Background
Traumatic brain injury (TBI) represents a leading cause of long-term neurological disability. Physical trauma to the brain initiates a complex cascade of events that include vascular damage, ischemia, excitotoxicity, inflammation, and neuronal loss [
1‐
3]. Pharmacological targeting of secondary injury processes such as neuroinflammation represents an important avenue of medical intervention to improve patient outcomes [
4]. Recent findings implicate Eph receptor signaling in the pathophysiology of neurological disorders [
5‐
7]. The Eph receptors comprise the largest family of receptor tyrosine kinases that are subdivided into two classes, EphAs and EphBs [
8]. EphAs contains a single transmembrane fragment and several cytoplasmic domains, while EphBs are GPI-anchored proteins. The extracellular portion of the Eph receptor interacts with its ligands ephrins, and their binding induces bi-directional signaling which has been implicated in multiple physiological and developmental processes. Ephrin type-A receptor 4 (EphA4) has been implicated in the disease pathology of Alzheimer’s [
9], amyotrophic lateral sclerosis [
10], ischemia [
11], and in TBI [
12]. Our initial findings of neuroprotection in global EphA4
−/− mice suggest EphA4 contributes to neural tissue damage. However, recent findings demonstrate neuron-specific Emx1-Cre conditional EphA4 knockout mice did not demonstrate neuroprotection following TBI, suggesting EphA4 mediates injury through non-neuronal mechanism(s) [
13]. Interestingly, previous studies have implicated EphA4 in promoting the adhesion of monocytes to endothelial cells within atherosclerotic plaques [
14] and mediating CD4(+) T cell development [
15] and migration [
16‐
18]. However, the mechanistic role of EphA4 signaling in regulating cell type-specific peripheral immune response to tissue damage remains unknown.
The current study evaluated the role of EphA4 in regulating inflammation and neural tissue damage following TBI using bone marrow chimeric knockout mice. We further tested the systemic delivery of two known EphA4 blocking peptides KYLPYWPVLSSL (KYL) [
19] and VTMEAINLAFPGEEKK (VTM-EEKK) which shows high binding affinity to EphA4 [
20]. Our findings demonstrate pharmacological inhibition and gene-targeted deletion of hematopoietic-specific EphA4 provided neuroprotection by modulating the pro-inflammatory milieu induced by the peripheral immune system following TBI. Additional in vitro analysis suggests these effects may be regulated by EphA4 suppression of monocyte/macrophages anti-inflammatory polarization state potentially through the mTOR, p-Akt, and NF-κB pathways. The current findings highlight a new and novel role for a well-characterized central nervous system axon guidance molecule in the acute immune response to TBI, which may be applicable to another disease of the nervous system.
Methods
Animals
All mice were housed in an AAALAC-accredited, virus/specific antigen-free facility with a 12-h light-dark cycle and food and water ad libitum. All mice used in these studies were male mice in order to reduce variables with sex differences. CD1 mice were purchased from Charles Rivers and reared until age P60–P90 for experimentation.
Cx3Cr1GFP/+,
Epha4−/−,
Epha4 floxed, Rosa
mTmG, and
Tie2-Cre mice on the C57BL/6 background were purchased from the Jackson Labs (Jackson Laboratory, Bar Harbor, ME) and bred for experimentation to a CD1 background and genotyped as previously described [
11]. All experiments were conducted in accordance with the NIH Guide for the Care and Use of Laboratory Animals and were conducted under the approval of the Virginia Tech Institutional Animal Care and Use Committee (IACUC; #15-063) and the Virginia-Maryland College of Veterinary Medicine.
