Ubiquitin-specific protease-44 inhibits the proliferation and migration of cells via inhibition of JNK pathway in clear cell renal cell carcinoma

Antibodies against Flag (catalog number: M185-3 L) and β-actin (M177–3) were purchased from Medical Biological Laboratories (Nagoya, Japan). Antibodies against matrix metalloproteinase (MMP)9 (A0289) were obtained from ABclonal (Woburn, MA, USA). Antibodies against P21 (2947), cyclin D1 (2978), c-Jun N-terminal kinase (JNK; 9252), phosphorylated (p)-JNK (4668), protein kinase B (AKT; 4691), p-AKT (4060), p38 (9212), p-p38 (4511), extracellular signal-regulated kinase (ERK; 4695) and p-ERK (4370) were purchased from Cell Signaling Technology (Danvers, MA, USA).

The JNK inhibitor JNK-IN-8 (HY-13319, MCE, USA) was dissolved in dimethyl sulfoxide (DMSO) and diluted into a 0.5-μM working solution with complete culture medium, and the same amount of DMSO was set as the control.

Bioinformatics analysis was undertaken in accordance with the work of Jiangqiao and collaborators [13]. ccRCC’s gene sequence tertiary count data samples and clinical information are obtained through TCGA data portal. DESeq2 within the R Project for Statistical Computing (Vienna, Austria) was used to standardize counting data and analyze differentially expressed genes between cancer samples and normal samples. Standardized data were used primarily to analyze the visual expression, stage, grade and survival correlation of USP44 in ccRCC and adjacent non-cancerous tissues. According to USP44 expression, clinical samples of ccRCC were divided into two groups for analyses.

Kaplan–Meier survival curves were used to show the differences in overall survival between patients with high expression of USP44 and cases with low expression of USP44. Simultaneously, we calculated the correlation between USP44 expression and the age, sex, tumor stage and tumor grade of the patient through T-text, and the obtained data were visualized through ggplot2 within the R Project for Statistical Computing.

The human ccRCC line 786-O (CRL-1932) was purchased from BeNa Culture Collection (Manassas, VA, USA). Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; C11995500BT; Billings, MT, USA) [14]. Caki-1 (a cell line of human ccRCC that metastasizes to the skin) was purchased from the Chinese Academy of Sciences Cell Bank (TCHu135; Beijing, China) and was cultured in McCoy’s 5A culture medium (L630; Basal Media, Saint Louis, MO, USA) [15]. Then, 10% fetal bovine serum (FBS; F05–001-B160216; One Biotechnology, Sarasota, FL, USA), penicillin (100 U/mL) and streptomycin (100 μg/mL) were added to DMEM and McCoy’s 5A. 786-O cells and Caki-1 cells were cultured in a humidified environment at 37 °C containing 5% carbon dioxide.

An overexpressed vector with a flag tag and shRNA vectors of the USP44 (homo) gene were designed and constructed according the method described by Jiangqiao and colleagues [13]. The gene registration number is NM_001347937.1. pHAGE-3xflag was used as the carrier. The primers were h-USP44-NF, AAACGATTCAGGTGGTCAGG, h-USP44-NR, and AGTGTACCCAGAACCCTCCT. The sequence of pLKO.1-h-USP44-shRNA1 was CGGATGATGAACTTGTGCAAT. The sequence of pLKO.1-h-USP44-shRNA2 was GCACAGGAGAAGGATACTAAT.

Cell viability was examined using a CCK-8 kit following manufacturer (44,786; Dojindo, Tokyo, Japan) protocols [13]. 786-O cells and Caki-1 cells were inoculated in 96-well plates (167,008; Thermo Scientific, Waltham, MA, USA). After cells had adhered to the plate, they were cultured further for 0, 12, 24, 36, 48, and 60 h, respectively. CCK8 reagents (10 μL) were added and absorbance at 450 nm measured.

The BrdU experiment was undertaken according to manufacturer (11,647,229,001; Roche, Basel, Switzerland) instructions [13]. 786-O cells and Caki-1 cells were inoculated in 96-well plates. After 24 h and 48 h, the BrdU experiment was carried out.

