Background
Human mesenchymal stromal /stem cells (hMSCs) is a group of fibroblast-like multipotent cells existing in almost all tissues with a limited self-renewal and differentiation potential to multiple cell lineages of endoderm, mesoderm and ectoderm [
1]. The hMSCs of various tissue origins also exhibit unique immunomodulatory activities, which make hMSCs the most popular cell type used in stem cell-based therapies [
2,
3]. To achieve the best clinical efficacy from hMSCs therapy, it is necessary to fully understand its immunomodulation, which represents the most important quality attribute of biological effectiveness of hMSCs.
The immunomodulation of hMSCs are manifested in part by their abilities to modulate almost all immune cells, such as T and B lymphocytes, natural killer cells [
4], macrophages [
5], and neutrophils [
6]. During modulating CD4
+ T lymphocytes, hMSCs inhibit proliferation and activity of pro-inflammatory lymphocytes, such as Type 1 T helper (Th1) and Type 17 T helper (Th17) subpopulations and promote polarization of regulatory T lymphocytes (Tregs) through cell-cell interaction and/or secretion of immunomodulatory molecules [
7]. Among the key molecules, the Indoleamine 2,3-dioxygenase 1 (IDO1) protein still represents a major research interest of the immunomodulation of hMSCs [
8].
IDO1 is a rate-limiting enzyme for catalizing tryptophan into kynurenine [
9]. Its expression is induced by pro-inflammatory molecules, such as IFN-γ, TNF-α or IL-1α [
10]. The importance of IDO1 in the immunomodulation of hMSCs has been established partially through employing either IDO1 silencing or small molecule IDO1 inhibitor, i.e. 1-methyl-L-tryptophan (1-L-MT). The IDO1 inhibition can cause significant reduction of various immunomodulatory activities of hMSCs, such as the reduction of inhibiting Th1 lymphocyte proliferation or promoting Treg polarization [
8,
11]. However, even though the IDO1 activities have been characterized in substantial details, the molecular mechanisms, particularly the cell signaling pathways involved in regulating IDO1 activity, still remain largely unknown.
Among various signaling pathways, the Notch1 signaling has been previously revealed for promoting the immunomodulation of hMSCs [
8]. The Notch1 signaling is activated sequentially through binding of Notch1 proteins to their ligands on surface of adjacent cells and two successive proteolytic cleavages mediated by TNF-α converting enzyme (TACE) and γ-secretase/presenilin complex [
8]. Different types of γ-secretase inhibitors have been used as experimental tools to unveil novel functions of Notch signaling [
12]. Among the most commonly used inhibitors is a small peptide inhibitor Gamma-secretase inhibitor I (GSI-I), which shares both structural and functional similarities with Botezomib, a proteasome inhibitor used frequently in cancer research [
13]. The cleavage by γ-secretase results in release of the Notch1 intracellular domain (NICD1) from plasma membrane and the NICD1 translocation into the nucleus, where it binds the CBF1/RBP-Jk; Su(H)/Suppressor of Hairless; Lag-1 (CSL) protein complex and turns the complex from transcriptional repressor into transcriptional activator with consequent activation of downstream effectors of the Notch1 signaling [
14].
Among the downstream effectors of Notch1, hairy and enhancer of split-1 (Hes1) and Hairy/enhancer-of-split related with YRPW motif protein 1 (Hey1) have been more intensely studied [
15]. These two effectors may represent different aspects of the Notch1 signaling. For example, over-expression of Hey1, but not Hes1, induced over an 80-fold decrease in Collagen Type II Alpha 1 Chain (
Col2a1) transcription in a 3-dimentional differentiation induction model, suggesting that the Notch signaling played an inhibitory role on chondrogenic differentiation, in which the Notch1-Hey-1 axis, rather than the Notch1-Hes1 axis, was most likely involved [
16]. In addition, Hes1 and Hey1 might be differently involved in tissue development, whereas Hes1 was involved in the development of brain, skin and adipose tissues, Hey1 was associated with the development of heart and vasculature [
17]. All these findings thus suggested that different Notch1 signaling axis may mediate different functional aspects of hMSCs.
The Deleted in Liver Cancer-1 (DLC-1) protein has been established as a tumor suppressor with abilities to inhibit growth, migration, invasion and metastasis of a large variety of common cancers [
18‐
20]. While the DLC-1 gene expresses in almost all normal tissues, it is frequently absent or dramatically down-regulated in tumor tissues mainly due to genomic deletion and/or aberrant methylation at the promoter region of the gene [
21]. In addition, the DLC-1 protein is subjected to cytoplasmic sequestration and proteasome-mediated degradation [
22,
23], which may be governed by the CUL4A–DDB1–FBXW5 E3 ubiquitin ligase complex [
24].
