Background
The brain’s inflammatory response to ischemic stroke has significant consequences for secondary neuronal death, effective resolution of the ischemic injury, and stroke outcomes [
1,
2]. Thus, defining the endogenous signals that regulate brain inflammation is essential. One such potentially important signal is the sympathetic nervous system. Sympathetic outflow is elevated after stroke in proportion to stroke size, resulting in increased epinephrine and norepinephrine in the blood and cerebrospinal fluid of stroke patients [
3‐
5]. Clinical care of stroke patients also involves amplifying or reducing blood pressure with drugs that act on the adrenergic receptors that bind epinephrine and norepinephrine [
6]. This makes it critical to understand how adrenergic signaling affects the immune response to stroke.
The immune effects of adrenergic signaling are primarily transmitted by β2-adrenergic receptors, which are highly expressed on all major immune cell subtypes [
7]. β2-adrenergic signaling has context-dependent consequences, in some cases suppressing immune cell activation [
5,
8] and in others causing immune cell depletion [
9]. Previous studies investigating how β2-adrenergic receptor signaling affects stroke-induced neuronal death and neuroinflammation in the brain focused on manipulation of the receptor prior to stroke only and yielded conflicting results [
10‐
14]. Pre-treating with a selective β2 agonist reduces infarct size in mice [
10] and rats [
10‐
12], while global knockout of the β2-adrenergic receptor or pre-treatment with the β2-adrenergic receptor selective antagonist ICI 118,551 also reduces infarct size, improves behavioral outcome, and reduces pro-inflammatory gene expression [
13,
14]. These studies did not distinguish whether altered β2-adrenergic signaling directly affects initial stroke size, or if it regulates neuroinflammation and subsequent neuronal loss. These studies also did not examine effects on the immune cells central to the stroke response: microglia and blood monocyte-derived macrophages (MDMs).
Indeed, although it is well-documented that immune cells in the periphery are regulated by the sympathetic nervous system and β2-adrenergic signaling, relatively little is known about the effect of β2-adrenergic signaling on immune responses within the central nervous system. Microglia and MDMs dominate the neuroimmune response in the sub-acute phase after ischemic stroke and therefore have a direct impact on neuronal survival and injury resolution [
15,
16]. Both of these cell populations express functional β2-adrenergic receptors [
17‐
19]; in fact, microglia express the β2-adrenergic receptor about ten-fold more highly than any other cell type in the brain [
20]. In cultured microglial cells, norepinephrine suppresses LPS-induced NF-κB signaling and production of pro-inflammatory cytokines including iNOS, IL-1β [
21‐
23], tumor necrosis factor-α (TNFα), and IL-6 [
18,
24,
25]. Loss of adrenergic signaling in models of neurodegeneration was shown to impair the microglial disease response [
25,
26]. However, the effects of β2-adrenergic signaling on the microglial/MDM response to brain injury such as ischemic stroke have not been investigated.
The aim of this study was thus to identify the role of microglial and macrophage β2-adrenergic signaling in modulating neuroinflammation and outcomes in a rodent model of ischemic stroke. We isolated the effects of β2-adrenergic stimulation on post-stroke neuroinflammation by treating mice with the brain-penetrant β2-adrenergic receptor agonist clenbuterol after stroke onset. To specifically investigate the role of microglia/MDM β2-adrenergic signaling on post-stroke neuroinflammation, we induced stroke in a mouse model with selective knockout of the β2-adrenergic receptor from microglia and monocyte-lineage cells. Using these models, we assessed activation, proliferation, and morphology of microglia/MDMs as well as infarct size, expression of inflammatory mediators, and stroke outcomes.