Adoptive transfer
Wild-type EphA4f/f male mice were X-ray irradiated with two doses of 550 rad at least 6 h apart to ablate the bone marrow. Mice were placed on autoclaved and filtered 1 mg/ml gentamycin sulfate water for 3 days prior and 2 weeks following irradiation. Donor Tie2-Cremtmg and EphA4f/f/Tie2-Cremtmg male mice were euthanized, and the bone marrow was flushed into FBS-containing media with penicillin-streptomycin. Red blood cells were lysed, and bone marrow cells were resuspended in sterile PBS. Irradiated mice were reconstituted with one to five million BMCs via tail vein injection within 24 h of irradiation then controlled cortical impact (CCI) injury was performed 28 days post-injection.
Bead isolation of CD45+ immune cells
Male mice were euthanized, and CD45+ cells were isolated from the lesion area as previously described [
21]. Briefly, the brains were placed in L15 dissecting media (Thermo Fisher, Waltham, MA) before the 4 × 4 mm lesion area was dissected and neural dissociation was performed (kit from Miltenyi Biotech, Auburn, CA). Seven mice were pooled per group (WT
WTBMC and WT
KOBMC), and a single-cell suspension was prepared. The suspension was subjected to CD45+ magnetic microbeads and column separation (MACS; Miltenyi Biotech, Auburn, CA). The flow-through was collected. The CD45+ and final flow-through fractions were placed in Trizol and used for RNA isolation and qPCR. Technical triplicates of the pooled samples were used for qPCR.
Peptide sequences
Three peptide sequences were synthesized: VTM-EEKK (VTMEAINLAFPGEEKK), VTA-EEKK (VTAEAINLAFPGEEKK), and KYL (KYLPYWPVLSSL). All peptides were synthesized via solid-phase peptide synthesis using Rink amide MBHA resin. Amino acids and resin were purchased from P3BioSystems. N,N-Diisopropylethylamine (DIEA), 1,8-diazabicyclo [5.4.0] undec-7-ene (DBU), triisopropylsilane (TIPS), and 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HBTU), and all other reagents were purchased from commercial vendors and used as received. A preparative RP-HPLC (Agilent Technologies 1260 Infinity) with an Agilent PLRP-S column (10 μm, 100 Å) was used to purify peptides. Fractions after HPLC purification were checked by an ESI-MS (Advion Express CMS), and then product-containing fractions were dried by a lyophilizer (LabConco FreeZone 6Plus). The final products were analyzed by a matrix-assisted laser desorption ionization tandem time of flight mass spectrometer (4800 MALDI TOF/TOF; AB Sciex).
Preparation of VTM-EEKK, VTA-EEKK, and KYL peptides
Due to poor hydrosolubility of the VTM peptide, we modified the sequence by adding four hydrophilic amino acids (EEKK) to its C-terminus (VTMEAINLAFPGEEKK; VTM-EEKK). The VTM-EEKK and VTA-EEKK control peptides were synthesized manually via solid-phase peptide synthesis (SPPS) in a shaker vessel using standard Fmoc protocols. The coupling, deprotection, and cleavage solutions were prepared following published methods. An example synthesis of VTM-EEKK is as follows: Rink amide MBHA resin (1 equiv., 0.25 mmol) was added to the shaker vessel and swollen for 15–20 min in 15 ml DMF. The Fmoc group was then deprotected using DBU/piperidine in DMF, and Fmoc-Lys (Boc)-OH (4 equiv., 0.47 g) was coupled using HBTU and DIEA in DMF for 3 h. Coupling was confirmed by the lack of blue color in a Kaiser test. The VTM-EEKK peptide was cleaved by adding 15 ml of cleavage solution (2.5% H2O, 2.5% TIPS in H2O) to the shaker vessel and then shaking for 2.5 h. The peptide solution was drained and collected in a round-bottom flask and then concentrated via rotary evaporation until less than 1 ml solution was left. The peptide was precipitated by pouring cold ethyl ether into the round-bottom flask, and white precipitated peptide powder was recovered by filtration. The crude peptide powders were purified via preparative RP-HPLC, eluting on an Agilent PLRP-S column with H2O and ACN as mobile phases, with 0.1% NH4OH added to each. Pure, product-containing fractions were collected after HPLC and checked by ESI-MS then lyophilized. Aliquots (3 mg each) were prepared by dissolving pure peptide at 10 mg ml−1, adjusting to pH 7 using 0.1 mg ml−1 NaOH, and transferring 300 μl into microcentrifuge tubes. The aliquots were lyophilized and then stored at − 20 °C before use.
