Background
Pathological myopia (PM) is defined as an eye axial length larger than 26 mm or a refractive error greater than 6 D, accompanied by posterior scleral staphyloma and chorioretinal degeneration in the macular area [
1]. The development of this disease leads to irreversible damage to the retinal tissue and it is one of the leading causes of blindness over the world. The incidence of PM is 2 %, and it is increasing year by year [
2]. A recent study found that systemic metabolic factors may be related to the abnormal growth of PM eyeballs [
3]. Further research found that serum and vitreous insulin levels in PM patients increased [
4].
RPE cells are one of the important cells in the initiation mechanism of the retina-choroid-sclera pathway [
5]. Progression of PM has discovered that RPE cells may play an important role in the formation and development of myopia [
6,
7]. For example, it has been shown that transforming growth factor and bone morphogenetic protein pathways are involved in the regulation of eye growth and myopia in RPE cells [
6]. Previous studies have revealed that the growth of the eye axis and the deformation of the eyeball during PM are caused by the steady-state changes of eyeball growth, which are controlled by optical signals [
8]. After receiving the optical signal, the local retina can control the growth of the local eyeball and the refractive state of the eyeball. The current research generally believes that the growth of the eyeball originates from the retina [
9]. After the retina receives optical signals, it can release a variety of signal molecules to control the growth rate of the underlying tissues and affect the process of myopia [
10]. In this signal transmission system, RPE cells are one of the most important cells and are closely related to the occurrence of eyeball growth and myopia. It is located in the outermost layer of the retina and separates the retina from the choroid and sclera. This key position of RPE between the retina and the choroid makes it a possible conduit for the growth regulation signal from the retina to the choroid and sclera. RPE has the function of secreting various cytokines and growth factors and carrying out ion transport [
11]. In turn, RPE cells have a similar barrier function and prevent the active substances of the retina from reaching downstream tissues, thereby preventing changes in downstream tissue morphology and function, so the disordered secrete function in RPE cells is an important cause of changes in the eye axis. Therefore, it is believed that the active substance of the retina acts as a primary signal on RPE cells first, which will cause function changes in RPE cell, and then generate secondary signals downstream [
10,
12].
Insulin is one of the indispensable hormones to promote tissue growth. It is a protein hormone secreted by insulin β cells and stimulated by endogenous or exogenous substances such as glucose, lactose, glucagon, etc. [
13]. It is the only protein hormone in the body that lowers blood sugar and plays its role in promoting growth and inhibiting protein decomposition. In recent years, insulin has been used in animal models to study the mechanism of eyeball growth regulation [
14]. Animal studies have found that the role of exogenous insulin in the formation of animal ocular myopia is mainly manifested in the injection of insulin into the eye, which can promote the growth of the eye axis and the thinning of choroidal tissue [
15]. Further studies have proposed that a certain concentration of exogenous insulin can also act on the eyes of form-deprivation animal models, causing a further deepening of myopia and an increase in the length of the eye axis [
4]. At present, the specific mechanism of insulin has not yet been clarified, and the study is limited to animal experiments, and no clinical studies have been reported.
Insulin receptors (INSR) are widely distributed in human eye tissues, including the retina, choroid, and sclera [
16]. The signal transduction of insulin receptors mainly goes through two pathways, the PI3K pathway and the MAPK pathway [
17]. Among them, the PI3K/AKT/mTOR pathway plays an important role in cellular sugar uptake, glycogen synthesis, protein synthesis, and cell survival [
18]. Insulin binds to INSR, phosphorylates INSR substrate protein, triggers PI3K to activate AKT, activates mTOR through the TSC pathway, initiates cell growth regulation, and releases downstream MMP-2/TGF-β2 and other cytokines, which are involved in the regulation of eye growth [
19]. However, whether insulin can regulate the biological behavior of RPE cells through this pathway in the eye, thereby regulating the growth of the eyeball, has not yet been reported.
Herein, we will investigate the mechanism of insulin in the occurrence and development of PM in RPE cells.
Methods
Cell culture
The ARPE-19 cells (ATCC, USA) were cultured in DMEM with 10 % fetal bovine serum (Gibco, USA) in a 37 °C incubator with 5 % CO2. The cells were cultured in serum-free DMEM for 24 h before treated with insulin. 0.1 µg/mL and 1 µg/mL concentrations of insulin were used to treat the ARPE-19 cells for 24 or 72 h in the study. 0 µg/mL of insulin stands for the blank control.