The DLC-1 protein is a multi-domain protein comprising of a Sterile Alpha Motif (SAM) domain, a Rho GTPase-Activating Protein (RhoGAP) domain and a StAR-related lipid-transfer (START) domain in its N-terminus, middle and C-terminus, respectively. In addition, it possesses a bipartite nuclear localizing sequence (NLS) responsible for DLC-1 protein nuclear translocation and a serine-rich region likely for regulating the NLS activity [
23]. Among the major functional domains, the RhoGAP domain is highly conserved responsible for catalyzing hydrolysis of Guanosine-5′-triphosphate (GTP) into guanosine diphosphate (GDP) and subsequent inactivation of small Rho subfamily proteins, such as the Ras homologous A/B/C (RhoA/B/C) and Cell division control protein 42 homolog (Cdc42) proteins. A prominent downstream effector of the small Rho proteins is Rho-associated protein kinase 1/2 (Rock1/2), which transmit various activities of the Rho proteins in different types of cells [
25].
In this study, we discovered a mutual exclusion crosstalk between the DLC-1 signaling and the Notch1 signaling in human umbilical-cord-derived mesenchymal stromal /stem cells (hUC-MSCs) following the search of candidate proteins subjective to proteasome-mediated protein degradation. The crosstalk detailed that the DLC-1 signaling in a way of FBXW5-DLC-1-Rock1 was inhibitory to the immunomodulation of hUC-MSCs and able to interact with the Notch1 signaling represented by the Notch1-Hey1 axis in a mutual exclusion manner, thus likely providing a fine-tuning mechanism in the regulation of immunomodulation of hMSCs.
Methods
Materials
Cells: hUC-MSCs was gifted anonymously from TuoHua Biotech company (Siping, China), where the cells were isolated and purified from Wharton’s Jelly of a discarded umbilical cord. The expression of the featured surface markers of hMSCs, the differentiation potentials to osteocytes, chondrocytes and adipocytes, and microbiological safety were tested for hUC-MSCs in our laboratory. Peripheral blood mononuclear cells (PBMCs) were freshly isolated using a conventional Ficoll method [
26] from whole blood of healthy donors provided anonymously from local Red Cross. All data analysis associated with the use of hUC-MSCs and PBMCs in this study was conducted anonymously.
Antibodies: the antibodies against IDO1, NICD1, DDB-1 and phosphor-STAT1 at Y701 (pSTAT1) were from Cell Signaling (Danvers, MA); the antibodies against DLC-1, from BD Bioscience (Franklin Lakes, NJ); the antibodies against ubiquitin, Hes1, Hey1, Rock1 and Rock2, from Santa Cruz Biotechnology (Dallas, TX); the antibodies against Cullin 4A and FBXW5, from Abcam (Cambridge, MA); the antibody against β-actin, from Sigma (Milwaukee, WI); Horseradish peroxidase (HRP)-conjugated anti-mouse or anti-rabbit secondary antibodies, from GE Healthcare (Piscataway, NJ). All antibodies conjugated with different fluorescent dyes were from BD Bioscience.
Constructs: pIDO1-Luc, pcDNA3.1-DLC-1, −DLC-1-Δ622, −DLC-1-662, −DLC-1-R718E containing a R718E point mutation in RhoGAP domain, and -DLC-1-RhoGAP, which is the RhoGAP domain only mutant, were constructed in previous studies [
8,
23].
Chemicals: GSI-I (SCP0004) and DAPT (D5942), γ-secretase inhibitors, were purchased from Sigma Aldrich (St. Louis, MI); Bortezomib, a proteasome inhibitor, was from ChemieTek (Indianapolis, IN); Y27632, a pan-Rock inhibitor, from EMD Millipore (Darmstadt, Germany); Phorbol-12-myristate-13-acetate (PMA) was from R&D (Minneapolis, MN), Ionomycin was from Santa Cruz Biotechnology (Dallas, TX), Brefeldin A (BFA) was from Abcam (Cambridge, MA).
Detection of hMSCs surface markers
The hUC-MSCs surface markers, i.e. CD105, CD90 and CD73, were detected by flow cytometry using BD Stemflow hMSC Analysis Kit following the procedures described previously [
8,
27].