Controlled cortical impact
Male mice were anesthetized with ketamine (100 mg/kg) and xylazine (10 mg/kg) via intraperitoneal injection and positioned in a stereotaxic frame. Body temperature was monitored with a rectal probe and maintained at 37 °C with a controlled heating pad set. The Φ = 4 mm craniotomy was made using a portable drill over the right parietal-temporal cortex (− 2.5 mm A/P and 2.0 mm lateral from the bregma). The injury was induced by a program-controlled cortical impactor (Φ = 3-mm beveled tip) connected to an eCCI-6.3 device (Custom Design & Fabrication, LLC) at a velocity of 5.0 m/s, depth of 2.0 mm, and 100 ms impact duration. Following injury, the incision was closed using Vetbond tissue adhesive (3M, St. Paul, MN, USA), and the animals were placed into a heated cage and monitored every 20 min until fully recovered from anesthesia. Alzet® Mini-Osmotic Pumps Model 1007D (Catalog # 0000290, DURECT Corporation, Cupertino, CA) was used to provide continuous systematic delivery of the saline control, VTA-EEKK, VTM-EEKK, or KYL peptide. The dosage of each peptide administration was 10 mg/kg/day.
Blood-brain barrier analysis
BBB disruption following CCI injury was performed as previously described [
21]. Briefly, a 2% sterile Evans blue (EB, Sigma E2129) solution was prepared in 0.1 M PBS and passed through a 0.22-μm filter. Mice having undergone either sham or CCI injury were restrained and injected with 5 μl g
−1 EB solution via the tail vein. Three hours post-injection, the brains were removed and the ipsilateral and contralateral cortical hemispheres dissected and incubated separately in 500 μl formamide (Invitrogen, 15515-026) for 24 h at 55 °C. Samples were then centrifuged to pellet the tissue, and absorbance of the solution was measured at 610 nm using a NanoDrop 1000 Spectrophotometer (Thermo Scientific, Wilmington, DE.). Absorbance at 610 nm was quantified and graphed for each cortical hemisphere.
Evaluation of lesion volume
Lesion volume (mm
3) was assessed by a blinded investigator using Cavalieri Estimator from StereoInvestigator (MicroBrightField, Williston, VT, USA) and an upright Olympus BX51TRF motorized microscope (Olympus America, Center Valley, PA, USA) as previously described [
5,
22]. Briefly, a volume analysis was performed by estimating the area of tissue loss in the ipsilateral cortical hemisphere using five 30 μm serial coronal sections (− 1.1 to − 2.6 mm posterior from bregma). Nissl-stained coronal sections were viewed under fluorescent microscopy at a magnification of × 4. A random sampling scheme was used that estimates every tenth section from rostral to caudal, yielding five total sections to be analyzed. A randomly placed grid with 100-μm spaced points was placed over the ipsilateral hemisphere, and the area of contusion was marked within each grid. Lesion boundaries were identified by loss of Nissl staining, pyknotic neurons, and tissue hemorrhage. The marked areas, using grid spacing, were then used to estimate total tissue volume based on section thickness, section interval, and total number of sections within the Cavalieri probe, StereoInvestigator. Data are represented as the volume of tissue loss or damage (mm
3) for juvenile and adult mice.