Methods
Animals
All animal use was in accordance with protocols approved by the Stanford University Institutional Animal Care and Use Committee. Male C57BL/6J mice (stock number: 000664) and Cx3cr1
CreER mice (specific strain name: B6.129P2(Cg)-
Cx3cr1tm2.1(cre/ERT2)Litt/WganJ) were purchased from The Jackson Laboratories (Bar Harbor, ME). Adrb2
flox/flox mice were obtained from the Gerard Karsenty lab at Columbia University. Mice were housed in a temperature-controlled 12-h light-dark alternating facility, with ad libitum access to food and water. All experiments were performed with 8–11-week-old male mice, except behavioral assessments which were performed in 10-week-old female mice. To generate mice with conditional knockout of the β2-adrenergic receptor from microglia and monocyte lineage cells, we bred Cx3cr1
CreER animals with Adrb2
flox/flox animals. Experimental Adrb2
cKO mice were homozygous for the Adrb2
flox/flox allele and heterozygous for the Cx3cr1
CreER knock-in allele; littermate control Adrb2
WT mice were homozygous for the Adrb2
flox/flox allele and homozygous for wild-type Cx3cr1. Both groups were given doses of 0.125 mg/kg tamoxifen in corn oil via oral gavage on three consecutive days to induce knockout of the gene for the β2-adrenergic receptor in Adrb2
cKO mice. Stroke surgeries were performed 5 days after the last tamoxifen dose to allow sufficient time for maximal recombination but not enough time for blood monocytes to turn over [
27], ensuring that microglia in addition to the majority of blood monocytes would lack the β2-adrenergic receptor at the time of stroke.
Photothrombotic stroke
The photothrombotic stroke model of cortical ischemic injury was performed based on published protocols [
28]. Animals were anesthetized with 2% Isoflurane in 2 L/min 100% oxygen and maintained at 37 °C both during surgery and recovery using a feedback-controlled heating blanket. Mice were injected intraperitoneally (i.p.) with 80 mg/kg Rose Bengal (Sigma #330000 5G) dissolved 10 mg/ml in sterile saline, anesthetized, and placed in a stereotactic frame. Sham mice were given i.p. injections of sterile saline instead of Rose Bengal and underwent the same surgery as the stroke groups. A midline scalp incision was made to expose the skull, and 10 min after Rose Bengal or saline injection, a 1-mm diameter Metal Halide Fiber optic light (Edmundonoptics #56371) was positioned directly over the right motor cortex (0.5 mm anterior and 1.75 mm laterally to the right of Bregma) for exactly 15 min to produce cortical infarction. Mice were concurrently injected with 25 mg/kg cefazolin (VWR #89149-888) and 1 mg/kg of buprenorphine SR (Zoopharm, Windsor, CO) to prevent infection and for pain management, respectively. The scalp incision was resealed using Surgi-lock tissue adhesive (Meridian, Allegan, MI).
Drug treatment
Clenbuterol (Sigma C5423) was administered to mice 3 h after stroke via subcutaneous pumps with a simultaneous bolus injection to immediately boost the amount of circulating drug in the blood and to allow the drug concentration to reach steady state more quickly. Bolus injections of 1 mg/kg clenbuterol dissolved in sterile 0.9% saline were delivered intraperitoneally using a volume of 0.01 mL per gram of mouse weight. Alzet 1003D drug delivery pumps (Alzet, Cupertino, CA) were filled with 0.000833 g/mL clenbuterol solution to achieve a delivery rate of 1 mg/kg/day and were implanted according to manufacturer instructions 3 h after stroke. Mice in the control group were injected with 0.9% sterile saline and implanted with a pump filled with 0.9% saline. Mice sacrificed at the acute 4-h time point received bolus injections but not subcutaneous pumps. Mice that underwent behavioral assessment were given 1 mg/kg i.p. injections of clenbuterol 3 h post-stroke and subsequently every 24 h for the first week of testing instead of using subcutaneous pump implants, in order to prevent impairment of performance on motor testing. Mice used for histological analysis were injected i.p. with 50 mg/kg bromodeoxyuridine (BrdU: Sigma B5002) dissolved in sterile PBS 24 h prior to sacrifice.