786-O cells and Caki-1 cells were inoculated into six-well plates (140,675; Thermo Scientific) at 3 × 10⁵ cells per well and incubated overnight. After that, the original culture medium was replaced with DMEM containing mitomycin (10 μg/mL). Then, cells were cultured for 12 h. Cells were wounded with a pipette tip and photographs taken immediately (0 h) as well as 6 h and 12 h after wounding. Then, the Cell Migration Index was calculated using the following formula:

Cell Migration Index = (wound width at 0 h – wound width at 6 h or 12 h) × 100/wound width at 0 h.

Healthy 786-O cells and Caki-1 cells were resuspended in DMEM or McCoy’s 5A. Then, they were plated at 3 × 10⁴ cells/well (786-O) or 5 × 10⁴ cells/well (Caki-1) in the upper compartment of a Transwell™ chamber (3421; Corning, Corning, NY, USA). Meanwhile, DMEM containing 600 μL of 2% FBS or 600 μL of 10% FBS was added to the lower chamber, respectively. Cells were cultured for 2 h or 3 h (786-O) or 10 h or 24 h (Caki-1) with phosphate-buffered saline. Then, 600 μL of 4% paraformaldehyde solution was used to fix cells for 15 min at room temperature, and 600 μL of 0.1% crystal violet (548–62-9; Xinkang,Hubei) was used to stain cells for 2 h at 37 °C. Images were acquired under a microscope. The number of positively stained cells reflected the cell-migration ability.

Proteins were extracted from 786-O cells and Caki-1 cells according to standard protocols. Meanwhile, protease inhibitors (04693132001; Roche) and phosphatase inhibitors (4,906,837,001; Roche) were added. Protein concentrations were determined using a Bicinchoninic Acid Protein Assay kit (23,225; Thermo Fisher Scientific). Briefly, we separated protein samples by sodium dodecyl sulfate-polyacrylamide gel electrophoresis on 12.5% gels, and then transferred them to nitrocellulose membranes. We blocked the nitrocellulose membranes using 5% nonfat dry milk in TBS-T buffer and incubated them overnight with primary antibody at 4 °C. After rinsing the blots extensively with TBS-T buffer, incubation with secondary antibodies for 1 h was undertaken. We applied a ChemiDoc™ XRS+ gel-imaging system (Bio-Rad Laboratories, Hercules, CA, USA) to detect the target bands.

The total mRNA of 786-O and Caki-1 cell lines was extracted with TRIzol® Reagent (15596–026; Invitrogen, Carlsbad, CA, USA). Then, total RNA was reverse-transcribed into complementary (c)DNA using a Transcriptor First Strand cDNA Synthesis kit (04896866001; Roche) according to manufacturer instructions. SYBR® Green (04887352001; Roche) was used to quantify the PCR-amplification products. mRNA expression of target genes was normalized to that of β-actin expression. All the primer information is in Table 1.

Data are the mean ± standard error. We used SPSS v19.0 (IBM, Armonk, NY, USA) for statistical analyses. The Student’s t-test was used to analyze all data. P < 0.05 was considered significant.

Analyses of information from the TCGA Data Portal demonstrated that USP44 expression was significantly lower in ccRCC specimens than that in normal tissues (Fig. 1a). Data analyses from the Gene Expression Omnibus (GEO) 102,101 database confirmed this result (Fig. 1b). Relationship between the expression of USP44 and Clinicopathological characteristics in Table 2. Subsequently, a subgroup analysis was undertaken based on the stage and grade of ccRCC. USP44 expression was closely related to the stage and grade of ccRCC (Fig. 1c, d). With an increment in stage and grade, USP44 expression showed a gradual decrease. USP44 expression was closely related to patient survival (Fig. 1e). Based on these results, USP44 might be a potential marker to predict ccRCC progression, and play an important part in ccRCC progression.

