Introduction
Cardiomyopathies are defined as a heterogeneous group of pathological conditions stemming from the myocardium's electrical and/or mechanical dysfunction [1]. These disorders can be categorized into primary cardiomyopathies which are due to genetics, acquired or mixed factors and solely affect the heart, and secondary cardiomyopathies which result from a systemic illness and impact several parts of the body causing different manifestations including hypertrophic (HCM), dilated (DCM) and restrictive (RCM) and arrhythmogenic right ventricular cardiomyopathy (ARVC) [1, 2]. Hypertrophic cardiomyopathy (HCM) is the most prevalent genetic myocardial disease caused by left ventricular hypertrophy which can cause exertional dyspnea, presyncope, atypical chest pain, heart failure, and sudden cardiac death [3]. Dilated cardiomyopathy (DCM) can be either genetic or acquired heart disease, characterized by left ventricular dilation and systolic dysfunction. DCM typically manifests symptoms of heart failure with reduced ejection fraction and in severe cases requires cardiac transplantation [1, 3]. However, restrictive cardiomyopathy (RCM) is less frequent and commonly associated with impaired ventricular filling with biatrial enlargement but with normal or decreased diastolic volume in one or both ventricles [4].
After the identification of pathogenic variants in the myosin heavy chain 7 (MYH7) gene and the cardiac alpha-actin (ACTC1) gene in developing HCM and DCM, respectively, over 100 genes have been reported to cause cardiomyopathies [3]. For instance, it has been found that mutations in genes, such as CSRP3 (MLP protein), TTN (titin protein), and TCAP (telethonin protein) encode several Z-disc proteins of the cardiac sarcomere can lead to several cardiac dysfunctions [5, 6]. TCAP-encoded telethonin is a genetic determinant that implicates the pathogenesis of both DCM and HCM which is required for the structural organization of sarcomere assembly and acting as a stretch sensor, regulates the sarcomere length [3, 7]. Therefore, molecular studies on Z-discs mutations showed that pathogenic variants disturbing the function of the telethonin protein can lead to cardiac complications and severe myocyte hypertrophy [6, 8]. Of interest is that a group of HCM-associated TCAP mutations increases binding to other cardiac proteins, such as titin/connectin and calsarcin-1. These variants augment the interaction of TCAP with titin and CS-1 in the Z-disc. This augmentation may employ an increased passive tension which might lead to elevated calcium sensitivity in muscle contraction at the constant length of muscle fiber [9]. On the other hand, any disturbance in proteins that closely interact with telethonin (TCAP) may derange the myocardium function. For instance, the telethonin (TCAP) was found to bind to a cell surface protein BMP10 at the stretch-sensing Z disc of cardiomyocytes. TCAP partially regulates prohypertrophic BMP10, thereby pathogenic variants in the BMP10 gene deter binding to TCAP and increase dilated cardiomyopathy occurrence [10]. Some patients harbored pathogenic mutations of MLP/TCAP-HCM that phenotypically resemble myofilament-HCM and experience more severe conditions than the subset of patients who remain without a disease-causing mutation [5]. Similarly, DCM-associated MLP mutations reduce binding to TCAP/telethonin and actinin proteins whereas DCM-associated alpha-actinin-2 mutation reduces binding to MLP. These observations indicate that changed interaction in Z-disc components triggers cardiomyopathy, more specifically reduced binding interaction might cause loose sarcomere and decrease the stretch response of cardiomyocytes, while increased binding and stiff sarcomere, may become highly susceptible to the hypertrophic response of cardiomyocytes against stretch [11].
Anzeige
In this study, we investigate the frequency, clinical phenotypes, and spectrum of TCAP genetic variants in a cohort of hypertrophic cardiomyopathy (HCM) and dilated cardiomyopathy (DCM) patients referring to our tertiary center in Tehran. The disease-causing effects and functional consequences of the variants in the M-domain of the Titin protein were also determined using prediction analysis.
Materials and methods
Sample collection
A total number of 74 patients diagnosed with hypertrophic (HCM) and dilated (DCM) cardiomyopathies were registered in the cohort of this study, these patients were referred to our center between 1959 and 2018. Informed consent was obtained from all of the patients. Clinical data were documented from the medical records and provided questionnaires. The given questionnaires thoroughly assembled the information regarding the clinical presentations, other diseases, syndromes, and environmental factors of each patient. The local ethics committee of the Cardiovascular, Medical Research Center approved the research protocol by protocol number (no IR.IUMS.REC.1399.157).