Immunohistochemistry
All animals were sacrificed at 3 days post-stroke for immunohistochemistry. Mice were sedated with chloral hydrate and perfused with 0.9% NaCl containing 10 U/mL heparin. The brains were collected and drop-fixed in 4% PFA in phosphate buffer for 24 h at 4 °C, then were preserved in 30% sucrose in PBS. A freezing microtome (Microm HM430) was used to collect 40-μm-thick coronal brain sections sequentially into 12 tubes. Brain sections were stored in cryoprotectant medium (30% glycerin, 30% ethylene glycol, and 40% 0.5 M sodium phosphate buffer) at 20 °C until processing. Standard immunohistochemistry procedures were used to stain free-floating sections. Briefly, sections were blocked with 3% donkey (Millipore, #S30-100 mL), or rabbit (Vector, #S-5000) serum for 1 h. Tissue was then incubated at 4 °C overnight in primary antibody: anti-Iba1 (rabbit, 1:1000, Wako 019-19,741), anti-BrdU (rat, 1:5000, Abcam Ab6326), biotinylated anti-NeuN (mouse, 1:500, Millipore MAB377B), or anti-CD68 (rat, 1:1000, BioRad MCA1957S). Iba1 and BrdU were labeled with fluorescent secondary antibodies (donkey anti-rabbit IgG, 1:200, Thermo-Fisher A-21206; donkey anti-rat IgG, 1:200, Jackson ImmunoResearch 712-165-153), mounted onto glass slides, and coverslipped using Vectashield HardSet Mounting Medium (Vector Laboratories, H-1400). For CD68 staining, tissue was incubated for 1 h in secondary antibody (rabbit anti-rat IgG, 1:500, Vector Laboratories BA-4001). For both CD68 and NeuN stains, tissue was treated with Avidin-Biotin Complex solution (Vector, #PK-6100) for 1 h and treated for 5 min with filtered DAB (Sigma, #D5905) solution. Finally, sections were mounted onto glass slides, air-dried overnight, and then coverslipped with Entellan (Electron Microscopy Sciences 14,800). NeuN-labeled slides were rehydrated and stained with Cresyl violet prior to coverslipping.
Image acquisition and quantification
BrdU/Iba1 colocalization
Z-stacks were taken at × 40 magnification using a Leica confocal microscope in the medial peri-infarct region of the cortex, defined as the area equidistant between the stroke border and the midline of the brain, at least one view field above the corpus callosum and with images spaced vertically one view field apart. Two z-stacks per brain section and two brain sections per mouse were used for analysis. Sections were excluded from the analysis if they showed irregular immunostaining, which was either high background immunofluorescence or failure of the BrdU stain to label the subventricular zone, which we used as an internal positive control. Iba1+ cells, BrdU+ cells, and Iba1/BrdU double-positive cells were quantified in the z-stacks using ImageJ software, and percent proliferation was calculated by dividing the total number of Iba1+ BrdU+ double-positive cells by the number of Iba1+ cells. All imaging and quantification and was performed by an experimenter blinded to experimental group.
Iba1 fluorescence area
Four z-stacks per brain section in two brain sections per mouse were taken of Iba1-stained cells. Confocal z-stacks of Iba1-stained cells were maximum intensity projected, converted to 8-bit, background-subtracted, and thresholded using the default method in ImageJ software. The percent of the image area covered by Iba1 immunostaining was averaged across images for each individual animal.
CD68 immunohistochemistry
Brightfield images were taken at × 20 magnification using a Keyence microscope in the medial and lateral peri-infarct cortex (along the edge of the stroke border). One image was taken per region per tissue section in five sequential sections per animal. Images were converted to 8-bit in ImageJ software and then thresholded using the default method. For each region, the percent of the image area covered by CD68 immunostaining was averaged across images for each individual animal. For qualitative scoring, infarct border images (1 image per brain section, 5 sections per animal) were evaluated by a blinded experimenter. Density of CD68+ cells was given a score of 1 (most sparse), 2 (average density), or 3 (extremely dense). Size of CD68+ cells was given a score of 1 (smallest), 2 (average size), or 3 (largest). Scores per animal were averaged for each measure.
Infarct volume analysis of NeuN and cresyl violet immunostains
Slides were scanned using a Silverfast PathScan Enabler IV Slide Scanner. The stroke area, ipsilateral ventricle area, ipsilateral hemisphere total area, contralateral ventricle area, and contralateral hemisphere total area were traced in ImageJ software. In order to account for brain swelling following ischemic injury and to minimize variance, normalized stroke volume was calculated as the stroke area divided by the area of the contralateral brain hemisphere with the contralateral ventricle area subtracted. This value was averaged across the nine sections centered on the maximal area of the stroke for each animal. All quantification was performed by an experimenter blinded to experimental group.
Mice were sacrificed at either an acute (4 h after stroke) or sub-acute (3 days after stroke) time point. Peri-infarct cortical tissue and stroke core was rapidly dissected, flash-frozen using liquid nitrogen, and stored at − 80 °C to prevent RNA degradation. Peri-infarct cortex was defined as the area of cortical tissue within a 2.5 mm radius of the stroke core at the time of dissection. Tissue was homogenized, and RNA was extracted with TRizol reagent (ThermoFisher 15596026). RNA (1.5 μg) was reverse-transcribed into cDNA using the High-Capacity cDNA Reverse Transcription Kit (ThermoFisher 4368814) according to manufacturer’s instructions. We performed qPCR using SYBR Green (Qiagen 204,145) and the QuantStudio 6 Flex Real-Time PCR System. We quantified the expression of the following genes: Adrb2, TNFα, iNOS, IL-10, Ym1, and Mki67 (Table
1). We used Gapdh as a reference gene and calculated relative gene expression using the ddC(t) method [
29].