Osteogenic differentiation
The osteogenic differentiation of hUC-MSCs was examined by detecting the expression of Response Gene to Complement 32 protein (RGC32), an effective biomarker of osteogenesis revealed and validated in previous studies, via a real-time Polymerase chain reaction (PCR) following previously described procedures for the induction of osteogenic differentiation described previously [
8].
Semi-quantitative PCR
Conventional semi-quantitative RT-PCR was employed to detect mRNA expression of Hes-1 and Hey-1 in hUC-MSCs following various treatments. The expression of Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control for the semi-quantitation. The sets of primer sequences were: AGCACAGACCCAAGTGTGCTG and GAAGGTGACACTGCGTTGGG, for HES-1; ACGAGAATGGAAACTTGAGTTCGGC and CCCAAACTCCGATAGTCCATAGCAAG, for HEY-1; ACCACAGTCCATGCCATCAC and TCCACCACCCTGTTGCTGT, for GAPDH.
Real-time PCR with SYBR Green quantification were set up using 1/20 of each complementary DNA (cDNA) preparation in Applied Biosystems® 7500 Real-Time PCR Systems (Thermo Fisher scientific, Waltham, MA). Quantitative analysis was conducted by normalizing the expression level of the testing gene to that of GAPDH. The primer sequences were: GAAGTTCTGGGTCCTTTCATC and GCATGGATCGTCTGTTCTAATA, for RGC32; GGGCTGTGGAGTTTGGTGTC and CTGCTTGGGTGGGTGGAG, for Runx2; GATGGATTCCAGTTCGAGTATG and AGTGACGCTGTAGGTGAA, for Collagen I; TGCCTTTCCTGTAACGTTGGA and CCACAATGTTCTCTTCCCAAG, for Osterix; GGTCACTGATTTTCCCACGGA and TGGATGTCAGGTCTGCGAAAC, for Osteopontin; CTGACCACATCGGCTTTC and CAGATTCCTCTTCTGGAGTTTAT, for BGLAP; AGGCTGGAGAGGCGGCTAAG and TGGAAGGTGACACTGCGTTGG, for HES1; GGATCACCTGAAAATGCTGCATAC and CCGAAATCCCAAACTCCGATAG, for HEY1; GCCGGACACCATGATCCTAAC and GAGCCTCAATGGCATCTCTGT, for DLC-1; GTGTGAACCATGAGAAGTATGA and TAGAGGCAGGGATGATGTT, for GAPDH.
Inhibition of Th1 lymphocyte proliferation
The effect of hUC-MSCs on inhibiting proliferation of Th1 lymphocytes from the PIB (acronym for PMA, Ionomycin and BFA)-induced PBMCs was examinedfollowing the previously reported procedures [
8]. Briefly, fresh PBMCs were co-cultured with hUC-MSCs in 5:1 ratio for 18 h in RPMI 1640 complete medium containing 10% FBS and then stimulated with PIB (25 ng/ml PMA, 1 μg/ml Ionomycin and 10 μg/ml BFA) for another 5 h. Then, the PBMCs of all testing groups were collected and stained with both PerCP-Cy5.5-conjugated CD3 and FITC-conjugated CD8 for 30 min at room temperature. The PMBCs were then fixed with 4% paraformaldehyde fix solution for 15 min at room temperature. After that, the PBMCs were incubated with permeabilization medium containing PE-conjugated IFN-γ in dark for 30 min at room temperature. Finally, the PBMCs were washed twice with PBS, and analyzed using BD FACS Calibur flow cytometer. Using flow cytometry, the CD3 positive lymphocytes were gated first, the CD8
−IFN-γ
+ subpopulation was then identified as Th1 lymphocytes, the CD3
+CD8
−IFN-γ
+ cells.
Western blotting
The procedures of conventional Western blotting were followed to monitor changes in expression of relevant proteins in hUC-MSCs following various treatments [
8].
Immunoprecipitation (IP) for detecting the expression of poly-ubiquitinated proteins
The Cell lysates extracted using RIPA buffer from 1.5 × 106 cells treated with GSI-I or Bortezomib were incubated with 1 μg antibody of the targeted protein for IP at 4 °C overnight, then incubated with protein A/G agarose at 4 °C for 1 h. After washing three times at room temperature, the agarose-bound cell lysates were then analyzed by Western blotting using ubiquitin antibody.