Clinical evaluations
Medical evaluations were performed and family histories were recorded for further analysis. From the cohort of this study, 40 patients were selected for genetic testing from whom 20 individuals were diagnosed with HCM (7 females and 13 males), and the other 20 patients were diagnosed with DCM (10 females and 10 males). Clinical presentations in most cases include hypertension, palpitation, dyspnea, syncope, fatigue, and high blood lipid, even though a handful of patients presented cardiac and abdominal edema, ischemia, kidney, and chest pain, muscular complications, and liver disorder. The diagnosis of HCM and DCM in all the patients of this study were confirmed by specialized physicians and the findings of medical testing were Echocardiography (ECG), Magnetic Resonance Imaging (MRI), two-dimensional echocardiography, and necessary clinical laboratory tests.
Molecular analysis
5 ml of peripheral blood sample was obtained from each patient for genetic analysis. Genomic DNA was extracted based on the salting-out procedure. Primers were designed for coding regions which include exon and exon-intronic boundaries of the TCAP gene (NM_003673) (Table 1), and the coding regions were amplified by a SimpliAmp™ Thermal Cycler.
Table 1
Reverse and forward primers used in this study for PCR procedure
Exon No. | Primer sequences 5′ to 3′ direction | Primer length | Product length | GC% | TM(˚c) |
---|---|---|---|---|---|
1 Forward | ACTTATAGCATCTGACACCAGAGG | 24 bp | 956 | 45.8 | 69.6 |
1 Reverse | AAATTTCTCCAGGGCTTCATG | 21 bp | 956 | 42.9 | 72.1 |
2 Forward | TGAAGCCCTGGAGAAATTTCTG | 22 bp | 956 | 45.5 | 74.1 |
2 Reverse | GCAAACTACAAAGCAGCCATG | 20 bp | 956 | 47.6 | 72.2 |
Anzeige
Then, PCR was performed in a volume of 50 μL reagents on the following condition: 200 ng DNA, 1.5–2 mmol/L MgCl2, 10.5 μL primers (Forward and Reverse primers), 200 mmol/L dNTP, and 1 U of Taq DNA polymerase. The PCR thermal program was initial denaturation for 5 min at 95 °C and 30 cycles for denaturation at 95 °C (30 s), annealing at 58 °C (30 s), extension at 72 °C (30 s), and final extension at 72 °C (10 min). Direct sequencing was implemented with the BigDye Terminator DNA sequencing kit and Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). Segregation analysis was performed for the families who had a novel variant.
In Silico analysis
Pathogenicity and clinical significance of TCAP gene variants were analyzed using bioinformatic predicting software, such as MutationTaster, Provean, SIFT, and CADD [12‐15]. Nucleotide and protein change, zygosity, and the main clinical manifestations and symptoms were included in the investigation in Tables 1 and 2.
Table 2
General information and clinical presentations of the cohort participated in this study
Patient No. | Sex | Age | symptom | Final results of Echocardiogram (ECG) | |||||||
---|---|---|---|---|---|---|---|---|---|---|---|
IVSD (cm) | PWd (cm) | LVIDs (cm) | LVIDd (cm) | LVEF (%) | LAD (cm) | LVOTO ± | SAM ± | ||||
1 | F | 60 | Hypertension/palpitations | 2.1 | 1 | 2.8 | 4.4 | 60 | 4 | – | – |
2 | F | 32 | Palpitations/dyspnea/fatigue/chest pain/syncope/anemia | 1.1 | 0.9 | – | 4.4 | 40–45 | – | – | – |
3 | M | 16 | Palpitations/dyspnea/fatigue/chest pain/gastrointestinal disorder/high cholesterol/allergy | 3.2 | 0.9 | 3.45 | 4.29 | 60 | 3 | – | + |
4 | M | 58 | Chest pain/hypertension/high cholesterol/muscular pain | 1.6 | 0.86 | 3.9 | 5.3 | 20 | 4.5 | N/A | N/A |
5 | F | 43 | Palpitations/dyspnea/abdominal edema/ischemia | 1.5 | 0.91 | 3.52 | 4.65 | 15–20 | 5.2 | – | – |
6 | M | 8 | Hypertension/palpitations | 2.2 | 1 | 2.6 | 4.4 | 40–45 | 4.1 | – | – |
7 | F | 28 | Fatigue/palpitations/hypertension | 2.2 | N/A | N/A | N/A | 45 | N/A | N/A | – |
8 | F | 30 | Hypertension/dyspnea/fatigue | 1.8 | 0.7 | 2.5 | 4.3 | 45–50 | 3.1 | N/A | – |
9 | M | 26 | Chest pain/dyspnea | 0.9 | 0.8 | 5.8 | 6.8 | 10 | 4.1 | – | – |
10 | F | 7 | Musculoskeletal disorder/Infectious disease | N/A | N/A | N/A | N/A | 10–15 | N/A | N/A | N/A |
11 | F | 10 | Dyspnea/palpitations/kidney problem | N/A | N/A | 5.6 | 6.2 | 10 | N/A | N/A | N/A |
12 | M | 37 | Cardiovascular disease/respiratory disease | 0.8 | 0.8 | 5.8 | 6.4 | 10 | N/A | N/A | N/A |
13 | M | 24 | Hypertension/high blood lipid/high triglyceride/fatigue/palpitations/dyspnea/fainting | 0.9 | 0.9 | 6.1 | 7.7 | 15 | 4.7 | N/A | N/A |
14 | M | 2 | Dyspnea/fatigue/chest pain/hypertension/liver disease/cardiac edema | 1.5 | N/A | N/A | N/A | 55 | N/A | N/A | N/A |
Data extraction
For extracting the necessary information associated with each article, a checklist was used to cover the mutation, mutation type, article title, first author's name, year of publication, ethnicity, sample size (total, men, and women), and the rate of consanguineous marriages.