CCK-8 assay
A CCK-8 kit (Cell Counting Kit-8, Beyotime, China) was used to detect ARPE-19 cell viability (with or without insulin treatment at the concentration of 0.1 or 1 µg/mL). Cells in the logarithmic growth phase were seeded into 96-well plates at a density of 5 × 104/well and cultured overnight. At the time point of 72 h, 10 µL CCK-8 reagent was added to each well, and cells incubated for another 1 h. The absorbance of cells at 450 nm was measured using a microplate reader.
Transmission electron microscopy
ARPE-19 cell suspensions at the concentration of 1×106 were centrifuged at 200×g for 10 min, and then fixed with 3 % glutaraldehyde for 2 h at 4 °C and postfixed with 1 % osmium tetroxide (OsO4) for another 2 h at 4 °C. After that, the cells were dehydrated with ethyl alcohol series for 15 min and embedded in Epon. Ultrathin sections (60–70 nm) were stained with uranyl acetate for 8 min and lead citrate for 5 min. The ultrastructure of ARPE-19 cells was viewed using a transmission electron microscope (HD-2700, Hitachi, Japan). Images were captured from three different fields at a magnification of 6800×.
Western blotting
The APRE-19 cells were washed 3 times with PBS and then lysed with radio immune precipitation (RIPA) buffer. The total protein was extracted in RIPA buffer, separated on polyacrylamide gels, and then immobilized on polyvinylidene fluoride (PVDF) membrane. Following blocking with 5 % non-fat milk at room temperature for 1.5 h, the PVDF membranes were incubated with primary antibodies against insulin receptor β, p-AKT, AKT, p-mTOR, mTOR, and β-actin for 12 h at 4 °C environments. The primary antibodies were purchased from Abcam and used at 1:1000 dilution. Then the PVDF membrane was washed 3 times with PBST. Subsequently, the membrane was incubated with a horseradish peroxidase-conjugated secondary antibody at a dilution of 1:5000 in a shaker at room temperature for 1 h. Finally, the ECL kit was used to process the membrane for the color reaction. The quantitative western blot results were normalized to the results of β-actin.
RT-qPCR assay
Total RNA was extracted using Trizol reagent (Invitrogen, UK). The purity and concertation of extracted RNA were determined by the NanoDrop TM ND-1000 (Thermo Fisher Scientific, USA). Prime Script TM RT reagent Kit was used to prepare cDNA (Takara, Japan). RT-qPCR was performed using the SYBR Green PCR master mix (Takara, Japan). The RT-qPCR amplification was performed in triplicate, the expression of RNA was calculated using the 2-ΔΔCt method [
20]. GAPDH expression was used as the internal control, allowing comparison of mRNA levels. Primers used in our study are listed in Table
1.
Table 1
List of primers used in reverse transcription-quantitative PCR
TIMP-2-F | ACTGCAGGA TGGACTCTTGCA |
TIMP-2-R | TTTCAGAGCCTTGGAGGAGCT |
MMP-2–F | CCACTGCCTTCGATACAC |
MMP-2-R | GAGCCACTCTCTGGAATCTTAAA |
b-FGF-F | ACCCCGACGGCCGA |
b-FGF-R | TCTTCTGCTTGAAGTTGTAGCTTGA |
IGF-1-F | TGTGTGGAGACAGGGGCTTT |
IGF-1-R | TTGGCAGGCTTGAGGGGT |
GAPDH-F | ACGGCAAGTTCAACGGCACAG |
GAPDH-R | GAAGACGCCAGTAGACTCCACGAC |
ELISA
Cells treated with or without insulin or LY294002 were seeded into 6-well plates. After incubation for 48 h, the protein levels of TIMP-1, MMP2, bFGF, and IGF-1 were detected in cell supernatants using an ELISA kit (Thermo Fisher Scientific, USA), according to the manufacturer’s protocol. In brief, the diluted samples were added to the monoclonal antibody-coated well plate. After incubation for 2 h at 37 °C, the plate was washed, and an enzyme-labeled antibody was added to each well except the blank wells. After further incubation for 1 h at 37 °C, the plate was washed 5 times. After patting dry, each well was added with color developer A and B. Color reaction was stopped after 15 min with the stop solution. The absorbance was measured at 450 nm with a multimode microplate reader (Thermo, MK-3).