Transient cDNA or small interfering RNA (siRNA) transfection
The procedures reported previously for either cDNA or siRNA transfection were followed for either over-expressing, or silencing the expression of the genes to be tested. Each plasmid DNA transfection was conducted using lipofectamine 2000-mediated transfection. To achieve equal transfection efficiency from different plasmid DNAs and to avoid biased results among different transfections in each individual experiment, all plasmid DNAs were extracted by the same laboratory personnel in the same time using endotoxin-free extraction kit following the same extraction and quality testing protocols. All plasmid DNAs used in each transfection experiment were carefully calculated to ensure all of them being in equal molar concentration. In addition, the transfection efficiency of each individual experiment was evaluated by Western blotting using β-actin as internal control to ensure equal amount of cells among different transfection groups were utilized in each individual experiment. The siRNA transfection was employed to silence the expression of Notch1, DLC-1, Hes-1 or Hey-1 in hUC-MSCs and the silencing effect for each target was determined by Western blotting or RT-PCR [
8]. The siRNA sequences were CACCAGUUUGAAUGGUCAAtt for Notch1; AGAACAGCACCUCUGGGAUtt for DLC-1, CGAGGUGACCCGCUUCCUGtt (1#) [
28] and AGACGAAGAGCAAGAAUAAtt (2#) [
29] for Hes1, and GUGCGGACGAGAAUGGAAAtt (1#) and GACCGGAUCAAUAACAGUUtt (2#) for Hey1 [
30]. The siRNA for Rock1 (sc-29,473) and Rock2 (sc-29,474) were purchased from Santa Cruz Biotechnology (Dallas, TX). The randomly scrambled siRNA was used as negative control.
Construction of Notch1 and NICD expression vector
The pcDNA3.1-Notch1 containing full-length Notch1 cDNA was kindly provided by Dr. Jon C. Aster [
31]. The cDNA of NICD1 was amplified by RT-PCR from total RNA of hUC-MSCs and constructed into the pcDNA3.1 expression vector. The primer sequences used for amplifying NICD were: 5′-GC
TCTAGAGTGCTGCTGTCCCGCAAGCG-3′ and 5′-CCC
AAGCTTTTCAACTTCCCTTCTCCAACATCATTTC-3′, in which Xbal and HindIII restriction sites were added for subcloning.
Luciferase assay
The luciferase assay was employed for detecting IDO1 promoter activity. The pIDO1-Luc vector used for the assay was constructed and characterized in a previous study [
8]. The procedures reported previously were followed for detecting IDO1 promoter activity in response to IFN-γ in hUC-MSCs [
8].
Data analysis
The data collected from the assays of cell viability, surface markers, luciferase-based promoter activity and Th1 lymphocyte proliferation were expressed as means ± SEM of at least three separate experiments. Comparison between group means was assessed using one-way analysis of variance with Newman–Keuls posttest (GraphPad Prism 4.0 Software, Inc., San Diego, CA, USA). The difference with P < 0.05 was considered significant.
Discussion
The unique immunomodulatory activities provide hMSCs a great versatility in managing various inflammatory/immune situations for treating a large variety of uncontrolled inflammatory or abnormal immune diseases. It is then reasonable to believe that the fine-tuned regulatory mechanisms yet to be identified must be always available for ensuring hMSCs to effectively sense various inflammatory environments for precisely modulating the corresponding inflammations utilizing precisely oriented regulatory capacities. Therefore, the endeavor to understand the fine-tuned mechanisms endowing such versatility is extremely important for fully appreciating the therapeutic effects of hMSCs. With a set of novel evidence, the present study demonstrates that a crosstalk between two important cell signaling represents a means of fine-tuning the immunomodulation of hMSCs.
The two signaling revealed in this study are the Notch1-Hey1 signaling and the FBXW5-DLC-1-Rock1 signaling, which regulate the immunomodulation of hMSCs in opposite directions. Whereas the Notch1-Hey1 signaling promotes, the FBXW5-DLC-1-Rock1 signaling inhibits, the immunomodulation of hMSCs. More importantly, the activities of these two signaling are mutually exclusive, thus providing a means of fine-tuning the immunomodulation of hMSCs.
The mutual exclusion mechanism presented in this study is built up on a hypothesis proposed previously that some protein(s) subjective to proteasome-mediated protein degradation may antagonize the Notch1 signaling in regulating the immunomodulation of hUC-MSCs [
8]. Although the search for DLC-1 represents the authors’ preferential long-term interest, the result from the search indeed supports that DLC-1 serves as a good candidate fitting the hypothesis.
