Skip to main content
Erschienen in: Molecular Autism 1/2013

Open Access 01.12.2013 | Research

Non-synonymous single-nucleotide variations of the human oxytocin receptor gene and autism spectrum disorders: a case–control study in a Japanese population and functional analysis

verfasst von: Wen-Jie Ma, Minako Hashii, Toshio Munesue, Kenshi Hayashi, Kunimasa Yagi, Masakazu Yamagishi, Haruhiro Higashida, Shigeru Yokoyama

Erschienen in: Molecular Autism | Ausgabe 1/2013

Abstract

Background

The human oxytocin receptor (hOXTR) is implicated in the etiology of autism spectrum disorders (ASDs) and is a potential target for therapeutic intervention. Several studies have reported single-nucleotide polymorphisms (SNPs) of the OXTR gene associated with ASDs. These SNPs, however, reside outside the protein-coding region. Not much is known about genetic variations that cause amino acid substitutions that alter receptor functions.

Methods

Variations in the OXTR gene were analyzed in 132 ASD patients at Kanazawa University Hospital in Japan and 248 unrelated healthy Japanese volunteers by re-sequencing and real-time polymerase chain reaction-based genotyping. Functional changes in variant OXTRs were assessed by radioligand binding assay and measurements of intracellular free calcium concentrations ([Ca2+]i) and inositol 1,4,5-trisphosphate (IP3) levels.

Results

Six subjects (4.5%) in the ASD group and two in the control group (0.8%) were identified as heterozygotes carrying the R376G variation (rs35062132; c.1126C>G); one individual from the ASD group (0.8%) and three members of the control group (1.2%) were found to be carrying R376C (c.1126C>T). The C/G genotype significantly correlated with an increased risk of ASDs (odds ratio (OR) = 5.83; 95% confidence interval (CI) = 1.16 to 29.33; P = 0.024, Fisher’s exact test). Consistently, the G allele showed a correlation with an increased likelihood of ASDs (OR = 5.73; 95% CI = 1.15 to 28.61; P = 0.024, Fisher’s exact test). The frequencies of the C/T genotype and the T allele in the ASD and control groups did not differ significantly. We also examined changes in agonist-induced cellular responses mediated by the variant receptors hOXTR-376G and hOXTR-376C. OXT-induced receptor internalization and recycling were faster in hOXTR-376G-expressing HEK-293 cells than in cells expressing hOXTR-376R or hOXTR-376C. In addition, the elevation in [Ca2+]i and IP3 formation decreased in the cells expressing hOXTR-376G and hOXTR-376C tagged with enhanced green fluorescent protein (EGFP), in comparison with the cells expressing the common-type hOXTR-376R tagged with EGFP.

Conclusions

These results suggest that the rare genetic variation rs35062132 might contribute to the pathogenesis of ASDs, and could provide a molecular basis of individual differences in OXTR-mediated modulation of social behavior.
Begleitmaterial
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​2040-2392-4-22) contains supplementary material, which is available to authorized users.

Competing interests

The authors declare they have no competing interests.

Authors’ contributions

HH and SY conceived and designed the research. WJM, TM, KH, KY, MY, and SY performed the genetic analysis of the ASD patients and healthy volunteers. WJM, MH, and SY carried out the experiments on cultured cells. WJM, HH, and SY analyzed data. WJM and SY drafted the initial manuscript; and WJM, TM, HH, and SY prepared successive versions of the document. All authors read and approved the final manuscript.
Abkürzungen
ANOVA
Analysis of variance
ASD
Autism spectrum disorder
BSA
Bovine serum albumin
cADPR
cyclic ADP-ribose
CI
Confidence interval
CREST
Core Research for Evolutional Science and Technology
DAPI
4',6-diamidino-2-phenylindole
DMEM
Dulbecco’s modified Eagle’s medium
EGFP
Enhanced green fluorescent protein
FBS
Fetal bovine serum
fura-2/AM
Fura-2-acetoxymethyl ester
hOXTR
Human oxytocin receptor
IP3
Inositol-1,4,5-trisphosphate
MGB
Minor groove binder
OR
Odds ratio
OXT
Oxytocin
OXTR
Oxytocin receptor
PCR
Polymerase chain reaction
PKC
Protein kinase C
SNP
Single-nucleotide polymorphism.

Background

Oxytocin (OXT) is a nonapeptide hormone primarily produced by magnocellular neurons in the paraventricular and supraoptic nuclei of the hypothalamus [16]. Oxytocin is secreted into the systemic circulation via the hypothalamic-neurohypophyseal system and transported to exert its peripheral effects, such as uterine contractions and milk ejection [16]. Oxytocin is released into the brain from dendrites [7] or centrally projected axonal terminals [8], and it acts on various areas of the central nervous system, modulating affiliative and social behaviors, emotional states, and cognitive functions in many animal species [16].
The actions of OXT are mediated by the OXT receptor (OXTR), which belongs to the GTP-binding protein-coupled receptor family [9]. It is well established that the OXTR is coupled to heterotrimeric Gq/11 protein and that it stimulates phospholipase Cβ (PLCβ), leading to the production of inositol 1,4,5-trisphosphate (IP3) and 1,2-diacylglycerol (DAG) [9]. Inositol 1,4,5-trisphosphate induces an increase in intracellular calcium concentration ([Ca2+]i) by triggering IP3 receptor-mediated Ca2+ release from intracellular stores, whereas DAG activates protein kinase C (PKC), which phosphorylates downstream signaling molecules [9]. Upon prolonged agonist stimulation, OXTR undergoes desensitization and internalization through phosphorylation by GPCR kinase 2 (GRK2) and subsequent interaction with β-arrestin 2 [913]. The internalized OXTRs are then recycled to the cell surface via vesicles containing small GTPases, Rab4 and Rab5 [13].
Previous studies have shown that impaired OXTR-mediated signaling causes behavioral abnormalities [2, 6, 14]. Mice deficient in the OXTR gene show diminished social discrimination, increased aggressive behavior, reduced cognitive flexibility, and increased susceptibility to seizures [15, 16]. Using homozygous mutant mice lacking CD38, a transmembrane protein with ADP-ribosyl cyclase activity, we have shown that a decrease in the formation of cyclic ADP-ribose (cADPR) results in dysfunction of Ca2+-induced Ca2+ release for OXT secretion in hypothalamic neurons. The reduction in cADPR levels also causes marked defects in maternal nurturing and social behaviors similar to those observed in OXT- and OXTR-knockout mice [17, 18]. We also demonstrated that ADP-ribosyl cyclase activity increases after OXTR stimulation, regulating OXT release in the hypothalamus and pituitary in adult male mice [19].
In humans, OXTR has been implicated in the pathogenesis of neuropsychiatric disorders and considered a potential target for therapeutic intervention [20]. Gregory et al. [21] have reported a heterozygous deletion of the OXTR gene, located on chromosome 3p25, in a patient with autism whose mother had a putative obsessive-compulsive disorder. In addition, many studies have demonstrated that single-nucleotide polymorphisms (SNPs) of the OXTR gene are associated with autism spectrum disorders (ASDs), social anxiety disorders, and schizophrenia [2229]. However, all SNPs reported so far reside outside the protein-coding region, and their functional importance is unclear. If allelic variations leading to amino acid substitutions in the OXTR gene were associated with these neuropsychiatric disorders, then such variations would help to predict the etiological relevance based on protein structure-function relationship and to introduce individualized OXT-based therapy.
Therefore, we analyzed nucleotide variations in the protein-coding regions of the human OXTR gene in ASD patients and unrelated healthy controls. Furthermore, we focused on a triallelic variation (rs35062132; c.1126C> G/T; the nomenclature of variation recommended by the Human Genome Variation Society [30]) and investigated whether the amino acid substitution R376G/C causes any changes in OXTR-mediated cellular responses.

Methods

Participants

We recruited 132 ASD subjects (102 males, 30 females; 15.9 ± 0.7 years) from the outpatient psychiatry department of the Kanazawa University Hospital. All subjects fulfilled the DSM-IV criteria for pervasive developmental disorder. The diagnoses were made by two experienced child psychiatrists through interviews and clinical record reviews as described previously [31], and the subjects had no apparent physical anomalies. The two experienced child psychiatrists independently confirmed the diagnosis of ASD for all patients by semi-structured behavior observation and interviews with the subjects and their parents. During each of these interviews with parents, which were helpful in the evaluation of autism-specific behaviors and symptoms, the examiners used one of the following methods: the Asperger Syndrome Diagnostic Interview [32], the Autism Diagnostic Interview-Revised (ADI-R)[33], the Pervasive Developmental Disorders Autism Society Japan Rating Scale [34], the Diagnostic Interview for Social and Communication Disorders [35], or the Tokyo Autistic Behavior Scale [36]. Based on these evaluation methods, 97 patients were classified as autistic disorder (autism), 10 as Asperger’s disorder, and 25 as pervasive developmental disorder not otherwise specified (PDD-NOS). The 248 controls (143 males, 105 females; 31.3 ± 0.6 years) were unrelated healthy Japanese volunteers. All patients and controls were Japanese with no non-Japanese parents or grandparents. This study was approved by the ethics committees of Kanazawa University School of Medicine. All examinations were performed after informed consent according to the Declaration of Helsinki.