Endothelial cell growth and LPS stimulation assays
Endothelial cells were isolated from postnatal day 1–3 brains of EphA4
f/f (WT) and EphA4
f/f /Tie2-Cre then grown in Cell Biologics™ Complete Mouse Endothelial Cell Medium (Catalog # M1168, Chicago, IL) as previously described [
11]. To simulate the endothelial cell response to inflammation, we plated 300,000 cells/well in a 6-well dish in complete media overnight. The following day, we added 1 μg ml
Escherichia coli O111:B4 LPS (Sigma Aldrich, St. Louis, MO) in the presence or absence of KYL (500 μM) and VTM (500 μM) peptides. Cells were washed two times with cold sterile PBS prior to RNA isolation and subsequent analyses. Concentrations used were determined through dosage studies.
Western blot
Cells were washed 3× with cold 1× PBS, or freshly dissected cortices were lysed in RIPA buffer (Tris-base 50 mM, NaCl 150 mM, EDTA 1 mM, NP-40 1%, sodium deoxycholate 0.25%, NaF 20 mM, 1 mM Na
3VO
4 1 mM, β-glycerophosphate 10 mM, azide 0.02%) with Roche Proteinase Inhibitor Cocktail (Catalog # 25178600, Indianapolis, IN) and Thermo Fisher Scientific Pierce™ Phosphatase Inhibitors (Catalog # 88667, Waltham, MA). The total amount of protein was quantified by Lowry method (DC Protein Assay Kit, catalog # 500-0116, Bio-Rad, Hercules, CA). Then, 50 μg total protein of each sample was separated by 8% SDS-PAGE then blotted on to Bio-Rad Laboratories Immin-Blot™ PVDF membrane (Catalog # 162-0177, Hercules, CA). The membranes were incubated with primary antibodies in blocking solution: TBS/0.1% Tween20 (TBST)/5% bovine serum albumin (BSA) for overnight at 4 °C, washed 4× with TBST, and incubated with secondary antibodies (anti-rabbit IgG Dylight™ conjugate 680 or anti-mouse IgG Dylight™ conjugate 800; Cell Signaling Technology, Danvers, MA) for 2 h in blocking solution at room temperature (Table
1). Following 4× wash with TBST, images were acquired by using LI-COR Odyssey Imaging Systems (LI-COR, Inc.), and band intensities were quantified by using NIH ImageJ software.
Table 1
Information of antibodies
β-actin | Cell Signaling Technology | 3700S | 1:10,000 |
Akt | Cell Signaling Technology | 4691P | 1:3000 |
p-Akt (S473) | Cell Signaling Technology | 4060S | 1:3000 |
BrdU | Abcam (IHC) | Ab6326 | 1:500 |
Cx43 | ECM Biosciences | CM4961 | 1:3000 |
EphA4 | ThermoFisher (IHC) | 371,600 | 1:250 |
p-Cx43 (S368) | Cell Signaling Technology | 3511S | 1:3000 |
EphA4 | ECM Biosciences (Western) | EM2801 | 1:3000 |
ERK | Cell Signaling Technology | 9102S | 1:3000 |
p-ERK (T202/Y204) | Cell Signaling Technology | 9101S | 1:3000 |
DyLight680-conjugated anti-rabbit IgG (H+L) | Cell Signaling Technology | 5366S | 1:10,000 |
DyLight800 conjugated anti-mouse IgG (H+L) | Cell Signaling Technology | 5257S | 1:10,000 |
Immunohistochemistry and confocal image analysis
The freshly dissected whole brain was snap-frozen and cryosectioned in serial 30-μm sections. Sections were fixed with 10% buffered formalin, washed 3 times in 1× PBS, and blocked in 2% cold water fish gelatin (Sigma, Inc.) in 0.2% triton for 1 h. The sections were then exposed to mouse anti-EphA4 (ThermoFisher, Cat #:371600) antibody (1:100) in block overnight, washed with 1× PBS then treated with anti-mouse alexFluor594 for 1 h. The sections were further washed in 1× PBS then mounted in media with DAPI counterstain (SouthernBiotech). Images were acquired using a Zeiss 880 confocal microscope (Carl-Zeiss, Oberkochen, Germany).