The DLC-1 tumor suppressor was first revealed in this study as a potential modulator of the surface markers of hMSCs, the CD105 in particular, suggesting it may be associated with overall quality of hMSCs, as CD105 is involved in multiple functions of hMSCs, including osteogenic differentiation [
8,
34], angiogenesis [
35], and regenerative/therapeutic potential [
36]. However, the most important finding about DLC-1 in this study was the interaction between DLC-1 signaling and Notch1 signaling in regulating the immunomodulation of hMSCs.
From thoroughly analyzing the key members of each signaling and their involvement in the relationship between DLC-1 and Notch1, a sophisticated mutual exclusion mechanism between the two signaling then emerges.
On the side of the DLC-1 signaling, this study reveals for the first time that the DLC-1 tumor suppressor is able to inhibit the immunomodulation of hUC-MSCs. This novel activity of DLC-1 is supported by the evidence that the change in DLC-1 expression is directly associated with the change of IFN-γ-induced IDO1 expression and the inhibition of Th1 lymphocyte proliferation by hUC-MSCs (Fig.
3). In this regard, the activity of DLC-1 appears to be both RhoGAP domain-dependent and RhoGAP domain-independent, although the structural integrity of the protein is needed (Fig.
4). Nevertheless, this novel finding may be of great importance as hMSCs exist abundantly in tumor microenvironment and contribute to the immunosuppression for tumor progression, especially the metastatic progression [
37]. If DLC-1 can inhibit the immunosuppression of hMSCs, it then exerts its tumor suppressor functions on both seeds (tumor cells) and soil (mesenchymal cells) in tumor microenvironment according to the ‘seed-soil’ theory of tumorigenicity [
38].
When functioning in hMSCs in the association with treating inflammatory diseases, the regulation of DLC-1 by proteasome-mediated protein degradation, rather than genomic deletion and/or epigenetic changes, may provide a flexible mechanism allowing DLC-1 to exert its activity in hMSCs on the basis of necessity. In comparison, genomic deletion and/or aberrant methylation occurring frequently for DLC-1 in different human cancers represent the more rigid mechanism(s) necessary for tumor cells to achieve a complete knock-down of the tumor suppressor functions of DLC-1.
Concerning the composition of the E3 ligase complex responsible for degrading DLC-1 protein, our study suggests that the complex is composed mainly of the DDB1 and FBXW5 E3 ligases in hMSCs. However, in a set of lung cancer cells, the complex responsible for degrading DLC-1 comprises CULT4, DDB1 and FBXW5 E3 ligases all together, thus suggesting the difference existing in the composition of E3 ligases between cancer cells and hMSCs [
24]. This notion is supported by a study, in which DDB1 and FBXW7, which is in the same family with FBXW5, is sufficient to form an E3 ligase complex without CUL4A for degrading MYC proteins [
39], supporting that two E3 ligases, i.e. DDB1 and FBXW5, rather than three ligases are sufficient for mediating DLC-1 degradation in hMSCs. The discrepancy between lung cancer cells and hUC-MSCs in the composition of E3 ligase proteins may represent different regulation stringencies needed in different types of cells. The regulation for DLC-1 protein stability may be more stringent in parenchymal cells with three E3 ligases than that in mesenchymal cells using two E3 ligases, thus providing more flexibility for DLC-1 in regulating the immunomodulation of hMSCs.
On the side of the Notch1 signaling, we first advanced our understanding about the involvement of Notch1 in immunomodulation of hMSCs by demonstrating that the Notch1 signaling diverges at the level of Hey1 and Hes1 regarding the immunomodulation of hMSCs. The new evidence revealed from the experiments employing either gene silencing or γ-secretase inhibitors GSI-I and DAPT suggest that the Notch1-Hey1 axis, rather than the Notch1-Hes1 axis, is likely involved in the immunomodulation of hMSCs (Figs.
7 and
s1). As the Notch signaling possesses a large variety of functions, the distinguished roles between Hey1 and Hes1 downstream of the Notch1 signaling are of highly realistic relevance because different downstream effectors of any functionally diverse signaling need to represent different functional perspective of the signaling. More importantly, the distinction between Hey1 and Hes1 provides a sophisticated multi-level basis on the side of the Notch1 signaling for establishing the mutual exclusion relationship between Notch1 and DLC-1.