Re-sequencing

Genomic DNA was extracted from venous blood samples using the Wizard Genomic DNA Purification kit (Promega, Madison, WI, USA), or from nails using the ISOHAIR DNA extraction kit (Nippon Gene, Tokyo, Japan). DNA fragments containing exons 3 and 4 of the hOXTR gene were amplified by PCR in a 20-μl reaction mixture containing 2.5 ng genomic DNA, 200 μM dNTPs, 200 nM of each primer, 4 μl Ampdirect G/C (Shimadzu, Kyoto, Japan), 4 μl Ampdirect-4 (Shimadzu), and 1 unit Ex Taq DNA polymerase (Takara Shuzo, Otsu, Japan). The amplification procedure consisted of denaturation at 96°C for 1 min, followed by 35 cycles of 96°C for 30 s, 65°C for 1 min, and 72°C for 1 min. The primers used were FWD1 or FWD4 and REV1 for exon 3, and FWD5 and REV3 for exon 4 (sequences are given in Table 1). After amplification, PCR products were purified with the High Pure PCR Cleanup Micro kit (Roche, Mannheim, Germany), subjected to cycle sequencing reaction (BigDye version 1.1; Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s protocol, and analyzed on an ABI PRISM 310 Genetic Analyzer (Applied Biosystems). The primers used were FWD1–FWD5 and REV1–REV6 (Table 1).
Table 1
Oligonucleotides used in this study
Nucleotide sequencing
Real-time PCR-based genotyping
Site-directed mutagenesis
EGFP tagging
 
Amplification
TaqMan MGB probes
  
FWD1: TGGACTCAGCAGATCCGTCCG
FWD8: GCTCCGCCAGCTACCTGAAG
376G-FAM: TGAGCCATGGCAGCTCC
R376G-FWD: CCTTTGTCCTGAGCCATG GCAGCTCCAGCCAGAGG
EGFP-FWD: CCGCAGGTGCACATCTTCTC
FWD2: CTAAGCATCGCCGACCTGGT
REV7: TGGTGGGTCACGCCGTGGAT
376R-VIC: TGAGCCATCGCAGCTCC
R376G-REV: CCTCTGGCTGGAGCTGCC ATGGCTCAGGACAAAGG
EGFP-REV: GTGGATCCCGCCGTGGATGG
FWD3: CCGCAGGTGCACATCTTCTC
 
376C-FAM: TGAGCCATTGCAGCTCC
R376C-FWD: CCTTTGTCCTGAGCCATT GCAGCTCCAGCCAGAGG
 
FWD4: TGGAGTCTCCAGGAGTGGA
  
R376C-REV: CCTCTGGCTGGAGCTGCA ATGGCTCAGGACAAAGG
 
FWD5: GTCTGGAAGTGGCTCCAGTG
    
REV1: CCTGGACATTCTGAGGCAGC
    
REV2: GATGAGCTTGACGCTGCTGAC
    
REV3: GTCAGCAGCGTCAAGCTCATC
    
REV4: CAGTCGAAGACGCCGTC
    
REV5: ACATGAGCAGCAGCAGG
    
REV6: CAGGAGCAGGATGAGAC
    
All sequences are given in the 5' to 3' direction. Nucleotides for rs35062132 are underlined. C, cysteine; FWD, forward; G, glycine; MGB, minor groove binder; R, arginine; REV, reverse.

Real-time PCR

Two primers, FWD8 and REV7 (Table 1), were designed to amplify a 138-bp product encompassing rs35602132 at the mRNA position 1748 (g.8734707; c.1126). Three custom-designed TaqMan minor groove binder (MGB) probes were obtained from Applied Biosystems: 376G-FAM and 376C-FAM targeted to the variant alleles, and 376R-VIC to the common allele (Table 1). PCR was performed in 20-μl mixtures containing 10 μl TaqMan universal master mix (Applied Biosystems), 200 nM of each primer, 100 nM 376R-FAM, 100 nM 376G-VIC or 376C-VIC, and 10 ng of sample DNA. Thermocycling was performed on the ViiA 7 Real-Time PCR System (Applied Biosystems). The amplification was conducted at 60°C for 30 s, 95°C for 5 min, and 40 cycles of 95°C for 15 s and 60°C for 1 min. Data were analyzed with SDS2.3 software (Applied Biosystems).

Site-directed mutagenesis

cDNAs encoding hOXTR variants at amino acid residue 376 were generated by site-directed mutagenesis as described previously [37]. pCHOXTR [38] harboring hOXTR-376R, a common-type receptor, was used as a template for PCR; the primers used were R376G-FWD and R376G-REV (Table 1) for the R376G substitution, and R376C-FWD and R376C-REV (Table 1) for R376C. The amplified products were treated with EX Taq DNA polymerase (Takara Shuzo) at 72°C for 10 min and cloned into a pCR2.1-TOPO vector (Invitrogen, Carlsbad, CA, USA) to yield pCHOXTR-376G and pCHOXTR-376C. The cDNA inserts were verified by nucleotide sequencing.

Construction of expression plasmids

The 1.4-kb Eco RI fragments from pCHOXTR [38], pCHOXTR-376G, and pCHOXTR-376C were cloned into the Eco RI site of the mammalian expression plasmid pcDNA3.1 (+) (Invitrogen) to yield pcDNAHOXTR-376R, pcDNAHOXTR-376G, and pcDNAHOXTR-376C, respectively.
In some experiments, hOXTRs of the common type and variants were fused to the enhanced green fluorescent protein (EGFP). Expression plasmids for these fusion proteins were constructed essentially as described previously [38]. In brief, the 1.4-kb Eco RI fragments obtained from pCHOXTR [38], pcDNAHOXTR-376G, and pcDNAHOXTR-376C were subjected to PCR using primers EGFP-FWD and EGFP-REV (Table 1). The amplified fragments were cleaved with Pst I and Bam HI. The resulting 0.46-kb Pst I (1334)/Bam HI (primer) fragments and the 0.78-kb Bam HI (556)/Pst I (1334) fragment from pCHOXTR were ligated to Bam HI/Bgl II-cleaved pEGFP-N3 (Clontech) to yield pHOXTR-376R-EGFP, pHOXTR-376G-EGFP, and pHOXT-R376C-EGFP. Restriction endonucleasesites are identified by numbers (in parentheses; in accordance with the data deposited in GenBank under accession number NM_000916) indicating the 5'-terminal nucleotide generated by cleavage.

Cell culture and transfection

Human embryonic kidney HEK-293 cells and COS-7 cells were maintained in DMEM supplemented with 10% FBS at 37°C in a humidified atmosphere of 95% air and 5% CO2. NG108-15 neuroblastoma × glioma hybrid cells were cultured as described previously [39]. Cells were grown in culture dishes to 80 to 90% confluence and transfected with expression plasmids using FuGENE HD Transfection Reagent (Roche) following the manufacturer’s instruction.

Radioligand binding assay

COS-7 cells transfected with pcDNAHOXTR-376R, pcDNAHOXTR-376G, pcDNAHOXTR-376C, or pcDNA3.1 (+) were collected 48 h after transfection, and resuspended in homogenization buffer (25 mM Tris, pH 7.4, 1 mM EDTA, 250 mM sucrose). The cells were homogenized and centrifuged at 1,500 g at 4°C for 10 min, to pellet nuclei and intact cells. The resulting supernatants were centrifuged at 40,000 g at 4°C for 30 min, and crude membrane pellets were suspended in binding buffer containing 50 mM HEPES (pH 7.4), 5 mM MgCl2, 1 mM CaCl2, and 0.2% BSA. Protein concentration was determined by the bicinchoninic acid assay (Pierce, Rockford, IL, USA) using BSA as a standard. [Tyrosyl-3H]-oxytocin ([3H]-OXT; PerkinElmer Life Sciences, Waltham, MA, USA) was diluted in the binding buffer to concentrations of 0.05 to 4 nM. Specific binding assays were performed in 5-μg cell membrane preparations incubated at room temperature for 1 h with increasing concentrations of [3H]-OXT, in the absence or presence of 200-fold excess of unlabeled OXT. Binding reaction mixtures were filtered through a GF/C glass fiber filter (Whatman, Maidstone, Kent, UK) and washed three times with Wash Buffer (50 mM HEPES, pH 7.4, 500 mM NaCl, 0.1% BSA). Radioactivity associated with membranes retained by glass filters was quantified in a liquid scintillation counter (LSC-5100; Aloka, Tokyo, Japan). Specific binding was calculated by subtracting non-specific binding in the presence of 200-fold excess of OXT at each radioligand concentration from total binding. Affinity (Kd) and maximal binding capacity (Bmax) of saturation binding were obtained from saturation isotherm specific binding data by nonlinear regression curve analysis using the standard equation for a rectangular hyperbola fitted to one site with the GraphPad Prism 5 (GraphPad Software Inc., San Diego, CA, USA). Competition binding experiments were performed in duplicate by incubating 5 μg of cell membranes at room temperature for 1 h, in the same medium with 1 nM [3H]-OXT and increasing concentrations of unlabeled OXT (10−12 to 10−5 M). Log IC50 values were derived from nonlinear least-squares analysis using the GraphPad Prism 5 software (GraphPad Software Inc.).

Measurement of receptor recycling

HEK-293 cells were plated on poly-D-ornithine-coated glass coverslips and cultured overnight. After transfection with pcDNAHOXTR-376R, pcDNAHOXTR-376G, or pcDNAHOXTR-376C, the cells were incubated at 37°C in serum-free DMEM for different times, in the absence or presence of OXT (100 nM). Reactions were stopped by removing the medium and fixing the cells with 4% paraformaldehyde at room temperature for 10 min. The cells were then blocked with PBS containing 1% BSA and 1.5% normal horse serum for 30 min, and incubated with goat anti-OXTR antibody (N-19; 1:200; sc-8103, Santa Cruz Biotechnology, Santa Cruz, CA, USA) at 4°C overnight. After washing in PBS, the cells were incubated with donkey anti-goat IgG (H + L) antibody conjugated with Alexa Fluor 488 (1:500; Invitrogen) combined with 4',6-diamidino-2-phenylindole (DAPI; 1 μg/ml; Dojindo, Kumamoto, Japan). In some experiments, pSNAPf-ADRβ2 (New England Biolabs, Ipswich, MA, USA), an expression plasmid for β2 adrenergic receptor fused to SNAPf, was cotransfected into HEK-293 cells. The cells were labeled with SNAP-Surface Alexa Fluor 488 (2 μM; New England Biolabs), fixed with 4% paraformaldehyde, and reacted with goat anti-OXTR antibody (N-19; 1:200; Santa Cruz) at 4°C overnight, followed by incubation with donkey anti-goat IgG (H + L) antibody conjugated with Alexa Fluor 594 (1:500; Invitrogen); none of the solutions contained any cell-permeabilizing reagents. Fluorescent images were obtained using confocal laser scanning microscopes (LSM5 Pascal; Carl Zeiss, Jena, Germany; FluoView FV10i, Olympus). Data were analyzed using the FV10-ASW software (Olympus).