Quantitative real-time PCR
Total RNA from 4 × 4 mm ipsilateral sham- or CCI-injured cortical tissue was isolated according to the manufacturer’s instructions using TRIzol® reagent (Ambion), and total RNA was isolated from the blood using TRIzol® Reagent LS per manufacturer’s instructions. RNA quantification was carried out by measuring absorbance with spectrophotometer ND-1000 (NanoDrop). RNA was reverse transcribed into cDNA with iScript™ cDNA synthesis kit (Biorad, Hercules, CA) per manufacturer’s specifications. For qRT-PCR analysis, 50 ng cDNA per reaction was amplified using iTaq™ Universal SYBR® Green Supermix (Biorad, Hercules, CA). Expression changes were calculated using ΔCq values with reference to
β-actin internal control gene for cultured cells and
Gapdh internal control gene for all other samples. Relative expression was calculated then normalized and compared to appropriate sham or untreated samples. All primers were tested for primer efficiency which ranged from 87 to 113% (Table
2).
Table 2
Information of qPCR primers
β-actin | Fw: TCGTACCACAGGCATTGTGATGGA |
Rv: TGATGTCACGCACGATTTCCCTCT |
Angpt2 | Fw: GGAAAAGCAGATTTTGGATCAG |
Rv: TTCTGCTCCTTCATGGACTGTA |
Arg1 | Fw: AAGATAGGCCTCCCAGAACCG |
Rv: AAAGGCCGATTCACCTGAGC |
Ccr2 | Fw: GGGCTGTGAGGCTCATCTTT |
Rv: TGCATGGCCTGGTCTAAGTG |
Gapdh | Fw: CGTCCCGTAGACAAAATGGT |
| Rv: TCAATGAAGGGGTCGTTGAT |
Il12p40 | Fw: AGACCCTGCCCATTGAACTG |
Rv: GAAGCTGGTGCTGTAGTTCTCATATT |
Il6 | Fw: CTTCACAAGTCGGAGGCTTAAT |
Rv: GATTGTTTTCTGCAAGTGCATC |
Kc (cxcl1) | Fw: ACCCAAACCGAAGTCATAGCCACA |
Rv: AGTGTTGTCAGAAGCCAGCGTTCA |
Mcp1 | Fw: TCACCTGCTGCTACTCATTCACCA |
Rv: TACAGCTTCTTTGGGACACCTGCT |
Tnf | Fw: AGAAGAGGCACTCCCCCAAA |
Rv: TGAGGGTCTGGGCCATAGAA |
Tie2 | Fw: AAATGACCCTAGTGAAGCCAGA |
Rv: GTCAGGAGGTAAGACTCGGTTG |
Epha4 | Fw: AAAAATGTACTGTGGGGCAGAT |
Rv: TCCGTGGAAAGAGCTTTGTAAT |
Vcam | Fw: GGTGTACGAGCCATCCACAG |
Rv: ACTTGTGGAAATGTGCCCGA |
Gja1 (cx43) | Fw: CGGAAGCACCATCTCCAACT |
Rv: CCACGATAGCTAAGGGCTGG |
Il6r | Fw: CTGTTTGCAACGCACAGTGA |
Rv: AACACCACCAACGGGAAGAG |
Cd86 | Fw: TGTGCCCAAATAGTGCTCGT |
Rv: TCTGCCGTGCCCATTTACAA |
Macrophage culture
Bone marrow cells (BMCs) isolated from 8- to 12-week WT CD1 background mice were cultured in DMEM medium supplemented with 10% fetal bovine serum, 2 mM l-glutamine, 1% penicillin/streptomycin, and 10 ng ml−1 M-CSF. Briefly, bone marrow-derived macrophages (BMDMs) were isolated from the femurs, filtered through a 70-μm filter; red blood cells were lysed using ACK lysing buffer (Gibco); and cells were cultured at 1 × 106 cells ml−1 in complete DMEM medium. Cells received fresh media containing 10% FBS, 2 mM l-glutamine, 1% penicillin/streptomycin, and 10 ng ml−1 M-CSF on days 2 and 4. After 5 days, cultured cells were washed with PBS and given fresh DMEM containing no M-CSF or FBS for subsequent treatments with VTM and KYL peptide. BMDMs were allowed to equilibrate for 2 h in fresh DMEM medium prior to VTM and KYL peptide treatment. The BMDMs were treated with KYL (500 μM) and VTM (500 μM) 1 h prior to 4 h treatment with 1 μg ml−1 Escherichia coli O111:B4 LPS (Sigma Aldrich, St. Louis, MO). Polarization studies were performed by changing media on day 5 to DMEM containing 10% FBS, 2 mM l-glutamine, 1% penicillin/streptomycin, and 5 ng ml−1 M-CSF. Day 5 BMDMs were then treated with IL-4 (20 ng/ml; R&D systems) or IFNγ (80 ng/ml; R&D Systems) for 48 h for M2 or M1 polarization, respectively. Cells were washed two times with cold sterile PBS prior to RNA isolations and subsequent analyses. All concentrations were determined through dosage studies.