Table 1
Primer sequences utilized for RT-qPCR analysis
Adrb2 | NM_007420.3 | Adrenergic receptor beta-2 | Forward: TCGAGCGACTACAAACCGTC |
Reverse: CCAGAACTCGCACCAGAAGT |
TNFα | NM_013693.3 | Tumor necrosis factor-alpha | Forward: TAGCCCACGTCGTAGCAAAC |
Reverse: GTCTTTGAGATCCATGCCGTTG |
iNOS | NM_001313922.1 | Inducible nitric oxide synthase | Forward: TGACGGCAAACATGACTTCAG |
Reverse: GCCATCGGGCATCTGGTA |
IL-10 | NM_010548.2 | Interleukin 10 | Forward: CTGGACAACATACTGCTAACCG |
Reverse: GGGCATCACTTCTACCAGGTAA |
Ym1 | NM_009892.3 | Chitinase-like 3 | Forward: AGACTTGCGTGACTATGAAGCATT |
Reverse: GCAGGTCCAAACTTCCATCCTC |
Mki67 | NM_001081117.2 | Marker of proliferation Ki-67 | Forward: ATCATTGACCGCTCCTTTAGGT |
Reverse: GCTCGCCTTGATGGTTCCT |
Gapdh | NM_001289726.1 | Glyceraldehyde-3-phosphate dehydrogenase | Forward: ATCATTGACCGCTCCTTTAGGT |
Reverse: GCTCGCCTTGATGGTTCCT |
Behavioral assessment
We tested functional recovery following photothrombotic stroke of the motor cortex using the foot fault task, gridwalk task, and the rotating beam task [
30,
31]. We measured missed steps of the contralateral forepaw on the foot fault task, and the distance traveled before falling on the rotating beam task. Mice underwent handling, one habituation day, two pretraining days, and baseline behavioral testing prior to photothrombotic stroke. Behavior was then tested on these tasks on days 1, 3, 7, 14, 21, and 28 following photothrombotic stroke. Animals were placed on the foot fault gridwalk apparatus and were allowed to explore freely for 5 min, and the number of contralateral forelimb faults was recorded. Animals were placed on the rotating beam and the distance covered prior to falling was recorded, for four trials each testing day.
Epinephrine and norepinephrine ELISA
We measured levels of epinephrine and norepinephrine in plasma of mice 4 and 24 h after photothrombotic stroke or sham surgery using a 2-Catecholamine [Adrenaline-Noradrenaline] Research ELISA kit (Rocky Mountain Diagnostics, Colorado Springs, CO). Briefly, plasma was obtained from whole blood collected via cardiac puncture from deeply anesthetized mice and EDTA and sodium metabisulfite were added to plasma samples at concentrations of 1 mM and 4 mM, respectively. Plasma samples were then diluted 1:2 and were assayed in duplicate according to the manufacturer’s instructions. Three samples were excluded from both the norepinephrine and epinephrine plasma analyses because they were identified to be statistical outliers using published methods [
32].
Blood pressure measurement
Blood pressure was recorded using the non-invasive tail cuff Visitech Systems BP-2000 Blood Pressure Recording System (Apex, NC). Mice were acclimatized to the recording device and procedure for two consecutive days preceding the testing day. Measurements taken on the second acclimatization day were used as baseline blood pressure measurements for each animal. On the testing day, the animals were allowed to adjust to the recording room in their home cages for 1 h, then received a single i.p. injection of either 1 mg/kg clenbuterol or sterile saline. At 4 h and 7 h post-injection, systolic blood pressure, diastolic blood pressure, pulse, and mean arterial blood pressure were measured according to the device manufacturer’s instructions and were processed using BP-2000 software. Fifteen measurements were taken for each animal at each time point, and the value for each animal was calculated by averaging the last 10 measurements taken. Individual measurements that were outliers were identified and removed using published methods [
32].