[Ca2+]i measurement

We measured [Ca2+]i using the fluorescent Ca2+ indicator fura-2-acetoxymethyl ester (fura-2/AM). HEK-293 cells or NG108-15 cells transfected with pHOXTR-376R-EGFP, pHOXTR-376G-EGFP, or pHOXTR-376C-EGFP were loaded with fura-2/AM to a final concentration of 3 μM in complete medium and incubated at 37°C. After 30-min loading, the cells were washed three times with HEPES-buffered saline (HBS) solution (145 mM NaCl, 5 mM KCl, 1 mM MgCl2, 20 mM HEPES-NaOH, 2 mM CaCl2, 20 mM glucose, pH 7.4). Cells expressing EGFP-tagged OXTRs were visualized at a wavelength of 488 nm before OXT application. The fluorescence of the cells loaded with fura-2/AM was then measured at 37°C, at the determined sites, through a pinhole (10 to 20 μm in diameter). We used alternating excitation wavelengths of 340 and 380 nm in a Ca2+ microspectrofluorometric system (OSP-3 Model; Olympus, Tokyo, Japan), as described previously [39]. The Ca2+ emission was detected every 10 s for 5 min after OXT application. The ratio of fluorescence at 340 nm and 380 nm (F340/F380) was used to determine [Ca2+]i. All data were normalized to the baseline fluorescence (F0) recorded 10 s before OXT addition, and given as F/F0.

IP3 accumulation assay

HEK-293 cells were plated at a density of approximately 5 × 104 per well in a 24-well plate, and transiently transfected with pcDNAHOXTR-376R, pcDNAHOXTR-376G or pcDNAHOXTR-376C, or pcDNA3.1(+). Before treatment with OXT, the transfected cells were washed and incubated in HBS containing 2 mM CaCl2, 10 mM glucose, and 10 mM LiCl at 37°C for 10 min. After OXT treatment, the reaction was terminated at designated time points by the addition of 50 μl of 10% (w/v) perchloric acid. The acid-soluble extract was neutralized with 150 μl of 1.53 M KOH-75 nM HEPES, and perchloric acid was precipitated on ice and removed by a brief centrifugation. The IP3 aqueous extract was then examined with an Inositol-1,4,5-triphosphate [3H]-Radio Receptor Assay Kit (PerkinElmer Life Sciences).

Statistical analyses

Data obtained from genetic studies were analyzed using a contingency table and the Fisher’s exact test (GraphPad Prism 5; GraphPad Software Inc.). All data from the in vitro studies are shown as mean ± standard error of the mean. Statistical significance was determined by the Student’s t test or two-way analysis of variance (ANOVA) using an interactive fitting program (GraphPad Prism 5; GraphPad Software Inc.); P values smaller than 0.05 were considered to be statistically significant.

Results

Genetic analysis

As the entire amino acid sequence of the hOXTR is encoded by exons 3 and 4, as illustrated in Figure 1A, we initially re-sequenced both exons for genetic variations. Of 27 single-nucleotide variations listed in the NCI dbSNP database, we detected minor alleles of rs4686302, rs151257822, and rs35062132 in 59 ASD patients and 30 unrelated healthy Japanese volunteers (Figure 1A, Table 2). As c.1126 G>C (rs35062132; R376G) was detected in two ASD patients but not in controls (Table 2, Figure 1B), we selected rs35062132 for further analysis.
Table 2
Frequency of non-synonymous single-nucleotide variations in the OXTR gene detected by re-sequencing
dbSNP-IDa
mRNAb
Allele
Amino acid
Amino acid
Number of cases
 
position
 
position
residue
ASD ( n= 59)
Control ( n= 30)
rs237908
19
T/G
7
S/A
T/T (0) T/G (0) G/G (59)
T/T (0) T/G (0) G/G (30)
rs237907
40
T/G
14
S/A
T/T (0) T/G (0) G/G (59)
T/T (0) T/G (0) G/G (30)
rs237906
46
T/G
16
S/A
T/T (0) T/G (0) G/G (59)
T/T (0) T/G (0) G/G (30)
rs189386
64
T/G
22
W/G
T/T (0) T/G (0) G/G (59)
T/T (0) T/G (0) G/G (30)
rs113718500
65
C/G
22
A/G
C/C (0) C/G (0) G/G (59)
C/C (0) C/G (0) G/G (30)
rs237903
86
T/C
29
V/A
T/T (0) T/C (0) C/C (59)
T/T (0) T/C (0) C/C (30)
rs171114
188
G/C
63
G/A
G/G (0) G/C (0) C/C (59)
G/G (0) G/C (0) C/C (30)
rs143644523
220
T/C
74
F/L
T/T (0) T/C (0) C/C (59)
T/T (0) T/C (0) C/C (30)
rs138770371
316
G/T
106
D/Y
G/G (0) G/T (0) T/T (59)
G/G (0) G/T (0) T/T (30)
rs115324487
515
C/T
172
A/V
C/C (0) C/T (0) T/T (59)
C/C (0) C/T (0) T/T (30)
rs150746704
616
G/C
206
V/L
G/G (0) G/C (0) C/C (59)
G/G (0) G/C (0) C/C (30)
rs4686302
652
A/G
218
T/A
A/A (3) A/G(12) G/G (34)
A/A (1) A/G(14) G/G (15)
rs143908202
661
A/G
221
S/G
A/A (0) A/G (0) G/G (59)
A/A (0) A/G (0) G/G (30)
rs145921539
684
T/G
228
C/W
T/T (0) T/G (0) G/G (59)
T/T (0) T/G (0) G/G (30)
rs184175311
700
G/A
234
E/K
G/G (0) G/A (0) A/A (59)
G/G (0) G/A (0) A/A (30)
rs61740241
712
A/G
238
T/A
A/A (0) A/G (0) G/G (59)
A/A (0) A/G (0) G/G (30)
rs151141371
755
C/G
252
A/G
C/C (0) C/G (0) G/G (59)
C/C (0) C/G (0) G/G (30)
rs139854982
760
T/C
254
C/R
T/T (0) T/C (0) C/C (59)
T/T (0) T/C (0) C/C (30)
rs144366756
764
G/T
255
G/V
G/G (0) G/T (0) T/T (59)
G/G (0) G/T (0) T/T (30)
rs237901
818
T/C
273
M/T
T/T (0) T/C (0) C/C (59)
T/T (0) T/C (0) C/C (30)
rs144814761
841
A/G
281
M/V
A/A (0) A/G (0) G/G (59)
A/A (0) A/G (0) G/G (30)
rs140488139
963
A/C
321
K/N
A/A (0) A/C (0) C/C (59)
A/A (0) A/C (0) C/C (30)
rs151257822
1001
A/G
334
D/G
A/A (0) A/G (0) G/G (59)
A/A (0) A/G (1) G/G (29)
rs143927655
1015
A/G
339
K/E
A/A (0) A/G (0) G/G (59)
A/A (0) A/G (0) G/G (30)
rs148899442
1100
G/A
367
S/N
G/G (0) G/A (0) A/A (59)
G/G (0) G/A (0) A/A (30)
rs144289031
1121
A/G
374
N/S
A/A (0) A/G (0) G/G (59)
A/A (0) A/G (0) G/G (30)
rs35062132
1126
G/C
376
G/R
G/G (0) G/C (2) C/C (57)
G/G (0) G/C (0) C/C (29)
rs35062132
1126
T/C
376
C/R
T/T (0) T/C (0) C/C (57)
T/T (0) T/C (1) C/C (29)
aIDs are from dbSNP of the National Center for Biotechnology Information [40]. Bold IDs indicate the presence of allelic heterozygosity. bA of the ATG of the initial methionine is denoted nucleotide +1.
We genotyped an additional 73 ASD patients and 218 healthy volunteers for rs35062132 variation using the TaqMan-based real-time PCR method. In total, we obtained data from 132 ASD patients and 248 controls. Six individualsin the ASD group (4.5%) and two in the control group (0.8%) were identified as heterozygotes carrying the R376G variation (rs35062132; c.1126C>G). One person in the ASD group (0.8%) and three in the control group (1.2%) carried R376C (c.1126C>T; Table 3). No homozygous carriers for the minor alleles were observed. The χ2 goodness-of-fit test showed that the genotype frequency distribution of rs35062132 did not deviate from Hardy-Weinberg equilibrium in the patient group (χ2 = 0.098, P = 0.99) or the control group (χ2 = 0.026, P = 1.00). The genotype and allele frequencies of rs35062132 obtained from all participants are summarized in Table 3. The C/G genotype was significantly correlated with an increased risk of ASDs (odds ratio (OR) = 5.83; 95% confidence interval (CI) = 1.16 to 29.3; P = 0.024, Fisher’s exact test; Table 3). Consistently, the G allele also showed a correlation with an increased likelihood of ASDs (OR = 5.73, 95% CI = 1.15 to 28.6; P = 0.024, Fisher’s exact test; Table 3). The frequencies of the C/T genotype and the T allele did not significantly differ between the ASD and control groups (Table 3).
Table 3
Comparison of the genotype and allele frequencies of rs35062132 at Kanazawa University Hospital for ASDs
 
Cases
Control
Odds ratio
P
 
(n= 132)
(n= 248)
(95% CI)
 
Genotype
    
C/C
125 (94.7%)
243 (98.0%)
Referent
 
C/G
6 (4.5%)
2 (0.8%)
5.83 (1.16,29.3)
0.024
C/T
1 (0.8%)
3 (1.2%)
0.65 (0.07,6.30)
1.00
G/G
0
0
  
T/T
0
0
  
G/T
0
0
  
Allele
    
C
257 (97.3%)
491 (99.0%)
Referent
 
G
6 (2.3%)
2 (0.4%)
5.73 (1.15,28.6)
0.024
T
1 (0.4%)
3 (0.6%)
0.64 (0.07,6.16)
1.00
CI, confidence interval. P values obtained by Fisher’s exact test are given.

Radioligand binding properties of the common and variant hOXTRs

To find out whether the amino acid changes at the residue 376 affect the receptor functions, we compared ligand-binding properties of the common and variant hOXTRs. In saturation binding and Scatchard analysis of 3[H]-OXT binding to membranes prepared from COS-7 cells transfected with hOXTR-expression plasmids, the variants hOXTR-376G and hOXTR-R376C, as well as the common-type hOXTR-376R, exhibited single high-affinity binding sites. Values of Kd were 0.90 ± 0.28, 1.1 ± 0.12, and 1.2 ± 0.19 nM (n = 15 in each group), and values of Bmax were 3153 ± 531, 3202 ± 234, and 3120 ± 339 fmol/mg of protein (n = 15 in each group) for hOXTR-376R, hOXTR-376G, and hOXTR-376C, respectively. Competition binding experiments confirmed that the variant and common receptors did not differ significantly: values of IC50 were 1.05 ± 0.47, 0.49 ± 0.23, and 0.71 ± 0.30 nM (n = 15 in each group) for hOXTR-376R, hOXTR-376G, and hOXTR-376C, respectively. These data indicate that both variations have no or little effect on OXT binding.