Phospho microarray
Using a commercially available high-throughput ELISA-based antibody Cancer Signaling Phosphoarray (Full Moon Biosystems, Inc., Sunnyvale, CA), we analyzed the total and phospho-protein changes between WT and EphA4
−/− BMDMs. BMDMs were cultured as described previously and treated with PBS or 1 μg ml
−1 Escherichia coli O111:B4 LPS (Sigma Aldrich, St. Louis, MO) for 4 h prior to protein isolation. Cells were washed 3× with cold 1× PBS and lysed in RIPA buffer (Tris-base 50 mM, NaCl 150 mM, EDTA 1 mM, NP-40 1%, sodium deoxycholate 0.25%, NaF 20 mM, 1 mM Na
3VO
4 1 mM, β-glycerophosphate 10 mM, azide 0.02%) with Roche Proteinase Inhibitor Cocktail (Catalog # 25178600, Indianapolis, IN) and Thermo Fisher Scientific Pierce™ Phosphatase Inhibitors (Catalog # 88667, Waltham, MA). The total amount of protein was quantified by the Lowry method (DC Protein Assay Kit, catalog # 500-0116, Bio-Rad, Hercules, CA). Protein was purified using the buffer exchange/lysate purification system given with the Cancer Signaling Phospho microarray. Then 100 μg of purified protein for each sample was used for the remaining of the protocol per manufacturer’s instructions. GenePix Microarray Scanner, 4000B (Molecular Devices, LLC., San Jose, CA) was used to image the microarray, and GenePix Pro (Molecular Devices, LLC., San Jose, CA) software was used for subsequent analyses. Full Moon Biosystems analyzed the data using the average signal intensity of six individual blots, for each pair of site-specific antibody and phosphosite-specific antibody; signal ratio of the paired antibodies was determined. A fold change was considered significant when the value was less than 0.5 or greater than 1.5 (Additional file
1). A 95% CI was used to quantify the precision of the phosphorylation ratio based on the analysis of the six individual sample replicates.
Statistical analysis
Data was graphed using GraphPad Prism, version 7 (GraphPad Software, Inc., San Diego, CA). Student’s two-tailed t test was used for comparison of the two experimental groups. For three or more groups, multiple comparisons were done using one-way and two-way ANOVA where appropriate followed by Bonferroni post hoc test for multiple pairwise examinations. Changes were identified as significant if p was less than 0.05. Mean values were reported together with the standard error of the mean (SEM). The sample size was determined based on an effect size measured for each outcome by pilot or prior studies. G*Power 3 (Universitat Dusseldorf, Germany) was used to retrieve sample size using an acceptable power range between 80 and 90%. All animal and serial sections were coded, and a double-blinded strategy was used in all stereological analysis.