Genetic variant distribution
The variant position in protein was determined based on UniProtKB/SwissProt—O15273 and also using NM_003673. The Human Gene Mutation Database (HGMD) and reference SNP ID (rsID) for the variants were examined using the databases MutationTaster (https://mutationtaster.org/) and Varsome (https://varsome.com/), and if required, they were corrected. In addition, variants that were reported as pathogenic or likely pathogenic in ClinVar, but were not available in the literature were included in this study. Thereafter, the reported variants were divided into six types including missense, nonsense, deletion, insertion, intronic, and duplication.
Results
Clinical features
Of the 40 patients in this study, half of them were diagnosed with HCM (10 females and 10 males) and the other half with DCM (13 males and 7 females). According to the statistical findings, the prevalence of DCM in this population is higher among males than females. The cohort is classified into three main age groups; children and youngsters (< 20), adults (40–20), middle-aged, and elderly (> 40). Medical history revealed that the symptoms started to manifest mostly in adulthood (44%) and middle-aged (35%) and a minority in childhood and youth (21%). On clinical examination, 7.69% of the patients with familial cardiomyopathy were shown to be asymptomatic whereas other patients had the most common presentations of hypertrophic or dilated cardiomyopathy, including hypertension, dyspnea, fatigue, chest pain, and palpitations (Fig. 1). Less common manifestations were recorded as fatigue, dizziness, and syncope. In addition, a few patients suffered from related severe conditions of myocardial infarction (7%,) and ischemic (3%). Some of the patients had received medical treatments which includes undergoing cardiac transplantation or ICD (32%) and angiography operation (10%). Several patients exhibited other complications, such as high cholesterol (24%), high blood pressure (19%), diabetes, and high blood sugar (8%). Considering environmental factors, some patients engaged in actions aggravating their conditions, such as smoking tobacco and consuming alcohol (17.56%) and being obese (2.7%). Only 16.21% of patients had daily physical activities. The clinical phenotypes and medical records of the patients are summarized in Table 2.
×
Family history
By examining the information extracted from the questionnaires and genetic counseling of the patients, 12% of them were the only ones affected with cardiomyopathy in their family, while the rest of the cohort exhibited family histories of cardiomyopathy that involved 1 to 10 family members with heart disease and other related disorders. Several affected families (59% of patients’ families) showed cardiomyopathy transmission through up to three consecutive generations.
Following cardiac disorders, the second and third most commonly reported diseases among the family members of these patients were cancer (20%) and stroke (14%).
Anzeige
Genetic analysis and bioinformatics findings
Our genetic analysis of the TCAP gene in the studied cohort revealed one novel intronic variant of c.111-42G > A in intron 1 of an HCM patient (No. 13). In silico analysis tools including MutationTaster, and CADD predicted this variant to be considered as polymorphism. In addition, Varsome considered this variant to have uncertain significance. The electropherogram (sequencing result) of the polymorphism variant and the pedigree of the patient are shown in Fig. 2.
×
As for other detected variants, 80% of DCM patients (accounted 18 out of 20) were found to possess previously reported variants of cDNA Level: NM_003673.3(TCAP): c.453A > C, gDNA Level: g.39666058A > C, Protein Level: (p.Ala151 =)(A151 =) whereas no mutation was detected in the remaining patients (20%). Furthermore, 70% of HCM patients (accounted 14 out of 20) were identified to have c.453A > C as well as two other patients with reported mutations including cDNA level: NM_003673.4(TCAP):c.316C > T, gDNA level: g.39665921C > T, protein level: (p.Arg106Cys)(R106C) and cDNA level: NM_003673.4(TCAP):c.110 + 48C > T gDNA level: g.39665517C > T. All the variants detected in this study’s cohort are shown on the TCAP gene depicted in Tables 3 and 4.