Agonist-induced receptor internalization and recycling in HEK-293 cells

We then examined the agonist-induced internalization and recycling of hOXTRs in HEK-293 cells, which have been most extensively used for investigation of GPCR internalization and trafficking. HEK-293 cells transfected with an expression plasmid for hOXTR-376R, hOXTR-376G, or hOXTR-376C were stimulated with 100 nM OXT for 5, 10, 15, 30, 45, 60, 90, and 120 min. At each time point, the cells were fixed and stained with antibody pecific for the amino (N)-terminus, located extracellularly, of the OXTR under impermeable conditions. The specificity of the staining was confirmed by the comparison with the staining of mock-transfected and non-transfected HEK-293 cells (Additional file 1: Figure S1).
Immunoreactivity for hOXTRs was visualized by confocal laser scanning microscopy (Figure 2A). Immunofluorescence was measured and expressed as a percentage of the intensity for receptors remaining at the cell surface. Cell-surface intensity for hOXTR-376R reached the lowest value of 43.9 ± 2.3% (n = 30) after 60 min, and then gradually increased to 77.1 ± 8.7% (n = 29) of the prestimulatory level at 120 min. OXT-induced internalization in the cells expressing hOXTR-376C were very similar to that for hOXTR-376R: the surface intensity decreased to 45.1 ± 3.3% (n = 30) at 60 min, and then elevated to 79.4 ± 18.1% (n = 8) at 120 min. In contrast, the surface intensity of hOXTR-376G showed a significantly faster decrease than that for hOXTR-376R at 5 min after OXT application (62.5 ± 4.7% (n = 25) for hOXTR-376G, 78.7 ± 6.7% (n = 15) for hOXTR-376R; P <0.05; Student’s t test). In addition, hOXTR-376G showed significantly higher levels of surface intensities from 30 min to 120 min after OXT application (Figure 2B). The values at 30, 45, 60, and 120 min were 59.6 ± 2.7 (n = 30, P <0.05; Student’s t test), 61.4 ± 3.0 (n = 30, P <0.05; Student’s t test), 67.7 ± 3.7 (n = 30, P <0.01; Student’s t test), and 96.1 ± 6.6% (n = 23, P <0.05; Student’s t test) for hOXTR-376G, compared with 52.0 ± 2.5 (n = 30), 51.1 ± 3.1 (n = 30), 43.9 ± 2.3 (n = 30), and 77.1 ± 8.7% (n = 29) for hOXTR-376R, respectively (Figure 2B). The majority of the hOXTR-immunoreactivity was colocalized with fluorescence for SNAPf-tagged β2-adrenergic receptor as a plasma membrane marker (>84%; Additional file 2: Figure S2). These data demonstrate that, upon agonist stimulation, hOXTR-376G is internalized into the cytoplasm and recycled to the plasma membrane more rapidly than hOXTR-376R and hOXTR-376C.

Agonist-induced Ca2+ mobilization in HEK-293 cells and NG108-15 neuronal cells

To examine whether the amino acid substitutions altered the coupling to intracellular signaling system, we measured OXT-induced Ca2+ mobilization. Both HEK-293 cells and NG108-15 neuroblastoma × glioma hybrid cells were transfected with an expression plasmid for EGFP-tagged hOXTR-376R, hOXTR-R376G, or hOXTR-376C. Before OXT stimulation, EGFP fluorescence was homogenously distributed in both HEK-293 cells and NG108-15 neuronal cells expressing hOXTR-376R-EGFP, hOXTR-376G-EGFP, and hOXTR-376C-EGFP, as previously reported [13] (Figure 3A,B). After loading these cells with Ca2+-sensitive fluorescent dye fura-2/AM, the effect of the amino acid variations on OXT-induced increase in [Ca2+]i was analyzed using a dual-wavelength (340 and 380 nm) fluorescence spectrophotometer.
The addition of 100 nM OXT to HEK-293 cells expressing hOXTR-376R-EGFP induced a rapid initial increase of [Ca2+]i; the levels reached 223 ± 19.6% (n = 24) of the prestimulatory level and then returned to the basal level within 3 min (Figure 3C,E). In contrast, both hOXTR-376G-EGFP- and hOXTR-376C-EGFP-expressing HEK-293 cells exhibited significantly smaller initial peaks: the maximum [Ca2+]i was 142 ± 13.2% (n = 24) and 159 ± 3.8% (n = 31) for hOXTR-376G-EGFP and hOXTR-376C-EGFP, respectively (Figure 3C,E). Mock-transfected control cells did not show Ca2+ mobilization at all (Figure 3C,E).
The same tendency was observed in NG108-15 neuronal cells. [Ca2+]i initially increased to relatively low levels compared with those in HEK-293 cells. The maximum [Ca2+]i levels at the initial peak in hOXTR-376G-EGFP- and hOXTR-376C-EGFP-expressing NG108-15 cells were 137 ± 5.1% (n = 28) and 128 ± 2.0% (n = 18), respectively, significantly lower than those in hOXTR-376R-EGFP-expressing cells, which reached 161 ± 5.1% (n = 24; Figure 3D,F).

Agonist dose-dependent Ca2+ mobilization

We further examined the OXT dose-dependence during the increase in [Ca2+]i in HEK-293 cells expressing the common and variant hOXTRs. OXT concentrations ranging from 10−11 to 10−6 M were tested. When the OXT concentration was lower than 10−10 M, no differences in the initial [Ca2+]i rise were observed in the cells expressing hOXTR-376R-EGFP, hOXTR-376G-EGFP, and hOXTR-376C-EGFP (Figure 4A,B). In the cells expressing hOXTR-376R-EGFP, the maximum initial increase in [Ca2+]i was at 10−7 M OXT (Figure 4A,B).
In HEK293 cells expressing hOXTR-376G-EGFP, the maximal [Ca2+]i increase was obtained at 10−8 M OXT (158 ± 5.2% (n = 24); Figure 4A,B). OXT at 10−7 and 10−6 M resulted in significantly smaller [Ca2+]i increases compared with those for hOXTR-376R-EGFP, with initial peak values being 142 ± 13.2% (n = 24) and 129 ± 7.2% (n = 16), respectively.
In HEK-293 cells expressing hOXTR-376C-EGFP, the maximal [Ca2+]i increase was obtained at 10−7 M (159 ± 3.8% (n = 31); Figure 4A,B). At concentrations higher than 10−9 M, the OXT-induced increase in [Ca2+]i was significantly reduced (Figure 4A,B). These data suggested that the rs35062132 variations (R376G/C) might alter the OXTR-mediated changes in the intracellular calcium concentrations.

Agonist-induced IP3 accumulation in HEK-293 cells

IP3 is known to mediate OXT-induced increase in [Ca2+]i levels. Therefore, we investigated whether the amino acid substitutions could affect IP3 production. As shown in Figure 5, in HEK-293 cells expressing hOXTR-376R-EGFP, 100 nM OXT elicited an increase in IP3 level within initial 10 s; this increase was maintained for 30 s and the level returned to its basal value after 3 min. Mock-transfected cells did not show any changes. The cells expressing hOXTR-376G-EGFP and hOXTR-376C-EGFP also stimulated IP3 production. During the whole period of 3 min after OXT application, IP3 production in cells expressing hOXTR-376G-EGFP was not statistically different compared with hOXTR-376R-EGFP (P = 0.1705, F(1, 217) = 1.89; two-way ANOVA), whereas cells expressing hOXTR-376C-EGFP showed significantly smaller IP3 production (P = 0.003, F(1, 210) = 9.01; two-way ANOVA). During the initial 5 to 30 s after OXT application, a slight but significant drop from the maximum IP3 levels was observed in these cells, compared with the values for hOXTR-376R-EGFP (P = 0.0210, F(1, 107) = 5.49 for hOXTR-376G-EGFP; P = 0.0209, F(1, 103) = 5.5 for hOXTR-376C-EGFP; two-way ANOVA).