We wished to explore the effect of USP44 in vitro. 786-O cells and Caki-1 cells show different metastatic and invasive abilities in the ccRCC model, so we chose these two cell lines for experiments. Overexpressed stable cell lines were obtained by viral infection of USP44 in 786-O cells and Caki-1 cells (Fig. 2a–d). The viability and proliferation potential of cells was evaluated through the CCK8 assay and BrdU experiment. In comparison with negative controls, USP44 overexpression inhibited the viability of these two lines significantly (Fig. 2e, f). To explore further the direct influence of USP44 on ccRCC proliferation, we labeled proliferating cells with BrdU in cells showing overexpression of USP44 and control cells. USP44 overexpression reduced the BrdU-absorption capacity of 786-O cells and Caki-1 cells significantly (Fig. 2g, h), which demonstrated that USP44 can inhibit ccRCC proliferation. Studies have shown that expression of cyclin D1 and P21 is closely related to tumor occurrence, and that they are markers of proliferation of tumor cells [16, 17]. The main function of cyclin D1 is to promote cell proliferation by regulating the cell cycle, which is closely related to the occurrence of tumors and is a marker of proliferation of tumor cells (including ccRCC) [18]. P21 expression is closely related to inhibition of tumor cells and can coordinate the relationship between the cell cycle, DNA replication and DNA repair by inhibiting the activity of cyclin-dependent kinase complexes [19]. USP44 expression was positively correlated with expression of the gene and protein of P21, and negatively correlated with expression of the gene and protein of cyclin D1 (Fig. 2i–l). Taken together, these results demonstrated that USP44 inhibited proliferation of 786-O cells and Caki-1 cells.

We conducted a series of experiments to investigate if USP44 overexpression inhibited the migration of 786-O cells and Caki-1 cells. First, we used Transwells to evaluate the effect of USP44 overexpression on cell migration. We found that USP44 overexpression slowed down the migration of 786-O cells and Caki-1 cells significantly (Fig. 3a, b), which was consistent with our expectation. Because the two types of tumor cells we used have different migration abilities, USP44 overexpression slowed down the migration ability of 786-O cells at the early stage (2 h, 3 h), and slowed down the migration ability of Caki-1 cells at the late stage (10 h, 24 h).

Next, we undertook wound-healing experiments to confirm the migration effect of USP44. To avoid the effect of cell proliferation on cell migration, mitomycin was administered before wound-healing experiments. USP44 overexpression slowed down the migration of 786-O cells and Caki-1 cells significantly (Fig. 3c, d). MMP2 and MMP9 are closely related to the blood-vessel formation, growth and metastasis of tumors [20]. MMP2 and MMP9 have been recognized as markers of the migration and metastasis of ccRCC lines [21]. USP44 overexpression down-regulated expression of the mRNA and protein of MMP2 and MMP9 in 786-O cells and Caki-1 cells (Fig. 3e–h). Collectively, these results demonstrated that USP44 inhibited the migration of 786-O cells and Caki-1 cells.

We attempted to verify the role of USP44 in tumor cells by silencing USP44 expression with shRNAs. Two shRNAs were constructed to silence USP44 expression in Caki-1 cells (Fig. 4a). Consistent with our expectation, USP44 knockdown promoted cell proliferation significantly according to the CCK-8 assay and BrdU experiments (Fig. 4b, c). USP44 knockdown inhibited P21 expression and upregulated expression of cyclin D1 (Fig. 4d, e). The cell-migration assay showed that USP44 deficiency promoted the migration of Caki-1 cells (Fig. 4f), which was associated with upregulation of expression of MMP2 and MMP9 (Fig. 4g, h). These results confirmed that USP44 knockdown enhanced the proliferation and migration of Caki-1 cells.

The AKT and mitogen activated protein kinase (MAPK) signaling pathways have important roles in the occurrence and development of malignant tumors [22]. To explore how USP44 regulates the proliferation and migration of tumor cells, we measured the activation of AKT, JNK, p38, and ERK signal pathways in USP44-overexpression and control groups. USP44 overexpression decreased the level of JNK, but not that of AKT, p38 or ERK, compared with control cells in both cell lines (Fig. 5a, b). JNK expression was promoted if USP44 expression was knocked down, but no effect was observed on expression of AKT, p38 or ERK (Fig. 5c). The results stated above suggest that the JNK signaling pathway participated in the USP44 function of regulating proliferation of 786-O cells and Caki-1 cells.

To verify further whether the role of USP44 in ccRCC progression was dependent upon the JNK pathway, we blocked JNK activation via a JNK inhibitor and examined the proliferation and migration of 786-O cells and Caki-1 cells (Fig. 6a). Results showed that the ability of USP44 knockdown to promote the proliferation and migration of 786-O cells and Caki-1 cells was reduced significantly after treatment with a JNK inhibitor. Hence, USP44 regulated the proliferation and migration of 786-O cells and Caki-1 cells through the JNK signaling pathway (Fig. 6b, c).