Table 3
Variants detected in DCM patients who participated in our study and in-silico prediction for each mutation
No. | Patient No | Nucleotide change | Amino Acid Change | Location | Zygosity | rs | Varsome | MutationTaster | Provean | SIFT | CADD | References |
---|---|---|---|---|---|---|---|---|---|---|---|---|
1 | DCM1 | No mutation found | – | – | – | – | – | – | – | – | – | – |
2 | DCM2 | c.453A > C | p.Ala151 = | Exon 2 | Homo | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [16] |
3 | DCM3 | No mutation found | – | – | – | – | – | – | – | – | – | – |
4 | DCM4 | c.453A > C | p.Ala151 = | Exon 2 | Homo | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [16] |
5 | DCM5 | c.453A > C | p.Ala151 = | Exon 2 | Het | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [16] |
6 | DCM6 | No mutation found | – | – | – | – | – | – | – | – | – | – |
7 | DCM7 | c.453A > C | p.Ala151 = | Exon 2 | Homo | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [16] |
8 | DCM8 | c.453A > C | p.Ala151 = | Exon 2 | Homo | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [16] |
9 | DCM9 | c.453A > C | p.Ala151 = | Exon 2 | Homo | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [16] |
10 | DCM10 | c.453A > C | p.Ala151 = | Exon 2 | Homo | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [16] |
11 | DCM11 | c.453A > C | p.Ala151 = | Exon 2 | Homo | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [16] |
12 | DCM12 | c.453A > C | p.Ala151 = | Exon 2 | Homo | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [16] |
13 | DCM13 | c.453A > C | p.Ala151 = | Exon 2 | Homo | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [16] |
14 | DCM14 | c.453A > C | p.Ala151 = | Exon 2 | Homo | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [16] |
15 | DCM15 | c.453A > C | p.Ala151 = | Exon 2 | Homo | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [16] |
16 | DCM16 | c.453A > C | p.Ala151 = | Exon 2 | Homo | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [16] |
17 | DCM17 | c.453A > C | p.Ala151 = | Exon 2 | Homo | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [16] |
18 | DCM18 | No mutation found | – | – | – | – | – | – | – | – | – | – |
19 | DCM19 | No mutation found | – | – | – | – | – | – | – | – | – | – |
20 | DCM20 | No mutation found | – | – | – | – | – | – | – | – | – | – |
Table 4
Variants found in HCM patients who participated in our study and in-silico prediction for each mutation
No. | Patient No. | Nucleotide change | Amino Acid Change | Location | Zygosity | rs | Varsome | MutationTaster | Provean | SIFT | CADD | References |
---|---|---|---|---|---|---|---|---|---|---|---|---|
1 | HCM1 | c.453A > C | p.Ala151 = | Exon 2 | Het | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [16] |
2 | HCM2 | c.316C > T | p.Arg106Cys | Exon 1 | Het | rs45578741 | Benign | polymorphism | Deleterious | Damaging | 28.8 | [17] |
c.453A > C | p.Ala151 = | Exon 2 | Het | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [16] | ||
3 | HCM3 | No mutation found | – | – | – | – | – | – | – | – | – | – |
4 | HCM4 | No mutation found | – | – | – | – | – | – | – | – | – | – |
5 | HCM5 | c.453A > C | p.Ala151 = | Exon 2 | Het | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [16] |
6 | HCM6 | c.453A > C | p.Ala151 = | Exon 2 | Homo | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [18] |
7 | HCM7 | c.453A > C | p.Ala151 = | Exon 2 | Het | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [18] |
8 | HCM8 | c.453A > C | p.Ala151 = | Exon 2 | Homo | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [18] |
c.110 + 48C > T | – | Intron 1 | Het | rs2941510 | Benign | polymorphism | – | – | 6.243 | [18] | ||
9 | HCM9 | No mutation found | – | – | – | – | – | – | – | – | – | – |
10 | HCM10 | c.453A > C | p.Ala151 = | Exon 2 | Homo | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [16] |
11 | HCM11 | c.453A > C | p.Ala151 = | Exon 2 | Homo | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [16] |
12 | HCM12 | No mutation found | – | – | – | – | – | – | – | – | – | – |
13 | HCM13 | c.453A > C | p.Ala151 = | Exon 2 | Homo | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [16] |
c.111–42G > A | – | Intron 1 | Homo | – | Uncertain Significance | polymorphism | – | – | 3.473 | This study | ||
14 | HCM14 | c.453A > C | p.Ala151 = | Exon 2 | Homo | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [16] |
15 | HCM15 | c.453A > C | p.Ala151 = | Exon 2 | Homo | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [16] |
16 | HCM16 | c.453A > C | p.Ala151 = | Exon 2 | Het | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [16] |
17 | HCM17 | c.453A > C | p.Ala151 = | Exon 2 | Het | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [16] |
18 | HCM18 | c.453A > C | p.Ala151 = | Exon 2 | Het | rs1053651 | Benign | polymorphism | Neutral | Tolerated | 10.92 | [16] |
19 | HCM19 | No mutation found | – | – | – | – | – | – | – | – | – | – |
20 | HCM20 | No mutation found | – | – | – | – | – | – | – | – | – | – |
Genetic variant distribution and genotype
Variants associated with the TCAP gene in HGMD and Clinvar were extracted that have been identified thus far. A total of 44 reported mutations were included in Table 5. The three most common variants found to be missense, deletion, and nonsense make up 35% (15 alleles), 21% (10 alleles), and 21% (9 alleles) of the total variants (Fig. 3).