Discussion

The main findings of this study are as follows. (i) Triallelic non-synonymous variation (rs35062132, c.1126C>G/T; R376G/C) is observed in both ASD patients and healthy controls in a Japanese population; the frequencies of the G allele are significantly higher in the ASD patients than in healthy controls. (ii) In HEK-293 cells expressing hOXTR-376G, the agonist-induced internalization and recycling of the OXTR are faster than that in the cells expressing hOXTR-376C or hOXTR-376R. (iii) In both HEK-293 cells and NG108-15 neuronal cells, the agonist-induced increase in [Ca2+]i mediated by hOXTR-376G-EGFP or hOXTR-376C-EGFP is smaller than the increase associated with hOXTR-376R-EGFP. These results provide new insights into the genetic architecture and therapeutic aspects of ASDs.
The present study is unique in associating non-synonymous allelic variations of the OXTR gene with ASDs. These variations at rs35062132 have not been reported in other disorders. To date, several studies have found ASD-associated SNPs in the OXTR gene, which reside in introns (rs4564970 [41], rs237897 [25], rs53576 [23, 24], rs2254298 [2325], rs2268493 [42], rs7632287 [42], rs11720238 [41]), 3'-untranslated region (rs1042778) [42], and intergenic regions (rs7632287 and rs11720238) [41]. The functional consequences of these SNPs remain unclear. Importantly, all minor alleles of these SNPs have a frequency more than 5%, and thus can be classified as common variations. In contrast, the frequencies of the G and T alleles of rs35062132 are 0.4% and 0.6%, respectively, in controls; these minor alleles can be categorized as rare [4345]. Therefore, most previous studies favor the common disease–common variant model, in which most of the risk is caused by common genetic variations (>5% allele frequency), each allele conferring a slight risk [4347]. By contrast, our results support the common disease–rare variant model, in which the risk is mostly attributable to rare variations (<5% allele frequency), each variant conferring a moderate but readily detectable increase in the relative risk [4347]. In agreement with this model, we observed that the minor alleles clearly affected OXT-induced cellular responses. Future studies will be conducted to test whether behavioral changes caused by these variations are moderate and reasonably deleterious. Also it will be interesting to examine whether the rs35062132 variations cosegregate with the risk alleles in the non-coding region [2224, 41, 42].
The limitation of this study is that sample size is not sufficient to analyze the rare variant alleles at rs35062132. Future studies with larger sample size or family-based association testing are necessary to conclude that the G allele of the rs35062132 is a genetic risk factor for ASDs. The result reported here should be replicated in independent populations with various ethnic backgrounds.
The amino acid variation R376G/C is located in the intracellular carboxy (C)-terminal tail of the receptor protein, which is critical for desensitization, internalization, and recycling of the OXTR, as in many other GPCRs [913]. Arg376 is associated with two structural components involved in these processes: (i) Arg376 is a part of a PKC consensus motif (Ser374-His375-Arg376; Figure 1A), which is thought to interact with PKC after OXT stimulation [10]; and (ii) Arg376 is in conjunction with one of the two Ser triplets in the C-terminus (Figure 1A) that are primary sites of agonist-induced phosphorylation and β-arrestin-2 binding [11]. When either one of the two Ser triplets was mutated to alanine residues, the stability of the β-arrestin-2-OXTR complex was altered, and the ability of β-arrestin-2 to internalize with the receptor was eliminated [11]. In the vasopressin receptor V2, which is highly homologous to OXTR in structure, the equivalent Ser triplets function as a retention motif. GRK phosphorylation of these Ser residues promotes the formation of stable receptor-β-arrestin complexes, followed by cotrafficking and colocalization of the complexes to endocytotic vesicles and slow recycling to the cell surface [48]. Therefore, it is suggested that the R376G substitution in the OXTR might suppress the phosphorylation of Ser residues in the Ser triplets or reduce the stability of β-arrestin binding to the triplets, resulting in faster receptor recycling.
We demonstrated that, both in HEK-293 cells and in NG108-15 neuronal cells, agonist-induced [Ca2+]i elevation mediated by variant receptors, hOXTR-376G-EGFP and hOXTR-376C-EGFP, is smaller than that by the common receptor hOXTR-376R-EGFP. Despite the marked reduction in the peak [Ca2+]i, the decrease in IP3 levels was slight. Provided that Arg376 is not located in the known site for Gq binding (Figure 1A) [49], the Gq/11/PLCβ/IP3-independent, unidentified signaling pathway for [Ca2+]i elevation might be affected by the R376G/C substitution.
Ca2+ signaling pathways in neurons have been implicated in the pathogenesis of ASDs [50]. However, the involvement of OXTR-mediated, PLC/IP3-dependent Ca2+ signaling in ASDs is still largely unknown. Recently, Ninan [51] has demonstrated that U73122, a PLC inhibitor, reduced OXT-induced suppression of glutamatergic synaptic transmission in pyramidal neurons of the medial prefrontal cortex, possibly by inhibiting PLC-dependent increase in postsynaptic calcium. Given that this process is critical for the OXT effects on social cognition, it is conceivable that the OXTR variations may serve as a risk factor for ASDs.
We have previously demonstrated that cADPR, which may act as an intracellular second messenger downstream of the OXTR, activates Ca2+ release from intracellular stores through the ryanodine receptor Ca2+ release channel. cADPR also initiates Ca2+ influx through melastatin-related transient receptor potential 2 (TRPM2) channels [38]. Our previous SNP analysis has suggested that R140W substitution of CD38 protein, a regulator of ryanodine receptor-mediated Ca2+-induced Ca2+ release for OXT secretion [17], could be a potential risk factor for a subset of Japanese ASD patients [31]. Although this study shares a part of the ASD patients with our previous analysis [31], the 140W allele of CD38 has not been found in the patients carrying the OXTR-376G or OXTR-376C until now (unpublished data). It is therefore conceivable that the underlying signaling process affected by the R376G/C substitution is independent of the CD38-mediated OXT release from hypothalamic neurons [17].
Besides their relevance to the etiology of ASDs, the results presented here might contribute to the development of new pharmacological treatments. Genetic polymorphisms of many drug targets predict responsiveness to drugs [52, 53]. It is likely that the alteration in the cellular functions mediated by the variant OXTRs could cause some individual differences in both behavioral and non-behavioral responses to OXT. Although no side effects specific to intranasal OXT administration have been reported [54], new clinical information regarding functional OXTR variants will be helpful in the determination of individual administration protocols to maximize therapeutic benefit with least adverse effects.

Conclusions

Our analysis of the genetic variation rs35062132 in the human OXTR gene may be important for both etiological and therapeutic aspects of ASDs. However, the results reported here should be reproduced in an independent population. Further studies with a larger sample size using subjects of different ethnicities are required to confirm that the G allele of the rs35062132 is a genetic risk factor for ASDs. Identifying rare functional variants of the OXTR will shed new light on the genetic architecture of ASDs and allow personalized pharmacological intervention using OXT.

Acknowledgements

We thank Ms. Michiko Hoshii for technical assistance. This work was supported by grants-in-aid from the Japan Science and Technology Corporation (CREST), and ‘Integrated research on neuropsychiatric disorders’ carried out under the Strategic Research Program for Brain Sciences by the Ministry of Education, Culture, Sports, Science and Technology of Japan.
Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://​creativecommons.​org/​licenses/​by/​2.​0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Competing interests

The authors declare they have no competing interests.

Authors’ contributions

HH and SY conceived and designed the research. WJM, TM, KH, KY, MY, and SY performed the genetic analysis of the ASD patients and healthy volunteers. WJM, MH, and SY carried out the experiments on cultured cells. WJM, HH, and SY analyzed data. WJM and SY drafted the initial manuscript; and WJM, TM, HH, and SY prepared successive versions of the document. All authors read and approved the final manuscript.
Anhänge