Statistical analysis
The data analysis was performed mainly using Graphpad Prism version 8.0 statistical software. All experiments were conducted at least three times. All data were presented as means ± standard deviations (SD). Student’s t-test or one-way analysis of variance (ANOVA) was performed to calculate the statistical differences. P < 0.05 was considered to indicate significance. Image J was used to carry out the semiquantitative analysis after the western blotting experiments.
Discussion
RPE cells are the main source of many growth factors and cytokines, including insulin-like growth factor-1 (IGF-1), transforming growth factor-β (TGF-β), and basic fibroblast growth factor (bFGF). They are locally synthesized and subsequently secreted, and play important roles in maintaining the structure and homeostasis of the retina and choroid [
6,
22]. Among the various cytokines secreted by RPE cells, TGF-β2 is a multifunctional cytokine that regulates cell growth and differentiation [
23]. It is one of the key signal molecules that regulate the growth of the eyeball [
24]. It can promote the proliferation of scleral cells and regulate the synthesis and degradation of the scleral extracellular matrix (ECM) [
25]. Also, our previous study has proved that TGF-β2 is a myopic signal factor in RPE cells. Besides, we have validated that insulin can promote the proliferation of RPE cells and the secretion of TGF-β2 in RPE cells for signal transmission and promote the occurrence of myopia [
26]. In our present study, the other two growth factors, IGF-1 and bFGF were studied. We found that insulin positively activated the proliferation of RPE cells, significantly promoted the secretion of IGF-1, and reduced the secretion of bFGF in ARPE-19 cells. As the insulin concentration increased and the action time was prolonged, the effect became more obvious. Our results proved that the myopia-promoting effect of insulin was likely to be through affecting RPE cells, promoting the increase of the secondary myopia signal molecule (TGF-β2, IGF-1, bFGF) secreted by RPE cells, and then acting on choroidal sclera and other downstream tissues, causing eye axis growth, and eventually promoting the occurrence of myopia.
The expression of MMP-2 (matrix metalloproteinases 2) and TIMP-2 (tissue inhibitors of metalloproteinase 2) were also detected in this study. MMP-2, which is a kind of zinc-dependent protease, can degrade the extracellular matrix of the sclera and mediate scleral remodeling in experimental myopia [
27]. TIMPs are a group of endogenous inhibitors of MMPs, regulating the proteolytic activity of MMPs [
28]. Pieces of evidence from myopic animal models (e.g. chicken and guinea pig) have shown an elevation of MMP-2 protein and mRNA levels in the sclera of myopic eyes, and a reduction of TIMP-2 expression [
29,
30]. In our study, insulin significantly promoted MMP-2 mRNA and protein expression levels and decreased the mRNA and protein levels of TIMP-2 in ARPE-19 cells. As the insulin concentration increased and the action time was prolonged, the effect became more obvious. Our results were assistant with previous studies.
At the same time, we detected a high expression of the insulin receptor (INSR) after insulin stimulation in ARPE-19 cells. The insulin activates a complex intracellular signaling network through INSR and the classic PI3K and ERK cascade. However, in many cases, MAPK does not seem to be necessary for the insulin-mediated signaling pathway [
31,
32]. Based on the results of previous experiments that the MAPK inhibitor PD98059 failed to cause significant changes with insulin treatment, the PI3K pathway was chosen in this study [
33]. We found that the insulin receptor activated the phosphorylation of AKT and mTOR after insulin stimulation, and this effect was restored by the PI3K inhibitor LY294002. Besides, the expression levels of myopia-related factors were also restored by LY294002. The results showed that after stimulating the insulin receptor, insulin acted on RPE cells through the PI3K/AKT/mTOR signaling pathway.
We also observed the ultrastructure changes in the ARPE-19 cells after insulin treatment. In the process of cell degeneration and necrosis, the granular endoplasmic reticulum generally expands [
34]. The lighter and limited expansion can only be seen under the electron microscope, and the severe expansion can be manifested under the optical microscope as vacuole formation. Besides, it has been reported that the endoplasmic reticulum vesiculation and expansion can lead to ER stress-induced apoptosis [
21]. After 24 h of insulin treatment, expansion and vesiculation in the endoplasmic reticulum were observed in our experiment, suggesting increased secretion of cytokines and degeneration in ARPE-19 cells.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit
http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.