Table 5
List of variants of TCAP gene reported in Literature and databases
No. | DNA Change | AA Change | Variant Type | Location | RS |
---|---|---|---|---|---|
1 | c.-178G > T | Splicing | 5' UTR | rs931992 | |
2 | c.32C > A | p.Ser11Ter | Nonsense | Exon 1 | rs45495192 |
3 | c.453A > C | p.Ala151 = | Synonymous | Exon 2 | rs1053651 |
4 | c.53G > A | p.Arg18Gln | Missense | Exon 1 | rs45614536 |
5 | c.145G > A | p.Glu49Lys | Missense | Exon 2 | rs45513698 |
6 | c.421C > G | p.Pro141Ala | Missense | Exon 2 | rs45509691 |
7 | c.75G > A | p.Trp25Ter | Nonsense | Exon 1 | rs778851652 |
8 | c.157C > T | p.Gln53Ter | Nonsense | Exon 2 | rs104894655 |
9 | c.637–640delGG | Deletion | Exon 2 | – | |
10 | c.172C > T | p.Gln58Ter | Nonsense | Exon 2 | – |
11 | c.37–39delGAG | p.Glu13del | Deletion | Exon 1 | – |
12 | c.208C > T | p.Arg70Trp | Missense | Exon 2 | rs775636212 |
13 | c.269C > T | p.Pro90Leu | Missense | Exon 2 | rs727504427 |
14 | c. 226C > T | p.Arg76Cys | Missense | Exon 2 | rs572836774 |
15 | c.244C > T | p.Gln82Ter | Nonsense | Exon 2 | – |
16 | c.255C > A | p.Tyr85Ter | Nonsense | Exon 2 | – |
17 | c.316C > T | p.Arg106Cys | Missense | Exon 2 | rs45578741 |
18 | c.388C > T | p.Arg130Cys | Missense | Exon 2 | rs374886575 |
19 | c.472C > A | p.Arg158Ser | Missense | Exon 2 | rs397516863 |
20 | c.493C > G | p.Gln165Glu | Missense | Exon 2 | rs397516865 |
21 | c.410C > T | p.Thr137Ile | Missense | Exon 2 | rs773317399 |
22 | c.458G > A | p.Arg153His | Missense | Exon 2 | rs149585781 |
23 | c.395A > C | p.Glu132Gln | Missense | Exon 2 | – |
24 | c.472C > T | p.Arg158Cys | Missense | Exon 2 | rs397516863 |
25 | c.90–91del | p.Ser31HisfsX11 | Deletion | Exon 1 | rs1555606976 |
26 | c.26–33dupAGGTGTCG | p.Arg12fsX31 | Duplication | Exon 1 | rs778568339 |
27 | c.45–46delTG | p.Cys15Ter | Deletion | Exon 1 | – |
28 | c.100delC | p.Glu35Argfs*33 | Deletion | Exon 1 | – |
29 | c.166insG | p.Gln56Argfs*52 | Insertion | Exon 2 | – |
30 | c.496–499delAGAG | p.Arg166AlafsTer21 | Deletion | Exon 2 | – |
31 | c.171C > G | p.Cys57Trp | Missense | Exon 2 | rs369447207 |
32 | c.109–110delGG | p.Gly37Leufs | Deletion | Exon 1 | – |
33 | c.110 + 5G > A | Intronic | Intron 1 | – | |
34 | c.25–31dup | p.Ser11Ter | Duplication | Exon 1 | rs863224933 |
35 | c.66G > A | p.Trp22Ter | Nonsense | Exon 1 | rs141019458 |
36 | c.*76G > T | Splicing | 3’UTR | rs45506294 | |
37 | c.34dup | p.Glu12fs | Duplication | Exon 1 | rs1555606959 |
48 | c.43–49dup | p.Arg17delinsLeuTer | Duplication | Exon 1 | rs886044421 |
39 | c.103G > T | p.Glu35Ter | Nonsense | Exon 1 | rs779699520 |
40 | c.110_110 + 1del | Deletion | Exon 1 | rs786205076 | |
41 | c.136_137del | p.Gln46Glufs*3 | Deletion | Exon 2 | rs2057249899 |
42 | c.166C > T | p.Gln56Ter | Nonsense | Exon 2 | – |
43 | c.110 + 1G > A | Intronic | Intron 1 | – | |
44 | c.14–15del | p.Glu5fs | Deletion | Exon 1 | – |
×
The affected patients presented with diseases including limb girdle muscular dystrophy 2G (LGMD-2G), dilated and hypertrophic cardiomyopathy (DCM and HCM), intestinal pseudo-obstruction, and telethonin deficiency (Table 5). However, the majority of patients were clinically diagnosed with LGMD-2G (47%) and HCM (29%) (Fig. 3). LGMG-2G patients suffered mostly from symptoms, such as scapular winging, contractures, and distal and proximal limb weakness (Table 6). A great number of HCM patients were found to have missense mutations, while LGMG-2G ones showed a high amount of nonsense variants.