Electronic supplementary material

Literatur
1.
Zurück zum Zitat Carter CS, Grippo AJ, Pournajafi-Nazarloo H, Ruscio MG, Porges SW: Oxytocin, vasopressin and sociality. Prog Brain Res. 2008, 170: 331-336.CrossRefPubMed Carter CS, Grippo AJ, Pournajafi-Nazarloo H, Ruscio MG, Porges SW: Oxytocin, vasopressin and sociality. Prog Brain Res. 2008, 170: 331-336.CrossRefPubMed
2.
Zurück zum Zitat Donaldson ZR, Young LJ: Oxytocin, vasopressin, and the neurogenetics of sociality. Science. 2008, 322: 900-904. 10.1126/science.1158668.CrossRefPubMed Donaldson ZR, Young LJ: Oxytocin, vasopressin, and the neurogenetics of sociality. Science. 2008, 322: 900-904. 10.1126/science.1158668.CrossRefPubMed
3.
Zurück zum Zitat Neumann ID: Brain oxytocin: a key regulator of emotional and social behaviours in both females and males. J Neuroendocrinol. 2008, 20: 858-865. 10.1111/j.1365-2826.2008.01726.x.CrossRefPubMed Neumann ID: Brain oxytocin: a key regulator of emotional and social behaviours in both females and males. J Neuroendocrinol. 2008, 20: 858-865. 10.1111/j.1365-2826.2008.01726.x.CrossRefPubMed
4.
Zurück zum Zitat McGregor IS, Callaghan PD, Hunt GE: From ultrasocial to antisocial: a role for oxytocin in the acute reinforcing effects and long-term adverse consequences of drug use?. Br J Pharmacol. 2008, 154: 358-368.PubMedCentralCrossRefPubMed McGregor IS, Callaghan PD, Hunt GE: From ultrasocial to antisocial: a role for oxytocin in the acute reinforcing effects and long-term adverse consequences of drug use?. Br J Pharmacol. 2008, 154: 358-368.PubMedCentralCrossRefPubMed
5.
Zurück zum Zitat Skuse DH, Gallagher L: Dopaminergic-neuropeptide interactions in the social brain. Trends Cogn Sci. 2009, 13: 27-35. 10.1016/j.tics.2008.09.007.CrossRefPubMed Skuse DH, Gallagher L: Dopaminergic-neuropeptide interactions in the social brain. Trends Cogn Sci. 2009, 13: 27-35. 10.1016/j.tics.2008.09.007.CrossRefPubMed
6.
Zurück zum Zitat Meyer-Lindenberg A, Domes G, Kirsch P, Heinrichs M: Oxytocin and vasopressin in the human brain: social neuropeptides for translational medicine. Nat Rev Neurosci. 2011, 12: 524-538. 10.1038/nrn3044.CrossRefPubMed Meyer-Lindenberg A, Domes G, Kirsch P, Heinrichs M: Oxytocin and vasopressin in the human brain: social neuropeptides for translational medicine. Nat Rev Neurosci. 2011, 12: 524-538. 10.1038/nrn3044.CrossRefPubMed
7.
Zurück zum Zitat Ludwig M, Leng G: Dendritic peptide release and peptide-dependent behaviours. Nat Rev Neurosci. 2006, 7: 126-136. 10.1038/nrn1845.CrossRefPubMed Ludwig M, Leng G: Dendritic peptide release and peptide-dependent behaviours. Nat Rev Neurosci. 2006, 7: 126-136. 10.1038/nrn1845.CrossRefPubMed
8.
Zurück zum Zitat Knobloch HS, Charlet A, Hoffmann LC, Eliava M, Khrulev S, Cetin AH, Osten P, Schwarz MK, Seeburg PH, Stoop R, Grinevich V: Evoked axonal oxytocin release in the central amygdala attenuates fear response. Neuron. 2012, 73: 553-566. 10.1016/j.neuron.2011.11.030.CrossRefPubMed Knobloch HS, Charlet A, Hoffmann LC, Eliava M, Khrulev S, Cetin AH, Osten P, Schwarz MK, Seeburg PH, Stoop R, Grinevich V: Evoked axonal oxytocin release in the central amygdala attenuates fear response. Neuron. 2012, 73: 553-566. 10.1016/j.neuron.2011.11.030.CrossRefPubMed
9.
Zurück zum Zitat Gimpl G, Reitz J, Brauer S, Trossen C: Oxytocin receptors: ligand binding, signalling and cholesterol dependence. Prog Brain Res. 2008, 170: 193-204.CrossRefPubMed Gimpl G, Reitz J, Brauer S, Trossen C: Oxytocin receptors: ligand binding, signalling and cholesterol dependence. Prog Brain Res. 2008, 170: 193-204.CrossRefPubMed
10.
Zurück zum Zitat Berrada K, Plesnicher CL, Luo X, Thibonnier M: Dynamic interaction of human vasopressin/oxytocin receptor subtypes with G protein-coupled receptor kinases and protein kinase C after agonist stimulation. J Biol Chem. 2000, 275: 27229-27237.PubMed Berrada K, Plesnicher CL, Luo X, Thibonnier M: Dynamic interaction of human vasopressin/oxytocin receptor subtypes with G protein-coupled receptor kinases and protein kinase C after agonist stimulation. J Biol Chem. 2000, 275: 27229-27237.PubMed
11.
Zurück zum Zitat Oakley RH, Laporte SA, Holt JA, Barak LS, Caron MG: Molecular determinants underlying the formation of stable intracellular G protein-coupled receptor-β-arrestin complexes after receptor endocytosis. J Biol Chem. 2001, 276: 19452-19460. 10.1074/jbc.M101450200.CrossRefPubMed Oakley RH, Laporte SA, Holt JA, Barak LS, Caron MG: Molecular determinants underlying the formation of stable intracellular G protein-coupled receptor-β-arrestin complexes after receptor endocytosis. J Biol Chem. 2001, 276: 19452-19460. 10.1074/jbc.M101450200.CrossRefPubMed
12.
Zurück zum Zitat Hasbi A, Devost D, Laporte SA, Zingg HH: Real-time detection of interactions between the human oxytocin receptor and G protein-coupled receptor kinase-2. Mol Endocrinol. 2004, 18: 1277-1286. 10.1210/me.2003-0440.CrossRefPubMed Hasbi A, Devost D, Laporte SA, Zingg HH: Real-time detection of interactions between the human oxytocin receptor and G protein-coupled receptor kinase-2. Mol Endocrinol. 2004, 18: 1277-1286. 10.1210/me.2003-0440.CrossRefPubMed
13.
Zurück zum Zitat Conti F, Sertic S, Reversi A, Chini B: Intracellular trafficking of the human oxytocin receptor: evidence of receptor recycling via a Rab4/Rab5 “short cycle”. Am J Physiol Endocrinol Metab. 2009, 29: E532-E542. Conti F, Sertic S, Reversi A, Chini B: Intracellular trafficking of the human oxytocin receptor: evidence of receptor recycling via a Rab4/Rab5 “short cycle”. Am J Physiol Endocrinol Metab. 2009, 29: E532-E542.
14.
Zurück zum Zitat Ferguson JN, Young LJ, Hearn EF, Matzuk MM, Insel TR, Winslow JT: Social amnesia in mice lacking the oxytocin gene. Nat Genet. 2000, 25: 284-288. 10.1038/77040.CrossRefPubMed Ferguson JN, Young LJ, Hearn EF, Matzuk MM, Insel TR, Winslow JT: Social amnesia in mice lacking the oxytocin gene. Nat Genet. 2000, 25: 284-288. 10.1038/77040.CrossRefPubMed
15.
Zurück zum Zitat Takayanagi Y, Yoshida M, Bielsky IF, Ross HE, Kawamata M, Onaka T, Yanagisawa T, Kimura T, Matzuk MM, Young LJ, Nishimori K: Pervasive social deficits, but normal parturition, in oxytocin receptor-deficient mice. Proc Natl Acad Sci USA. 2005, 102: 16096-160101. 10.1073/pnas.0505312102.PubMedCentralCrossRefPubMed Takayanagi Y, Yoshida M, Bielsky IF, Ross HE, Kawamata M, Onaka T, Yanagisawa T, Kimura T, Matzuk MM, Young LJ, Nishimori K: Pervasive social deficits, but normal parturition, in oxytocin receptor-deficient mice. Proc Natl Acad Sci USA. 2005, 102: 16096-160101. 10.1073/pnas.0505312102.PubMedCentralCrossRefPubMed
16.
Zurück zum Zitat Sala M, Braida D, Lentini D, Busnelli M, Bulgheroni E, Capurro V, Finardi A, Donzelli A, Pattini L, Rubino T, Parolaro D, Nishimori K, Parenti M, Chini B: Pharmacologic rescue of impaired cognitive flexibility, social deficits, increased aggression, and seizure susceptibility in oxytocin receptor null mice: a neurobehavioral model of autism. Biol Psychiatry. 2010, 69: 875-882.CrossRef Sala M, Braida D, Lentini D, Busnelli M, Bulgheroni E, Capurro V, Finardi A, Donzelli A, Pattini L, Rubino T, Parolaro D, Nishimori K, Parenti M, Chini B: Pharmacologic rescue of impaired cognitive flexibility, social deficits, increased aggression, and seizure susceptibility in oxytocin receptor null mice: a neurobehavioral model of autism. Biol Psychiatry. 2010, 69: 875-882.CrossRef
17.
Zurück zum Zitat Jin D, Liu HX, Hirai H, Torashima T, Nagai T, Lopatina O, Shnayder NA, Yamada K, Noda M, Seike T, Fujita K, Takasawa S, Yokoyama S, Koizumi K, Shiraishi Y, Tanaka S, Hashii M, Yoshihara T, Higashida K, Islam MS, Yamada N, Hayashi K, Noguchi N, Kato I, Okamoto H, Matsushima A, Salmina A, Munesue T, Shimizu N, Mochida S: CD38 is critical for social behaviour by regulating oxytocin secretion. Nature. 2007, 446: 41-45. 10.1038/nature05526.CrossRefPubMed Jin D, Liu HX, Hirai H, Torashima T, Nagai T, Lopatina O, Shnayder NA, Yamada K, Noda M, Seike T, Fujita K, Takasawa S, Yokoyama S, Koizumi K, Shiraishi Y, Tanaka S, Hashii M, Yoshihara T, Higashida K, Islam MS, Yamada N, Hayashi K, Noguchi N, Kato I, Okamoto H, Matsushima A, Salmina A, Munesue T, Shimizu N, Mochida S: CD38 is critical for social behaviour by regulating oxytocin secretion. Nature. 2007, 446: 41-45. 10.1038/nature05526.CrossRefPubMed
18.
Zurück zum Zitat Liu HX, Lopatina O, Higashida C, Tsuji T, Kato I, Takasawa S, Okamoto H, Yokoyama S, Higashida H: Locomotor activity, ultrasonic vocalization and oxytocin levels in infant CD38 knockout mice. Neurosci Lett. 2008, 448: 67-70. 10.1016/j.neulet.2008.09.084.CrossRefPubMed Liu HX, Lopatina O, Higashida C, Tsuji T, Kato I, Takasawa S, Okamoto H, Yokoyama S, Higashida H: Locomotor activity, ultrasonic vocalization and oxytocin levels in infant CD38 knockout mice. Neurosci Lett. 2008, 448: 67-70. 10.1016/j.neulet.2008.09.084.CrossRefPubMed
19.
Zurück zum Zitat Lopatina O, Liu HX, Amina S, Hashii M, Higashida H: Oxytocin-induced elevation of ADP-ribosyl cyclase activity, cyclic ADP-ribose or Ca2+ concentrations is involved in autoregulation of oxytocin secretion in the hypothalamus and posterior pituitary in male mice. Neuropharmacology. 2010, 58: 50-55. 10.1016/j.neuropharm.2009.06.012.CrossRefPubMed Lopatina O, Liu HX, Amina S, Hashii M, Higashida H: Oxytocin-induced elevation of ADP-ribosyl cyclase activity, cyclic ADP-ribose or Ca2+ concentrations is involved in autoregulation of oxytocin secretion in the hypothalamus and posterior pituitary in male mice. Neuropharmacology. 2010, 58: 50-55. 10.1016/j.neuropharm.2009.06.012.CrossRefPubMed
20.
Zurück zum Zitat Graustella AJ, MacLeod C: A critical review of the influence of oxytocin nasal spray on social cognition in humans: evidence and future directions. Horm Behav. 2012, 61: 410-418. 10.1016/j.yhbeh.2012.01.002.CrossRefPubMed Graustella AJ, MacLeod C: A critical review of the influence of oxytocin nasal spray on social cognition in humans: evidence and future directions. Horm Behav. 2012, 61: 410-418. 10.1016/j.yhbeh.2012.01.002.CrossRefPubMed
21.
Zurück zum Zitat Gregory SG, Connelly JJ, Towers AJ, Johnson J, Biscocho D, Markunas CA, Lintas C, Abramson RK, Wright HH, Ellis P, Langford CF, Worley G, Delong GR, Murphy SK, Cuccaro ML, Persico A, Pericak-Vance MA: Genomic and epigenetic evidence for oxytocin receptor deficiency in autism. BMC Med. 2009, 7: 62-10.1186/1741-7015-7-62.PubMedCentralCrossRefPubMed Gregory SG, Connelly JJ, Towers AJ, Johnson J, Biscocho D, Markunas CA, Lintas C, Abramson RK, Wright HH, Ellis P, Langford CF, Worley G, Delong GR, Murphy SK, Cuccaro ML, Persico A, Pericak-Vance MA: Genomic and epigenetic evidence for oxytocin receptor deficiency in autism. BMC Med. 2009, 7: 62-10.1186/1741-7015-7-62.PubMedCentralCrossRefPubMed
22.
Zurück zum Zitat Wu S, Jia M, Ruan Y, Liu J, Guo Y, Shuang M, Gong X, Zhang Y, Yang X, Zhang D: Positive association of the oxytocin receptor gene (OXTR) with autism in the Chinese Han population. Biol Psychiatry. 2005, 58: 74-77. 10.1016/j.biopsych.2005.03.013.CrossRefPubMed Wu S, Jia M, Ruan Y, Liu J, Guo Y, Shuang M, Gong X, Zhang Y, Yang X, Zhang D: Positive association of the oxytocin receptor gene (OXTR) with autism in the Chinese Han population. Biol Psychiatry. 2005, 58: 74-77. 10.1016/j.biopsych.2005.03.013.CrossRefPubMed
23.
Zurück zum Zitat Jacob S, Brune CW, Carter CS, Leventhal BL, Lord C, Cook EHJ: Association of the oxytocin receptor gene (OXTR) in Caucasian children and adolescents with autism. Neurosci Lett. 2007, 417: 6-9. 10.1016/j.neulet.2007.02.001.PubMedCentralCrossRefPubMed Jacob S, Brune CW, Carter CS, Leventhal BL, Lord C, Cook EHJ: Association of the oxytocin receptor gene (OXTR) in Caucasian children and adolescents with autism. Neurosci Lett. 2007, 417: 6-9. 10.1016/j.neulet.2007.02.001.PubMedCentralCrossRefPubMed
24.
Zurück zum Zitat Lerer E, Levi S, Salomon S, Darvasi A, Yirmiya N, Ebstein RP: Association between the oxytocin receptor (OXTR) gene and autism: relationship to Vineland Adaptive Behavior Scales and cognition. Mol Psychiatry. 2008, 13: 980-988. 10.1038/sj.mp.4002087.CrossRefPubMed Lerer E, Levi S, Salomon S, Darvasi A, Yirmiya N, Ebstein RP: Association between the oxytocin receptor (OXTR) gene and autism: relationship to Vineland Adaptive Behavior Scales and cognition. Mol Psychiatry. 2008, 13: 980-988. 10.1038/sj.mp.4002087.CrossRefPubMed
25.
Zurück zum Zitat Yrigollen CM, Han SS, Kochetkova A, Babitz T, Chang JT, Volkmar FR, Leckman JF, Grigorenko EL: Genes controlling affiliative behavior as candidate genes for autism. Biol Psychiatry. 2008, 63: 911-916. 10.1016/j.biopsych.2007.11.015.PubMedCentralCrossRefPubMed Yrigollen CM, Han SS, Kochetkova A, Babitz T, Chang JT, Volkmar FR, Leckman JF, Grigorenko EL: Genes controlling affiliative behavior as candidate genes for autism. Biol Psychiatry. 2008, 63: 911-916. 10.1016/j.biopsych.2007.11.015.PubMedCentralCrossRefPubMed
26.
Zurück zum Zitat Ebstein RP, Israel S, Lerer E, Uzefovsky F, Shalev I, Gritsenko I, Riebold M, Salomon S, Yirmiya N: Arginine vasopressin and oxytocin modulate human social behavior. Ann NY Acad Sci. 2009, 1167: 87-102. 10.1111/j.1749-6632.2009.04541.x.CrossRefPubMed Ebstein RP, Israel S, Lerer E, Uzefovsky F, Shalev I, Gritsenko I, Riebold M, Salomon S, Yirmiya N: Arginine vasopressin and oxytocin modulate human social behavior. Ann NY Acad Sci. 2009, 1167: 87-102. 10.1111/j.1749-6632.2009.04541.x.CrossRefPubMed