Statistical analysis
Data was processed using GraphPad Prism 7 software. For comparisons between two groups, a two-tailed Student’s t test was used. A Mann-Whitney test with Dunn’s multiple comparisons test was used for data that was not normally distributed. For experiments with more than two groups, a one- or two-way ANOVA test was used with Tukey’s multiple comparisons test for post hoc analysis. All data are presented as mean ± SEM. Experiments were designed using power analyses to determine sample sizes based on expected variances and group differences. All animals were randomized between experimental groups and experimenters were blinded to group assignments.
Discussion
We show here that increasing β2-adrenergic stimulation after stroke onset causes enlarged morphology of microglia/MDMs surrounding the stroke, impairs proliferation of these cells, and reduces expression of pro-inflammatory TNFα early, followed by a later reduction in both pro- and anti-inflammatory cytokines. Augmented β2-adrenergic signaling after stroke resulted in decreased blood pressure, increased heart rate, and increased infarct volume. Furthermore, we report that selective knockout of the β2-adrenergic receptor causes opposite changes in the overall cytokine response in the post-stroke brain but does not affect microglial proliferation or morphology. Taken together, this indicates that β2-adrenergic signaling is an important regulator of the microglia/MDM response to ischemic brain injury and that increasing it after stroke is detrimental.
There is a growing interest in understanding the impact of drugs targeting the sympathetic nervous system on stroke outcomes. Analyses of clinical stroke populations report that more than 50% of patients had prolonged use of β-blockers prior to experiencing stroke, some of which act on the β2-receptor [
35,
36]. Also, after stroke, patients may receive therapy with pressors to increase their blood pressure, and some act on the β2-receptor (e.g., norepinephrine and epinephrine), while others do not (e.g., neosynephrine) [
6]. Clinically, the choice of adrenergic agent does not take into account direct or indirect effects on neuroinflammation, because these effects are unknown. Thus, it is critically important to understand how the sympathetic nervous system regulates the pathophysiology of stroke both in the periphery and in the central nervous system. β-blockers are also being investigated to prevent or treat post-stroke infection, which is believed to be caused in part by immunosuppression due to an increased outflow of the sympathetic nervous system. Some retrospective studies of β-blocker use in stroke patients found reduced infection and improved outcomes [
37]. However, other similar studies failed to find improvements in infection rates and mortality with β-blocker use [
36,
38,
39]. Further work will be required to understand whether post-stroke neuroinflammation in humans is analogous to neuroinflammation in mice. Our results imply that both non-selective β-blocker and pressor use in humans may be influencing stroke outcome.
The goal of our study was to directly assess the effect of β2-adrenergic signaling on post-stroke neuroinflammation in the central nervous system by treating mice with the β2-adrenergic receptor agonist clenbuterol after the ischemic event had already occurred. We used a stroke model that produces small-to-moderately-sized strokes that did not induce a significant increase in plasma norepinephrine and epinephrine. These results are in line with earlier findings from both human and animal studies that stroke size correlates with sympathetic response [
3‐
5] and reflect that this model may not induce strokes that are large enough to increase plasma catecholamines. Our results demonstrate that pharmacologically supplementing β2-adrenergic signaling after photothrombotic stroke suppresses the microglia/MDM response and the expression of inflammatory mediators. The pro-inflammatory cytokine TNFα was strongly reduced early after stroke with clenbuterol treatment and prolonged clenbuterol treatment after stroke led to a suppression of both pro- and anti-inflammatory mediators. These findings indicate an overall downregulation of the neuroimmune response with increased β2-adrenergic signaling. The effects on cytokine expression are mediated by microglia and MDMs, as cell-specific knockout of the β2-adrenergic receptor led to increased cytokine expression. As noted above, drugs regulating adrenergic signaling typically affect blood pressure by acting on adrenergic receptors expressed in the heart and in blood vessels [
7]. We observed a reduction in rodent blood pressure and a compensatory increase in heart rate with the dose of clenbuterol used for this study. The neuroimmune effects of increased β2-adrenergic stimulation after stroke may therefore be due to direct binding to β2-adrenergic receptors expressed by immune cells as well as indirect effects mediated by changes in blood pressure. Further experimentation would be needed to determine if clenbuterol reduces cerebral perfusion specifically in the context of ischemic stroke.