Table 6
First reported cases due to TCAP genotypes and clinical presentations
Genotype | Protein change | Zygosity | Patient no. | Family | Phenotype | Consanguinity | Ethnicity | Sex | Age on onset | HT | DT | SW | CT | FW | CD | Proximal Limb’s weakness | distal Limb’s weakness | Other clinical presentations | References |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
c.32C > A/c.–178G > T/c.453A > C | p.Ser11Ter/-/p.Ala151 = | Homo/Hetero/Hetero | 1 | 1 | LGMD-2G | Yes | Indian | M | 2 y | + calves | ND | + | + ankle | + | ND | ND | ND | mild foot drop, progressive pectoral girdle | [19] |
c.32C > A/c.–178G > T/c.453A > C | p.Ser11Ter/-/p.Ala151 = | Homo/homo/homo | 1 | 1 | LGMD-2G | Yes | Indian | F | 8 y | + calves | ND | + | + ankle | + | ND | ND | ND | Wheelchair-bound state, mild foot drop, progressive pectoral girdle | [19] |
c.32C > A/c.–178G > T/c.453A > C | p.Ser11Ter/-/p.Ala151 = | Homo/homo/homo | 1 | 1 | LGMD-2G | Yes | Indian | F | 8 y | + calves | ND | + | + ankle | + | ND | ND | ND | Ambulant, mild foot drop, progressive pectoral girdle | [19] |
c.1630G > A | p.Arg18Gln | Hetero | 1 | 2 | IDC | ND | Caucasian | ND | ND | ND | ND | ND | ND | ND | + | ND | ND | [20] | |
c.1968G > A | p.Glu49Lys | Hetero | 1 | 3 | IDC | ND | Caucasian | ND | ND | ND | ND | ND | ND | ND | + | ND | ND | [20] | |
c.2244C > G | p.Pro141Ala | Hetero | 1 | 4 | IDC | ND | Caucasian | ND | ND | ND | ND | ND | ND | ND | + | ND | ND | [20] | |
c.75G > A | p.Trp25Ter | Homo | 1 | 5 | LGMD-2G | ND | Moldavian | F | 15 y | + calves | ND | ND | ND | ND | ND | + the lower extremities | + anterior compartment of legs | mild weakness in shoulder girdle muscles | [21] |
c.157C > T | p.Gln53Ter | Homo | 2 | 6 | LGMD-2G | ND | Brazilian | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | [22] |
c.637–640delGG/c.157C > T | -/p.Gln53Ter | Com Hetero | 1 | 7 | LGMD-2G | ND | Brazilian | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | [22] |
c.172C > T | p.Gln58X | Homo | 1 | 8 | telethonin deficiency | No | French | M | 9 m | ND | ND | + | + the Achilles’ tendons | ND | ND | + | ND | delayed motor milestones, waddling gait, mild hyperlordosis, mild upper limb distal joint hyperlaxity, Gower’s maneuver | [23] |
c.37–39delGAG | p.Glu13del | Homo | 1 | 9 | HCM | No | Caucasian | M | 47 y | ND | ND | ND | ND | ND | ND | ND | ND | Dyspnea, (pre)syncope | [6] |
c.37–39delGAG | p.Glu13del | Homo | 1 | 10 | HCM | No | Caucasian | M | 37 y | ND | ND | ND | ND | ND | + | ND | ND | Angina, dyspnea, sudden cardiac death | [6] |
c.208C > T | p.R70W | Homo | 1 | 11 | HCM | No | Caucasian | F | 44 y | ND | ND | ND | ND | ND | + | ND | ND | Asymptomatic, Dyspnea, Atrial fibrillation | [6] |
c.269C > T | p.P90L | Homo | 1 | 12 | HCM | No | Caucasian | F | 26 y | ND | ND | ND | ND | ND | + | ND | ND | Angina, dyspnea, presyncope, Atrial fibrillation | [6] |
c. 226C > T | p.Arg76Cys | Hetero | 1 | 13 | Intestinal pseudo-obstruction | ND | Italian | M | 42 y | ND | ND | ND | ND | ND | ND | ND | intestinal pseudo-obstruction, delayed small bowel and colon transit | [24] | |
c.244C > T | p.Gln82X | Homo | 1 | 14 | LGMD-2G | No | Indian | M | 8 y | ND | + Thigh, calf muscles, gluteal | + | + asymmetric Achilles tendon, bilateral elbow flexion, hip and ankle joints | + | + Especially lower | + | toe-walking, frequent fall, a wide-based gait with lumbar hyperlordosis, wheelchair bound, distal phalanx flexion weakness, a few episodes of chocking | [25] | |
c.255C > A | p.Tyr85* | Homo | 1 | 15 | LGMD-2G | Yes | Spanish | 2 y | ND | + Thighs, the tibialis anterior muscles | + | + symmetric Achilles tendon, patellar | ND | + | + | toe walking, frequent fall, asymmetric calves, Gowers’ maneuver | [26] | ||
c.316C > T | p.Arg106Cys | Hetero | 2 | 16 | HCM | No | Danish | ND | 30–32 y | ND | ND | ND | ND | ND | + | ND | ND | apical hypertrophy | [17] |