Discussion
Eph receptor signaling plays a central role in the disease of CNS [
5,
6,
49‐
52]. The current study reveal a novel role for this axon growth and guidance molecule in regulating the pro-inflammatory state of monocyte/macrophage and mediating tissue damage following TBI. We demonstrate EphA4 is upregulated in the cortex within hours of CCI injury and on CX3CR1-expressing infiltrated and/or resident monocyte/macrophages in the peri-lesion cortex. We also show that inhibition of the EphA4 receptor [
20,
53] provides significant tissue protection in a murine model of cortical contusion injury which mimics the effects observed in global EphA4
−/− mice. Gene expression analysis of the cortex and peripheral immune cell response indicates that blocking EphA4 following peptide inhibition attenuates a pro-inflammatory milieu while promoting a pro-resolving state. These findings were mimicked in EphA4 bone marrow chimeric KO mice indicating loss of EphA4 is neuroprotective, in large part, by regulating the peripheral immune system. These results show a novel mechanism by which inflammation is regulated by Eph receptor signaling. In vitro, we also show that EphA4 inhibition blunts the LPS-induced response of cultured monocyte/macrophages and endothelial cells, shifting them towards a pro-resolving rather than pro-inflammatory phenotype, potentially via p-AKT signaling [
54]. These novel findings demonstrate EphA4 negatively regulates acute TBI outcome by mediating the pro-inflammatory milieu.
Monocyte infiltration and inflammation is a major component of secondary brain injury and has been a target of treatment aimed at limiting TBI-induced disability [
55,
56]. Trauma initiates both local CNS and systemic peripheral inflammation processes [
57‐
59]. Previous studies have implicated EphA4 in chronic glial scar formation and are upregulated in acute closed-head injury in humans and non-human primates [
12,
60]. We also find a significant acute increase in EphA4 expression in the ipsilateral cortex within hours following CCI injury, which correlates with the induction of inflammation in the brain following TBI [
57]. The inflammatory response is a key driver in the pathogenesis of TBI [
61]; however, the mechanisms underlying its influence remain poorly understood. The failure of anti-inflammatory drugs to improve outcome in a human clinical trial suggests a more complex role of inflammation which may be reflective of regional (resident vs peripheral), phenotypic (M1 vs M2), and time-dependent differences that occur in response to TBI. A better understanding of these changes is needed in order to restore immunologic balance.
Cytokines are induced in a time-dependent manner in the human brain and arterial plasma including TNF, IL-1, IL-6, IL-8, IL12p70, MCP-1, IL-10, and VEGF [
57,
62,
63]. IL-6 and IL-8 are increased in serum following injury and correlate with unfavorable outcomes of human patients [
64,
65]. It has also been previously shown that IL-6 blockage after TBI decreased motor coordination deficits in TBI/hypoxia models [
66]. We demonstrated decreased levels of
Il6 mRNA in the blood and brain of VTM-EEKK- and KYL-treated mice, which has been correlated with better patient outcome in humans [
67]. We also demonstrated that VTM and KYL peptide were capable of attenuating the IL-8 homolog
Cxcl1 mRNA levels with acute inflammation in cultured macrophages. It is also important to note that EphA4 inhibition or deficiency consistently decreased
Mcp1 signaling throughout our study, which is a key signaling molecule in monocyte infiltration into the brain through CCR2 [
68]. The attenuation of pro-inflammatory gene expression following in vitro LPS stimulation after loss of EphA4 or peptide inhibition of EphA4 suggests that EphA4 may be responsible for increased inflammation and secondary damage following TBI. Our findings suggest that EphA4 inhibition may shift the inflammatory response towards a pro-resolving state as shown by the differential changes in the expression of
Il-6,
Il-8, and
Il-12 and
TNF compared to
Il10,
Arginase-1,
Angpt2, and
Tgfβ. Some of the mRNA level discrepancies between KYL and VTM treatments may be due to KYL promiscuity, leading to slightly different responses between the two inhibitors. However, further time- and dose-dependent evaluation is needed as these differences may be related to the length of binding time and potential internalization of peptide/receptor complexes. Nonetheless, our in vitro studies expand our understanding of the acute pro-inflammatory role of EphA4 and suggest the negative effects of EphA4 activation following CCI injury may be the result of its phenotypic control over peripheral-derived monocytes. Surprisingly, KO BMCs isolated from the injured cortex did not show greater differences in pro-inflammatory genes such as
Il6 compared to WT cells. Given the gene expression was evaluated sub-acutely, it is possible we overlooked the early pro-inflammatory activation of infiltrating immune cells and instead overserved the enhanced pro-resolving state of the cells.