The finding that the β2-adrenergic receptor agonist clenbuterol leads to infarct expansion is in contrast to previous reports that rats or mice treated with clenbuterol 3–5 h prior to transient or permanent middle cerebral artery occlusion (MCAO) have reduced infarct volumes at 7 days post-stroke [
10‐
12]. The disparities in outcomes between our observations and these previous studies may be explained by differences in stroke model, drug dose, or experimental timelines. For instance, particularly high doses of clenbuterol administered before stroke in rats increased ischemic damage, which the authors suggested was due to a dramatic reduction in blood pressure and therefore cerebral perfusion [
12]. Lower doses of clenbuterol might confer neuroprotective effects without reducing blood pressure. However, pretreatment with clenbuterol at doses that reduced blood pressure was neuroprotective in another rodent stroke study [
40], so it is unclear if the beneficial or detrimental effects of clenbuterol can be attributed to blood pressure changes alone. Another possibility is that clenbuterol targets different mechanisms in stroke pathophysiology depending on the timing of administration. Thus, clenbuterol treatment before stroke onset could mitigate the severity of the initial ischemic event, whereas clenbuterol treatment after stroke could reduce cerebral blood flow and suppress the normal neuroimmune response, resulting in exacerbation of the injury.
Interestingly, blocking β2-adrenergic signaling is also reported to be neuroprotective in stroke models. For example, infarct size 24 h after transient MCAO is reduced in global β2-adrenergic receptor knockout mice or mice treated with the β2-adrenergic receptor antagonist ICI 118,551 prior to stroke [
13,
14]. Pre-treatment with the non-specific β-adrenergic receptor antagonist propranolol also reduces stroke size 3 days after MCAO in rats [
41]. These three studies taken with our results suggest that blocking β2-adrenergic receptor activity before stroke onset is neuroprotective, whereas increasing β2-adrenergic receptor signaling after stroke is detrimental.
Our data show for the first time that β2-adrenergic signaling specifically regulates the microglial and MDM response to ischemic stroke. We observed that clenbuterol treatment after stroke onset induced enlarged morphology of microglia/MDMs in the peri-infarct cortex and caused a dramatic reduction in microglia/MDM numbers and proliferation. These findings are in agreement with previous reports of the effects of β2-adrenergic stimulation on microglia in vitro. In an acute brain slice model, stimulation of microglia with norepinephrine causes retraction of microglial processes and a shift to an ameboid morphology, dependent on β2-adrenergic receptors [
42]. Furthermore, stimulation of cultured rat microglia with β2-adrenergic receptor agonists but not agonists for other adrenergic receptor subtypes suppresses microglial proliferation, possibly by elevating intracellular levels of cAMP [
43]. β2-adrenergic stimulation also suppresses the proliferation of other immune cell subtypes in vivo, such as group 2 innate lymphoid cells [
44]. We assessed microglia/MDM numbers, activation, and proliferation in mice with Adrb2 specifically knocked out of monocyte-lineage cells in order to determine the effects of β2-adrenergic receptor knockout on how these cells respond to stroke. We surprisingly did not see an increase in proliferation of microglia/MDMs in Adrb2
cKO mice, suggesting that cell-intrinsic β2-adrenergic signaling may not regulate the effects of clenbuterol specifically on proliferation, and/or that there are other signals influencing proliferation in the absence of β2-signaling. One possibility is that the effect of clenbuterol treatment on blood pressure and/or heart rate indirectly suppresses microglia/MDM proliferation or impairs MDM trafficking into the injured brain.
In addition to proliferation, a key function of microglia and MDMs in post-stroke inflammation is upregulation of inflammatory signaling molecules, such as TNFα and iNOS. In clenbuterol-treated mice, post-stroke expression of these genes was reduced. Notably, we report higher expression of TNFα in Adrb2
cKO animals after stroke, in which the β2-adrenergic receptor is specifically knocked out of microglia/MDMs. These results suggest that the changes in inflammatory gene expression with clenbuterol are directly mediated by intrinsic microglia/MDM β2-adrenergic signaling rather than by indirect effects such as blood pressure. Our findings are in agreement with substantial previous literature that β2-adrenergic stimulation is generally anti-inflammatory. For example, clenbuterol treatment reduces gene expression of TNFα and NFκb signaling in the brain after systemic LPS treatment [
45]. The opposite effect occurs in rodent models of Alzheimer’s disease, where disproportionate death of noradrenergic neurons causes increased expression of TNFα and iNOS, which can be reduced with norepinephrine administration [
26]. In the context of neurodegeneration, it appears that loss of adrenergic signaling and the resulting increase in neuroinflammation exacerbates neuronal loss and speeds disease progression [
25,
26,
46]. However, in our stroke model, increasing adrenergic signaling and reducing neuroinflammation was associated with increased stroke size. This finding may support the concept that a robust early neuroinflammatory response is actually beneficial for stroke outcomes, possibly by promoting clearance of harmful debris and dead cells, recruiting immune cells from the periphery, and forming a border around the stroke. Other studies also support this idea; for instance, depleting microglia from the brain before ischemic stroke or preventing MDM influx into the brain results in larger infarcts and worse outcomes [
15,
47,
48]. Alternatively, it may be that blood pressure reduction by clenbuterol was responsible for the increased stroke size independent of clenbuterol-induced changes in neuroinflammation.
