Preimplantation genetic diagnosis of hemophilia A

Since the publication of the sequence of the F8 in 1984, more than 2000 gene mutations causing HA have been described and these are catalogued in the Human Gene Mutation Database (HGMD; http://​www.​hgmd.​cf.​ac.​uk/​ac/​index.​php) and Factor VIII Variant Database (http://​www.​factorviii-db.​org/​). In 2008, we had first published the mutation spectrum in the Taiwanese population [6]. Of 31 unrelated HA patients (19 severe and 10 moderate/mild males, and 2 severe females), 12 (38.7 %) and 1 (3.2 %) severe males were genotyped with INV22 and INV1 respectively. The F8 defects in the remaining 18 inversion-negative patients cover a wide spectrum, in which 17 different mutations were identified (10 missense and 3 nonsense mutations, and 2 small and 2 large deletions). Eleven of these mutations are novel and unique, confirming a high diversity of molecular defects in HA [6]. A systematic review for data from 30 studies on 5383 patients had been reported and showed 45 % of HA had INV22, 2 % INV1, 3 % large deletions, 16 % small deletions or insertions, and 28 % point mutations (15 % missense mutations, 10 % nonsense mutations, and 3 % splicing site mutations). In 4.6 % of patients, the mutation was unknown [12]. Overall, with the exceptions of recurrent INV22 and INV1, no mutation hot spots have been identified.

There are a number of different approaches for the genotyping of HA (Table 1). For reasons of rapid and smart screening, however, targeted mutation analysis for the recurrent INV22 and INV1 has become the first test assessed in patients (particularly in severely affected hemophiliacs). INV22 can be detected by Southern blotting or, more time- and labor-saving choice, by long-distance polymerase chain reaction (long-distance PCR) or inverse PCR (I-PCR) [13, 14]. INV1 is typically detected by multiplex PCR [15]. Other mutations responsible for HA are mostly point mutation and small deletion/insertion in the F8 gene and their spectrum is quite complex. In these cases, mutation can be detected by PCR with a number of screening methods (e.g., single strand conformational polymorphism, conformation sensitive gel electrophoresis, amplification and mismatch detection, denaturing gradient gel electrophoresis) followed by direct DNA sequencing [16‐21]. For female patients with only one mutation detected and also in those females suspected to be carriers but no mutation could be found, gene dosage assays such as multiplex ligation-dependent probe amplification (MLPA) should be applied to screen for the underlying exon deletions since deletions in single allele usually escape detection by the PCR-based analysis, due to the masking of the non-deleted allele. In Fig. 1, we exemplified the MLPA finding of a female HA patient who was karyotyped as 45,X [22]/46,X,idic(X)(q21) [8] mosaicism. Her aberrant X-chromosome (idic(X)(q21)) do not contain the Xq22q28 (and thus F8 gene) and familiar follow-up studies demonstrate this anomaly is of de novo. PCR amplification for exon1-22 of the F8 is failure in patient but is successful in her parents. Through the MLPA analyses, it is evidenced that the patient carries an exon 1–22 deletion in the allele on her “morphologically-normal” X-chromosome, which is inherited from her mother (Fig. 1).

Given the marked morbidity associated with severe HA, PGD has become a feasible option for couples at risk of having a child with HA since it reduces the risk of termination of affected pregnancies. Gender selection by fluorescence in situ hybridization (FISH) and transfer of only female embryos is a simple strategy for X-linked recessive disorders, such as HA, and has been adopted in many clinics [11]. However, in practice, gender selection is illegal in some countries (e.g., Taiwan) and methods allowing the correct and more definitive diagnosis of the HA status of every embryo are more desirable because the number of embryos available for transfer is increased. PGD involving whole genome amplification (WGA) step was broadly applied to mutation detection strategies, but the high rate of amplification bias renders WGA an imperfect option [22]. Recently, co-amplification of polymorphic microsatellite markers, linked with the targeted mutation, had been the gold-standard genotyping strategy for PGD [4, 23‐26] (Table 1). A linkage approach using polymorphic markers located near the mutation allows monitoring the occurrence of allele dropout, a known problem associated with PCR amplification bias in PGD. Below, we describe our experience with two HA families seeking for PGD.