27.
Zurück zum Zitat Liu X, Kawamura Y, Shimada T, Otowa T, Koishi S, Sugiyama T, Nishida H, Hashimoto O, Nakagami R, Tochigi M, Umekage T, Kano Y, Miyagawa T, Kato N, Tokunaga K, Sasaki T: Association of the oxytocin receptor (OXTR) gene polymorphisms with autism spectrum disorder (ASD) in the Japanese population. J Hum Genet. 2010, 55: 137-141. 10.1038/jhg.2009.140.CrossRefPubMed Liu X, Kawamura Y, Shimada T, Otowa T, Koishi S, Sugiyama T, Nishida H, Hashimoto O, Nakagami R, Tochigi M, Umekage T, Kano Y, Miyagawa T, Kato N, Tokunaga K, Sasaki T: Association of the oxytocin receptor (OXTR) gene polymorphisms with autism spectrum disorder (ASD) in the Japanese population. J Hum Genet. 2010, 55: 137-141. 10.1038/jhg.2009.140.CrossRefPubMed
28.
Zurück zum Zitat Wermter AK, Kamp-Becker I, Hesse P, Schulte-Körne G, Strauch K, Remschmidt H: Evidence for the involvement of genetic variation in the oxytocin receptor gene (OXTR) in the etiology of autistic disorders on high-functioning level. Am J Med Genet B Neuropsychiatr Genet. 2010, 153B: 629-639.PubMed Wermter AK, Kamp-Becker I, Hesse P, Schulte-Körne G, Strauch K, Remschmidt H: Evidence for the involvement of genetic variation in the oxytocin receptor gene (OXTR) in the etiology of autistic disorders on high-functioning level. Am J Med Genet B Neuropsychiatr Genet. 2010, 153B: 629-639.PubMed
29.
Zurück zum Zitat Meyer-Lindenberg A, Tost H: Neural mechanisms of social risk for psychiatric disorders. Nat Neurosci. 2012, 15: 663-668. 10.1038/nn.3083.CrossRefPubMed Meyer-Lindenberg A, Tost H: Neural mechanisms of social risk for psychiatric disorders. Nat Neurosci. 2012, 15: 663-668. 10.1038/nn.3083.CrossRefPubMed
30.
Zurück zum Zitat den Dunnen JT, Antonarakis SE: Mutation nomenclature extensions and suggestions to describe complex mutations: a discussion. Hum Mut. 2000, 15: 7-12. 10.1002/(SICI)1098-1004(200001)15:1<7::AID-HUMU4>3.0.CO;2-N.CrossRefPubMed den Dunnen JT, Antonarakis SE: Mutation nomenclature extensions and suggestions to describe complex mutations: a discussion. Hum Mut. 2000, 15: 7-12. 10.1002/(SICI)1098-1004(200001)15:1<7::AID-HUMU4>3.0.CO;2-N.CrossRefPubMed
31.
Zurück zum Zitat Munesue T, Yokoyama S, Nakamura K, Anitha A, Yamada K, Hayashi K, Asaka T, Liu HX, Jin D, Koizumi K, Islam MS, Huang JJ, Ma WJ, Kim UH, Kim SJ, Park K, Kim D, Kikuchi M, Ono Y, Nakatani H, Suda S, Miyachi T, Hirai H, Salmina A, Pichugina YA, Soumarokov AA, Takei N, Mori N, Tsujii M, Sugiyama T: Two genetic variants of CD38 in subjects with autism spectrum disorder and controls. Neurosci Res. 2010, 67: 181-191. 10.1016/j.neures.2010.03.004.CrossRefPubMed Munesue T, Yokoyama S, Nakamura K, Anitha A, Yamada K, Hayashi K, Asaka T, Liu HX, Jin D, Koizumi K, Islam MS, Huang JJ, Ma WJ, Kim UH, Kim SJ, Park K, Kim D, Kikuchi M, Ono Y, Nakatani H, Suda S, Miyachi T, Hirai H, Salmina A, Pichugina YA, Soumarokov AA, Takei N, Mori N, Tsujii M, Sugiyama T: Two genetic variants of CD38 in subjects with autism spectrum disorder and controls. Neurosci Res. 2010, 67: 181-191. 10.1016/j.neures.2010.03.004.CrossRefPubMed
32.
Zurück zum Zitat Gillberg C, Gillberg C, Rastam M, Wentz E: The Asperger Syndrome (and high-functioning autism) Diagnostic Interview (ASDI): a preliminary study of a new structured clinical interview. Autism. 2001, 5: 57-66. 10.1177/1362361301005001006.CrossRefPubMed Gillberg C, Gillberg C, Rastam M, Wentz E: The Asperger Syndrome (and high-functioning autism) Diagnostic Interview (ASDI): a preliminary study of a new structured clinical interview. Autism. 2001, 5: 57-66. 10.1177/1362361301005001006.CrossRefPubMed
33.
Zurück zum Zitat Lord C, Rutter M, Le Couteur A: Autism Diagnostic Interview-Revised: a revised version of a diagnostic interview for caregivers of individuals with possible pervasive developmental disorders. J Autism Dev Disord. 1994, 24: 659-685. 10.1007/BF02172145.CrossRefPubMed Lord C, Rutter M, Le Couteur A: Autism Diagnostic Interview-Revised: a revised version of a diagnostic interview for caregivers of individuals with possible pervasive developmental disorders. J Autism Dev Disord. 1994, 24: 659-685. 10.1007/BF02172145.CrossRefPubMed
34.
Zurück zum Zitat Autism Society Japan: Pervasive Developmental Disorders Autism Society Japan Rating Scale (PARS). 2006, Tokyo Autism Society Japan: Pervasive Developmental Disorders Autism Society Japan Rating Scale (PARS). 2006, Tokyo
35.
Zurück zum Zitat Wing L, Leekam SR, Libby SJ, Gould J, Larcombe M: The Diagnostic Interview for Social and Communication Disorders: background, inter-rater reliability and clinical use. J Child Psychol Psychiat. 2002, 43: 307-325. 10.1111/1469-7610.00023.CrossRefPubMed Wing L, Leekam SR, Libby SJ, Gould J, Larcombe M: The Diagnostic Interview for Social and Communication Disorders: background, inter-rater reliability and clinical use. J Child Psychol Psychiat. 2002, 43: 307-325. 10.1111/1469-7610.00023.CrossRefPubMed
36.
Zurück zum Zitat Kurita H, Miyake Y: The reliability and validity of the Tokyo Autistic Behavior Scale. Psychiat Clin Neurosci. 1990, 44: 25-32. 10.1111/j.1440-1819.1990.tb00438.x.CrossRef Kurita H, Miyake Y: The reliability and validity of the Tokyo Autistic Behavior Scale. Psychiat Clin Neurosci. 1990, 44: 25-32. 10.1111/j.1440-1819.1990.tb00438.x.CrossRef
37.
Zurück zum Zitat Shenoy AR, Visweswariah SS: Site-directed mutagenesis using a single mutagenic oligonucleotide and Dpn I digestion of template DNA. Anal Biochem. 2003, 319: 335-336. 10.1016/S0003-2697(03)00286-0.CrossRefPubMed Shenoy AR, Visweswariah SS: Site-directed mutagenesis using a single mutagenic oligonucleotide and Dpn I digestion of template DNA. Anal Biochem. 2003, 319: 335-336. 10.1016/S0003-2697(03)00286-0.CrossRefPubMed
38.
Zurück zum Zitat Amina S, Hashii M, Ma WJ, Yokoyama S, Lopatina O, Liu HX, Islam MS, Higashida H: Intracellular calcium elevation induced by extracellular application of cyclic-ADP-ribose or oxytocin is temperature-sensitive in rodent NG108-15 neuronal cells with or without exogenous expression of human oxytocin receptors. J Neuroendocrinol. 2010, 22: 460-466. 10.1111/j.1365-2826.2010.01978.x.CrossRefPubMed Amina S, Hashii M, Ma WJ, Yokoyama S, Lopatina O, Liu HX, Islam MS, Higashida H: Intracellular calcium elevation induced by extracellular application of cyclic-ADP-ribose or oxytocin is temperature-sensitive in rodent NG108-15 neuronal cells with or without exogenous expression of human oxytocin receptors. J Neuroendocrinol. 2010, 22: 460-466. 10.1111/j.1365-2826.2010.01978.x.CrossRefPubMed
39.
Zurück zum Zitat Hashii M, Minabe Y, Higashida H: cADP-ribose potentiates cytosolic Ca2+ elevation and Ca2+ entry via L-type voltage-activated Ca2+ channels in NG108-15 neuronal cells. Biochem J. 2000, 345: 207-215. 10.1042/0264-6021:3450207.PubMedCentralCrossRefPubMed Hashii M, Minabe Y, Higashida H: cADP-ribose potentiates cytosolic Ca2+ elevation and Ca2+ entry via L-type voltage-activated Ca2+ channels in NG108-15 neuronal cells. Biochem J. 2000, 345: 207-215. 10.1042/0264-6021:3450207.PubMedCentralCrossRefPubMed
41.
Zurück zum Zitat Tansey KE, Brookes KJ, Hill MJ, Cochrane LE, Gill M, Skuse D, Correia C, Vicente A, Kent L, Gallagher L, Anney RJL: Oxytocin receptor (OXTR) does not play a major role in the aetiology of autism: genetic and molecular studies. Neurosci Lett. 2010, 474: 163-167. 10.1016/j.neulet.2010.03.035.CrossRefPubMed Tansey KE, Brookes KJ, Hill MJ, Cochrane LE, Gill M, Skuse D, Correia C, Vicente A, Kent L, Gallagher L, Anney RJL: Oxytocin receptor (OXTR) does not play a major role in the aetiology of autism: genetic and molecular studies. Neurosci Lett. 2010, 474: 163-167. 10.1016/j.neulet.2010.03.035.CrossRefPubMed
42.
Zurück zum Zitat Campbell DB, Datta D, Jones ST, Batey Lee E, Sutcliffe JS, Hammock EA, Levitt P: Association of oxytocin receptor (OXTR) gene variants with multiple phenotype domains of autism spectrum disorder. J Neurodev Disord. 2011, 3: 101-112. 10.1007/s11689-010-9071-2.PubMedCentralCrossRefPubMed Campbell DB, Datta D, Jones ST, Batey Lee E, Sutcliffe JS, Hammock EA, Levitt P: Association of oxytocin receptor (OXTR) gene variants with multiple phenotype domains of autism spectrum disorder. J Neurodev Disord. 2011, 3: 101-112. 10.1007/s11689-010-9071-2.PubMedCentralCrossRefPubMed
43.
Zurück zum Zitat Cirulli ET, Goldstein DB: Uncovering the roles of rare variants in common disease through whole-genome sequencing. Nat Rev Genet. 2010, 11: 415-425. 10.1038/nrg2779.CrossRefPubMed Cirulli ET, Goldstein DB: Uncovering the roles of rare variants in common disease through whole-genome sequencing. Nat Rev Genet. 2010, 11: 415-425. 10.1038/nrg2779.CrossRefPubMed
45.
Zurück zum Zitat State MW, Levitt P: The conundrums of understanding genetic risks for autism spectrum disorders. Nat Neurosci. 2011, 14: 1499-1506. 10.1038/nn.2924.PubMedCentralCrossRefPubMed State MW, Levitt P: The conundrums of understanding genetic risks for autism spectrum disorders. Nat Neurosci. 2011, 14: 1499-1506. 10.1038/nn.2924.PubMedCentralCrossRefPubMed
46.
Zurück zum Zitat Bodmer W, Bonilla C: Common and rare variants in multifactorial susceptibility to common diseases. Nat Genet. 2008, 40: 695-701. 10.1038/ng.f.136.PubMedCentralCrossRefPubMed Bodmer W, Bonilla C: Common and rare variants in multifactorial susceptibility to common diseases. Nat Genet. 2008, 40: 695-701. 10.1038/ng.f.136.PubMedCentralCrossRefPubMed
47.
Zurück zum Zitat Schork NJ, Murray SS, Frazer KA, Topol EJ: Common vs. rare allele hypotheses for complex diseases. Curr Opin Genet Dev. 2009, 19: 212-219. 10.1016/j.gde.2009.04.010.PubMedCentralCrossRefPubMed Schork NJ, Murray SS, Frazer KA, Topol EJ: Common vs. rare allele hypotheses for complex diseases. Curr Opin Genet Dev. 2009, 19: 212-219. 10.1016/j.gde.2009.04.010.PubMedCentralCrossRefPubMed
48.
Zurück zum Zitat Innamorati G, Sadeghi H, Eberle AN, Birnbaumer M: Phosphorylation of the V2 vasopressin receptor. J Biol Chem. 1997, 272: 2486-2492. 10.1074/jbc.272.4.2486.CrossRefPubMed Innamorati G, Sadeghi H, Eberle AN, Birnbaumer M: Phosphorylation of the V2 vasopressin receptor. J Biol Chem. 1997, 272: 2486-2492. 10.1074/jbc.272.4.2486.CrossRefPubMed
49.
Zurück zum Zitat Hoare S, Copland JA, Strakova Z, Ives K, Jeng YJ, Hellmich MR, Soloff MS: The proximal portion of the COOH terminus of the oxytocin receptor is required for coupling to Gq, but not Gi: independent mechanisms for elevating intracellular calcium concentrations from intracellular stores. J Biol Chem. 1999, 274: 28682-28689. 10.1074/jbc.274.40.28682.CrossRefPubMed Hoare S, Copland JA, Strakova Z, Ives K, Jeng YJ, Hellmich MR, Soloff MS: The proximal portion of the COOH terminus of the oxytocin receptor is required for coupling to Gq, but not Gi: independent mechanisms for elevating intracellular calcium concentrations from intracellular stores. J Biol Chem. 1999, 274: 28682-28689. 10.1074/jbc.274.40.28682.CrossRefPubMed
50.
Zurück zum Zitat Krey JF, Dolmetsch RE: Molecular mechanisms of autism: a possible role for Ca2+ signaling. Curr Opin Neurobiol. 2007, 17: 112-119. 10.1016/j.conb.2007.01.010.CrossRefPubMed Krey JF, Dolmetsch RE: Molecular mechanisms of autism: a possible role for Ca2+ signaling. Curr Opin Neurobiol. 2007, 17: 112-119. 10.1016/j.conb.2007.01.010.CrossRefPubMed
51.
Zurück zum Zitat Ninan I: Oxytocin suppresses basal glutamatergic transmission but facilitates activity-dependent synaptic potentiation in the medial prefrontal cortex. J Neurochem. 2011, 119: 324-331. 10.1111/j.1471-4159.2011.07430.x.CrossRefPubMed Ninan I: Oxytocin suppresses basal glutamatergic transmission but facilitates activity-dependent synaptic potentiation in the medial prefrontal cortex. J Neurochem. 2011, 119: 324-331. 10.1111/j.1471-4159.2011.07430.x.CrossRefPubMed
52.
Zurück zum Zitat Ma Q, Lu AYH: Pharmacogenetics, pharmacogenomics, and individualized medicine. Pharmacol Rev. 2011, 68: 437-459.CrossRef Ma Q, Lu AYH: Pharmacogenetics, pharmacogenomics, and individualized medicine. Pharmacol Rev. 2011, 68: 437-459.CrossRef
53.
Zurück zum Zitat Relling MV, Giacomini KM: Pharmacogenetics. Goodman & Gilman’s The Pharmacological Basis of Therapeutics. Edited by: Brunton LL. 2011, New York: McGraw-Hill, 145-168. 12 Relling MV, Giacomini KM: Pharmacogenetics. Goodman & Gilman’s The Pharmacological Basis of Therapeutics. Edited by: Brunton LL. 2011, New York: McGraw-Hill, 145-168. 12
54.
Zurück zum Zitat MacDonald E, Dadds MR, Brennan JL, Williams K, Levy F, Cauchi AJ: A review of safety, side-effects and subjective reactions to intranasal oxytocin in human research. Psychoneuroendocrinology. 2011, 36: 1114-1126. 10.1016/j.psyneuen.2011.02.015.CrossRefPubMed MacDonald E, Dadds MR, Brennan JL, Williams K, Levy F, Cauchi AJ: A review of safety, side-effects and subjective reactions to intranasal oxytocin in human research. Psychoneuroendocrinology. 2011, 36: 1114-1126. 10.1016/j.psyneuen.2011.02.015.CrossRefPubMed
Metadaten
Titel
Non-synonymous single-nucleotide variations of the human oxytocin receptor gene and autism spectrum disorders: a case–control study in a Japanese population and functional analysis
verfasst von
Wen-Jie Ma
Minako Hashii
Toshio Munesue
Kenshi Hayashi
Kunimasa Yagi
Masakazu Yamagishi
Haruhiro Higashida
Shigeru Yokoyama
Publikationsdatum
01.12.2013
Verlag
BioMed Central
Erschienen in
Molecular Autism / Ausgabe 1/2013
Elektronische ISSN: 2040-2392
DOI
https://doi.org/10.1186/2040-2392-4-22