At 4 h post-stroke with clenbuterol treatment, we observed a significant decrease in TNFα gene expression in the stroke condition accompanied by a trend towards an increase in IL-10 gene expression. At 3 days after stroke, both cytokines are decreased by clenbuterol treatment, and both are increased in the Adrb2
cKO mice. Although the change in IL-10 with clenbuterol at 4 h after stroke is not significant, this data is consistent with previous reports that stimulation of β2-adrenergic receptors with clenbuterol or norepinephrine induces IL-10 expression and suppresses TNFα expression [
18,
24,
49‐
51]. The fact that 3 days later both are suppressed by clenbuterol likely results from a feedback loop between these two cytokines. Upregulation of TNFα typically stimulates expression of IL-10, which then downregulates TNFα to keep inflammation in check [
34,
52]. Thus, while the early effect is to inhibit pro-inflammatory TNFα expression, and perhaps augment anti-inflammatory IL-10, later the result is that the entire cytokine response is suppressed. This feedback relationship is likely also responsible for the increases in both cytokines at 3 days after stroke in the Adrb2
cKO mice. Similar effects have been reported previously where neutralization of TNFα downregulates IL-10 [
53] and in some cases, IL-10 and TNFα are downregulated by the same treatment [
54].
The β2-adrenergic receptor signals through multiple complex pathways; for this reason, it is likely that its effect on inflammation depends on cell type and context of the inflammatory insult. The β2-adrenergic receptor is a 7-transmembrane receptor that is typically coupled to
Gs proteins. Canonical stimulation of β2-adrenergic receptors expressed by immune cells increases intracellular cyclic-AMP and activates the protein kinase A pathway, generally resulting in reduced expression of pro-inflammatory factors such as TNFα and reactive oxygen species [
7,
55‐
57]. However, the β2-adrenergic receptor is capable of signaling through multiple other pathways. When the β2-adrenergic receptor is phosphorylated, its coupling can switch from G
s to G
i which can actually have pro-inflammatory outcomes [
58‐
60]. Additionally, β-arrestins can bind to the phosphorylated β2-adrenergic receptor, with effects including desensitization, internalization, or induction of signaling through the alternate ERK1/2 pathway [
58,
61]. Here, we observed predominantly canonical immunosuppressive effects of β2-adrenergic receptor stimulation after stroke, although future work is needed to elucidate how β2-adrenergic signaling pathways in the brain are regulated over time.
Another factor to consider in future studies is that β2-adrenergic signaling may have particular effects on different cell types involved in the post-stroke inflammatory response. Both brain-resident microglia and MDMs infiltrating from the bloodstream have crucial, non-redundant roles in the neuroimmune response after stroke. A limitation of the present study is that we did not distinguish between these two cell types. In our clenbuterol experiment in which gene expression of TNFα was downregulated in brain tissue 4 h post-stroke, we can assume that these changes in inflammation are attributable to brain-resident cells, because blood-borne macrophages do not infiltrate the brain parenchyma at this early time point [
16]. However, at 3 days post-stroke, we did not identify the cellular source of changes in inflammatory gene expression or distinguish between microglia or MDMs in the brain, since CD68 and Iba1 are markers known to label both cell types. Future experiments using cell-specific genetic markers might be useful for isolating these individual cell types and distinguishing the differential effects of β2-adrenergic activity. However, the two cell types likely respond analogously. Previous literature generally suggests that β2-adrenergic signaling affects microglia and peripheral macrophages similarly and results in similar effects on cytokines in both cell types to those we observed here [
57,
62].