Two Taiwanese couples were referred to our center for PGD of HA. Preliminary genetic testing of F8 for two couples showed the two wives are both HA carriers: one has a splicing site mutation, c.1538-1G > A, and the other has a common INV22. For the family with c.1538-1G > A mutation, an in-house developed duplex-nested ARMS-qPCR was customized designed for PGD [4, 5]. The optimized PGD protocol was then performed to detect the disease-causing mutation in embryos acquired after ovarian stimulation. Seven single blastomeres biopsied from corresponding day-3 (8-cell cleavage-stage) embryos were collected and examined independently in a sterile PCR tube. Each blastomere cell was lysed with 125 μg/mL proteinase K at 50 °C for 60 min and inactivated at 99 °C for 4 min. Duplex-nested PCR was then used to amplify the intron 10–11 region of F8 gene, which includes the targeted mutation. The two primer sets, designed based on the reverse strand’s F8 gene sequence, were OF: CTGAGGACCCATTACCCTGA and OR: CCTGCAACAGTGCTACATGC for the first PCR (amplicon size: 937 bp), and IF: CTTGCTCCCTTTCCTCACAG and IR: TGGGGAGGATCAGCTAGAGA for the secondary PCR (amplicon size: 757 bp) (Fig. 2a). The first PCR was carried out in a 40 μL reaction, consisting of 1X PCR buffer, 1.25 mmol/L MgCl₂, 0.35 mmol/L dNTP, each 0.5 μmol/L of OF and OR primer, 1X GC-RICH solution, and 1U Faststart Taq DNA polymerase (Roche Diagnostics GmbH, Mannheim, Germany). The cycling conditions were 95 °C, 5 min, followed by 25 cycles of 95 °C, 30 s, 55 °C, 30 s and 71 °C, 1 min, and a final extension at 71 °C, 2 min. The PCR products were directly subjected to the second round of PCR by adding 10 μL PCR supplement with a similar PCR mixture to that used in the first PCR, except for the primer set (IF and IR). Cycling conditions were similar to the first PCR, but the number of cycles in the second step was increased from 25 to 40. To ensure an accuracy of the PCR, amplified fragments were confirmed by direct sequencing. For ARMS-qPCR, two sequence-specific forward primers, modified with a mismatch at the penultimate nucleotide position of the mutation site to increase the specificity of the reaction, were designed: (MUF: TATGGTTTTGCTTGTGGGTGA for the mutant allele and WTF: TATGGTTTTGCTTGTGGGTGG for the wild-type allele). The two forward primers were respectively paired with the same reverse primer 3rdR: TGAGGAGAGGGCCAATGAGT (amplicon size:198 bp) (Fig. 2b). The ARMS-qPCR performed on the LightCycler 480 Real-Time PCR System (Roche, Mannheim, Germany) in a 20 μL reaction, consisted of 0.5 ng of the duplex-nested PCR product, 0.5 μmol/L of each primer, 1X SYBR Green PCR Master Mix (Finnzymes, Espoo, Finland). Cycling conditions were: 95 °C, 10 min, followed by 45 cycles at 95 °C, 10 s, 60 °C and 60 s. The exemplified results of ARMS-qPCR were shown in Fig. 2c. Of the seven blastomeres examined, two were reported as affected embryos with the homo- or hemizygous c.1538-1G > A mutation, one was known as a heterozygous carrier, and the remaining four were presented as same as wild-type pattern without the mutation. However, only one unaffected embryo kept good morphology and was transferred on day 5. After 39 weeks of uneventful gestation, one healthy baby girl was born successfully with a birth weight of 3040 g. Postnatal genotyping confirmed the girl to be an unaffected carrier and, interestingly, she was HLA-compatible with her older brother affected by HA (see family 1 in Fig. 3).

The INV22 of F8 is one of the most frequent cause of severe HA, known as a result of homologous recombination between the int22h-1 region within the F8 locus and either int22h-2 (Inv22 type II) or int22h-3 (Inv22 type I), which lie nearly 400 kb distal to F8 [27]. The gene rearrangements tend to increase the difficulty of PGD experimental design performed in the affected families. In the second PGD family with F8 INV22 mutation, the couple (2–1 and 2–2) has had a healthy boy and they would like to get more babies without HA. We performed 3 PGD cycles of HA during the period of Sep. 2014 to Dec. 2015 using short tandem repeat (STR) markers and capillary electrophoresis for direct linkage analysis. Five informative STR markers distributed within or near the flanking region of the F8 were selected for PGD performing (see family 2 in Fig. 3). Among a total of 19 examined embryos, 5 wild types and 4 INV22 carriers were selected and transferred during the period. Unfortunately, pregnancy outcome did not occur as expected, possibly due to ad maternal age, embryo morphology, development and other abnormalities. Despite the fact that no pregnancy was achieved in the PGD experience so far, they are still willing to keep trying.