Weitere Artikel der Ausgabe 1/2013

Molecular Autism 1/2013 Zur Ausgabe

Neu in den Fachgebieten Neurologie und Psychiatrie

Akuter Schwindel: Wann lohnt sich eine MRT?

28.04.2024 Schwindel Nachrichten

Akuter Schwindel stellt oft eine diagnostische Herausforderung dar. Wie nützlich dabei eine MRT ist, hat eine Studie aus Finnland untersucht. Immerhin einer von sechs Patienten wurde mit akutem ischämischem Schlaganfall diagnostiziert.

Niedriger diastolischer Blutdruck erhöht Risiko für schwere kardiovaskuläre Komplikationen

25.04.2024 Hypotonie Nachrichten

Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.

Frühe Alzheimertherapie lohnt sich

25.04.2024 AAN-Jahrestagung 2024 Nachrichten

Ist die Tau-Last noch gering, scheint der Vorteil von Lecanemab besonders groß zu sein. Und beginnen Erkrankte verzögert mit der Behandlung, erreichen sie nicht mehr die kognitive Leistung wie bei einem früheren Start. Darauf deuten neue Analysen der Phase-3-Studie Clarity AD.

Viel Bewegung in der Parkinsonforschung

25.04.2024 Parkinson-Krankheit Nachrichten

Neue arznei- und zellbasierte Ansätze, Frühdiagnose mit Bewegungssensoren, Rückenmarkstimulation gegen Gehblockaden – in der Parkinsonforschung tut sich einiges. Auf dem Deutschen Parkinsonkongress ging es auch viel um technische Innovationen.