase in ANXA3 expression (Fig. 6A, p < 0.05). Si-ANXA3 significantly inhibited the OGD/R combined with LPS-induced increases in the expression of NLRC4, AIM2, GSDMD-N, caspase-8, pro-caspase-1, cleaved caspase-1, and IL-18 (Fig. 6B, C,  p < 0.05), suggesting that si-ANXA3 could inhibit the pyroptosis induced by OGD/R + LPS.

To further validate the impact of ANXA3 inhibition on MCAO/R-induced animal models, we conducted in vivo experiments to suppress ANXA3 expression. The MCAO/R + sh-ANXA3 group showed lower infarct rate and neurological scores than the MCAO/R + sh-NC group (Fig. 7A and B). Additionally, the protein expression levels of NLRP3, NLRC4, AIM2, GSDMD-N, caspase-8, pro-caspase-1, cleaved caspase-1, and IL-1β were lower in the MCAO/R + sh-ANXA3 group as compared to the MCAO/R + sh-NC group (Fig. 7C and D). These findings indicated that ANXA3 inhibition could effectively suppress MCAO/R-induced pyroptosis.

We further analyzed the functional enrichment of the ANXA3 gene. ANXA3 was mainly enriched in Toll-like receptor binding, inflammasome complex, MYD88-dependent Toll-like receptor signaling pathway, oxidoreductase activity acting on a sulfur group of donors’ oxygen as acceptor, regulation of interleukin 1-mediated signaling pathway, hypoxia inducible factor 1alpha signaling pathway, and TGF beta signaling pathway (Fig. 8A). In addition, in the functional enrichment analysis of immune cells, compared with the low ANXA3 group, the high ANXA3 group showed lower levels of CD8 T cells (p < 0.01), M2 macrophages (p < 0.01), and naive CD4 T cells (Fig. 8B, p < 0.0001). The above results suggest that ANXA3 may be associated with inflammatory and immune regulatory pathways.