c.* + 76G > T | Homo | 1 | 17 | HCM | No | Danish | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | [17] | ||
c.388C > T | p.R130C | Homo | 1 | 18 | DCM | ND | British | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | [27] | |
c.472C > A | p.R158S | Homo | 1 | 19 | DCM | ND | British | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | [27] | |
c.493C > G | p.Q165E | Homo | 1 | 20 | DCM | ND | British | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | [27] | |
c.410C > T | p.Thr137Ile | Hetero | 1 | 21 | HCM | No | Japanese | F | 29 y | ND | ND | ND | ND | ND | + | ND | ND | [10] | |
c.458G > A | p.R153H | Homo | 1 | 22 | HCM | No | Japanese | M | 48 y | ND | ND | ND | ND | ND | + | ND | ND | [10] | |
c.395A > C | p.E132Q | Hetero | 1 | 23 | DCM | No | Korean | M | 34 y | ND | ND | ND | ND | ND | + | ND | ND | heart failure | [10] |
c.472C > A | p.Arg158Ser | Homo | 1 | 24 | DCM | No | Finnish | ND | ND | ND | ND | ND | ND | ND | + | ND | ND | LV systolic dysfunction, hypertensive heart disease, primary valve disease, coronary artery disease | [28] |
c.472C > T | p.R158C | Homo | 1 | 25 | DCM | ND | Canadian | ND | ND | ND | ND | ND | ND | ND | + | ND | ND | Hypertension, diabetes, thyroid conditions | [29] |
c.90_91del | p.Ser31HisfsX11 | Homo | 1 | 26 | LGMD-2G | Yes | Turkish | F | 2 y | ND | + the dorsal thighs and calves | ND | + Achilles tendon | ND | ND | + Especially leg | + Especially legs | tiptoe-walking, myalgia, hyperlordosis, | [30] |
c.26_33dupAGGTGTCG | p.Arg12fsTer31 | Homo | 2 | 27 | LGMD-2G | Yes | Chinese–Cambodian | M | late teenage years | + Mild calf | ND | + | + Achilles tendon | ND | ND | ND | ND | progressive muscle weakness, mild weakness of eye closure, mild weakness of most other muscle groups | [31] |
c.45_46delTG | p.Cys15Ter | Het | 1 | 28 | LGMD-2G | No | Chinese | ND | late childhood | + calf | ND | + | ND | ND | ND | + | + | wasted sternal head of pectoralis major, finger drop, foot drop | [32] |
c.100delC/c.166insG | p.Glu35Argfs*33/p.Gln56Argfs*52 | Com hetero | 1 | 29 | LGMD-2G | ND | Chinese | ND | ND | ND | ND | ND | ND | ND | + | ND | ND | Vacuolar myopathy | [33] |
c.37_39delGAG/c.496_499delAGAG | p.Glu13del /p.Arg166AlafsTer21 | Comp hetero | 1 | 30 | CMD | ND | Korean | M | 2 y | ND | + | ND | ND | ND | ND | ND | ND | muscle fiber necrosis, increased central nuclei and interstitial fibrosis and/or fatty infiltration | [34] |
c.171C > G | p.C57W | Hetero | 2 | 31 | HCM | No | Portuguese | F/M | 45 y | ND | ND | ND | ND | ND | + | ND | ND | paroxysmal atrial fibrillation (AF), a systolic murmur at the left sternal border and aortic area that increased during orthostatism | [35] |
c.109_110delGG/c.157C > T | p.Gly37Leufs/p.Gln53X | Comp Hetero | 6 | 32 | LGMD-2G | ND | Brazilian | ND | 9–15 Y | ND | ND | ND | ND | ND | ND | + Upper | ND | ND | [22] |
c.165–166insG | ND | 1 | 33 | LGMG-2 | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | *(ClinVar) | |
c.110 + 5G > A | ND | 1 | 34 | LGMG-2 | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | *(ClinVar) | |
c.25–31dup | p.Ser11Ter | Homo | 1 | 35 | LGMD-2G | ND | ND | ND | 26 y | ND | ND | ND | ND | ND | + | ND | ND | muscular dystrophy, myopathy, muscle weakness | *(ClinVar) |
c.66G > A | p.Trp22Ter | Homo | 1 | 36 | HCM | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | *(ClinVar) |
c.34dup | p.Glu12fs | Homo | 1 | 37 | LGMG-2G | ND | Iranian | M | 39–40 y | ND | ND | ND | ND | ND | ND | ND | ND | Myopathy | *(ClinVar) |
c.43–49dup | p.Arg17delinsLeuTer | Hetero | 1 | 38 | HCM | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | *(ClinVar) |
c.103G > T | p.Glu35Ter | Homo | 1 | 39 | HCM | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | *(ClinVar) |
c.110_110 + 1del | ND | 1 | 40 | LGMG | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | *(ClinVar) | |
c.136_137del | p.Gln46fs | ND | 1 | 41 | HCM | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | *(ClinVar) |