The multi-level mutual exclusion relationship between the two signaling is identified by employing a general approach, in which the function of the key molecule of each signaling was characterized for its association with the function of the opposite signaling in terms of regulating the immunomodulation of hMSCs. Through the characterization, each of the DLC-1, FBXW5 and Rock1 proteins of the DLC-1 signaling showed the ability to inhibit the expression of NICD1 and Hey1 and the associated immunomodulation of hMSCs (Fig.
7). Similarly, both Notch1 and Hey1 were demonstrated for their activity of reducing the expression of DLC-1, but inducing the expression of FBXW5 (Figure
s2). Interestingly, although both FBXW5 and DDB1 are directly involved in regulating DLC-1 protein stability, it is FBXW5, but not DDB1, that is directly involved in the mutual exclusion relationship, thus leading to a possibility that, within the E3 ligase complex responsible for degrading DLC-1, it is the FBXW5 protein that is more likely to act as a sensor for detecting the degradation signal released from the Notch1 signaling.
The characterization also leads to a conclusion that the mutual exclusion relationship between the DLC-1 and Notch1 signaling is formed by the intra-signaling and inter-signaling transduction. The intra-signaling transduction along the DLC-1 signaling is in the order of FBXW5-DLC-1-Rock1. The inter-signaling transduction concerns mutual crosstalk between the two signaling; the crosstalk can be initiated at multiple levels of each signaling, transducted through the intra-signaling, released via the inter-signaling, and then sensed or received by the opposite signaling. It is thus imaginable that this type of crosstalk can provide a basis for achieving a mutual inhibition/exclusion of the two signaling regarding the regulation of the immunomodulation of hMSCs. For example, the inter-signaling transduction initiated in the Notch1 signaling can be transduced to the Hey1 protein and then released to the FBWX5 protein of the DLC-1 signaling for achieving the enhanced immunomodulation through inhibiting the DLC-1 signaling. With both inter- and intra- signaling transduction, the multi-level mutual exclusion mechanism can then provide a sophisticated automation system for fine-tunning the immunomodulation of hMSCs. The importance of this fine-tuned system is to set up a constantly dynamic control to sense and meet different needs of immunomodulation in various inflammatory environments.
With the framework about the crosstalk between the two signaling being proposed, a set of preliminary data provided in this study also suggests the existence of negative feedback control mechanism within each signaling for regulating the activity of that signaling. Within the DLC-1 signaling, the Rock2 protein may serve as a negative feedback molecule for limiting the activity of the DLC-1 signaling as the Rock2 inhibition induced by siRock2 or Y27632, which exhibits a more preferential inhibition on Rock2 than Rock1 in our experiments, inhibits DLC-1 protein expression while elevating IDO1 expression (Figure
s3). Similarly, within the Notch1 signaling, the Hes1 protein may serve as a negative feedback molecule for inhibiting the Notch1 signaling as the Hes1 silencing elevates NICD1 and IDO1, but decreases DLC-1, an apparently opposite effect to the Hey1 silencing. The negative feedback control branched from the downstream effector of each signaling represents a common and effective control mechanism seen in different cell signaling pathways [
40] and provides an additional level of the sophistication to the mutual exclusion crosstalk. Nevertheless, further investigation for the importance of the negative feedback mechanisms is warranted.
While more mechanistic studies are needed for fully understanding the mutual exclusion mechanism, one previous observation about the association of Caveolin-1 with the activity of γ-secretase may help interpret the signaling transduction from DLC-1 to Notch1. The DLC-1 protein can bind the Caveolin-1 protein in a START domain-dependent manner [
41,
42]. The binding may lead to a negative regulation of γ-secretase activity as the Caveolin-1 protein is involved in the attenuation of γ-secretase-mediated proteolysis of Notch1 [
43]. Nevertheless, further investigations are warranted to address all relevant details mediating the crosstalk between the two signaling before fully understanding the mutual exclusion crosstalk between them.
Besides the future mechanistic studies for further advancing our understanding of the mutual exclusion mechanism, the present study in fact inspires several interesting thinking which could be potentially exploited for future development of new testing methods to evaluate the quality of hMSCs or for the design of novel approaches to enhance therapeutic efficacy of hMSCs. For example, the key molecules involved in the mutual exclusion relationship may be developed as novel DLC-1/Notch1-based or FBXW5/Hey1-based surrogate markers for evaluating the versatility of immunomodulation of hMSCs; Rock2-specific inhibitors may be included in novel priming/licensing strategies to enhance therapeutic efficacy of hMSCs or may be utilized as small molecule therapeutics to provoke immunomodulatory potential of endogenous hMSCs in future ‘cell-free’ hMSCs therapy.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.