The clinical importance of pro-resolving gene expression is evident in human plasma levels of the angiopoietin/Tie2 axis, which has been shown to be a predictive biomarker for vascular integrity and outcome following TBI [
69]. We also found that once EphA4-null monocyte/macrophages are polarized to M1 pro-inflammatory phenotype, they exhibit less
CD86,
IL-12p40,
Ccr2, and
Mcp1. CD86 is a key glycoprotein expressed in macrophages that activate naive T cells, contributing to inflammatory signaling in other cell types, suggesting beneficial cross talk may also be possible among monocyte/macrophages and infiltrating T cells in the TBI milieu. It is also important to note a key marker and inflammatory cytokine IL12p40 is decreased in polarized EphA4-KO cells implying less inflammatory behavior once polarized to pro-inflammatory. Reduced MCP1/CCR2 signaling observed in EphA4-KO M1 monocyte/macrophages in vitro and in vivo may also explain decreased inflammation and infiltration of GFP+ immune cells in EphA4 chimeric mice. Moreover, once polarized to an anti-inflammatory phenotype, cultured EphA4-KO monocyte/macrophages exhibit higher
Arg1, a prominent anti-inflammatory mediator, and increased
Tie2 and
Angpt2 expression compared to WT cells. While vascular Tie2 and Angpt2 expression are both necessary for vascular stability, which would be beneficial in the TBI milieu [
69,
70], Angpt2 has also been shown to skew the phenotype of Tie2-expressing monocytes (TEMs) towards M2-like state [
37]. Interestingly, we found the KO BMCs isolated from the injured cortex, and KO M2-skewed cells cultured in vitro displayed increased Tie2 and Angpt2 expression suggesting the loss of peripheral immune-specific EphA4 may increase the presence/numbers of (TEMs) or increase the pro-resolving functional characteristics TEMs in the injured milieu. However, given there is evidence that Tie2 may regulate the pro-inflammatory activation of human macrophages [
71,
72], additional studies are needed to further explore whether these effects are cell and/or context dependent. Additional findings also demonstrate Tie2 expression and function on human neutrophils regulate their chemotaxis and viability [
73,
74]. Further elucidation of these pathways, including analysis of NFkB, is needed to expand our mechanistic understanding of EphA4’s role in the peripheral immune cell response to TBI. In addition, their role in regulating brain resident-derived immune cell responses, such as microglia activation, and the potential role of EphA4 on these neuroimmune cells are needed.
While the controversial role of peripheral immune activation in brain trauma remains under investigation, our novel findings demonstrate the well-known axon guidance molecule, EphA4, is upregulated within hours of TBI and plays a substantial role in the neuro-immune milieu. We have also identified EphA4 as a novel regulator of the monocyte/macrophage inflammatory response following LPS stimulation and TBI. This newly identified regulator of neuroinflammation expands our knowledge of the key players that may be involved in fine-tuning the inflammatory profile in the brain necessary for tissue homeostasis.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.