c.166C > T | p.Gln56Ter | ND | 1 | 42 | HCM | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | *(ClinVar) |
c.110 + 1G > A | Homo | 1 | 43 | LGMG-2G | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | Lower limb muscle weakness, Difficulty climbing stairs | *(ClinVar) | |
c.14–15del | p.Glu5fs | ND | 1 | 44 | Abnormality of the musculature | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | ND | *(ClinVar) |
Anzeige
Discussion
This paper was the first to study the TCAP gene in the Iranian hypertrophic cardiomyopathies (HCM) and dilated cardiomyopathies (DCM) populations. The cohort consisted of 17 females and 23 males who were clinically diagnosed with HCM and DCM. Their medical records were documented and their blood samples were genetically analyzed, wherein we detected one novel intronic variant c.111-42G > A in intron 1 of the TCAP gene in one of our patients. This novel HCM-associated variant was predicted to be polymorphism and have uncertain significance by in-silico analysis.
Dilated and hypertrophic cardiomyopathies are the most frequent cardiac diseases in the affected patients. These disorders impair the myocardium function and lead to severe complications and sudden cardiac death. Various genes were reported to play pivotal roles in presenting cardiomyopathies, such as MYH7, TTN, MLP, and TCAP. Pathogenic variants of these genes may disturb the structures of the protein or other proteins that bind them and result in functional alterations of the Z-disc complex. Previous studies on the TCAP gene (telethonin protein) suggested that this gene may be a rare cause of cardiomyopathies among the other involving genes, even though dysfunctional telethonin interferes organizing of the structure of sarcomere assembly and regulates the sarcomere length. Therefore, genetic testing is required for the patients to identify their disease-causing variants and apply efficient treatment for alleviating their symptoms and also detect other susceptible family members before worsening their manifestation.
Hitherto, 44 mutations have been detected in the TCAP that can cause various phenotypes ranging from the most common symptoms of hypertrophy, scapular winging, and contractures to fewer common ones, such as intestinal complications. LGMD-2G and HCM were the top two common diseases among the patients and a great number of them were found to have nonsense and missense variants, respectively.
Mainly due to the lack of studies on the TCAP gene mutations in the Iranian population, we investigated the TCAP gene in our patients for the presence of HCM and DCM-susceptibility mutations. However, we identified no disease-causing variants in the gene among our cohort suggesting the TCAP gene may not be a common cause of heart failure among Iranian patients.
Anzeige
Since our cohort was limited, further analysis is needed to reach a conclusive result regarding the role of TCAP gene mutations in Iranian patients with HCM and DCM.
Acknowledgements
We would like to thank the patients and their families who participated in this study. In addition, we are thankful to Cardiology experts and the personnel of the Cardiogenetic Research Laboratory, at Rajaei Hospital. We also appreciate Dr. Sepideh Taghavi and other colleagues in Shahid Rajaei Hospital for their help with the evaluations of the patients.
Declarations
Ethical approval and consent to participate
Protocols for research projects involving human subjects or animals must have been approved by a suitably constituted Ethics Committee of the institution in which the work was undertaken and must conform to the provisions of the Declaration of Helsinki (as revised in Edinburgh 2000). This study was approved by a committee of the Iran University of Medical Sciences (no IR.IUMS.REC.1399.157).
Competing interests
None of the authors have any conflicts of interest to disclose.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.