Role of endothelial PDGFB in arterio-venous malformations pathogenesis

To address the role of PDGFB-mediated PC recruitment in AVM pathogenesis, we depleted Pdgfb specifically in ECs by crossing Pdgfb^fl/fl to the tamoxifen (TX) inducible Cdh5-CreERT2 mouse line to create Pdgfb^iΔEC (Fig. 1A). Pdgfb gene depletion was induced in newborns via intraperitoneal (i.p) TX administration at postnatal days (P0–P2 and retinal vasculature was analyzed at P7. Efficient gene depletion was confirmed by qPCR and western blot (WB) in mouse lung ECs (mLECs) isolated from TX induced P7 pups (Suppl. Fig. 1a, b). Loss of Pdgfb resulted in no significant changes in the body weight compared to control neonates (Pdgfb^fl/fl) (Suppl. Fig. 1c). Labeling P7 Pdgfb^fl/fl and Pdgfb^iΔEC retinas for myocardial neuron-glial antigen 2 (NG2), a MC marker, and Isolectin B4 (IB4) to detect the ECs, revealed severely impaired PC coverage of the developing vessels (Fig. 1B, quantified in C) with multiple vascular defects: decrease in vascular area and outgrowth, loss of side branches, and vessel dilation with the highest impact within the capillaries and a significant decline in the morphological altered tip cell number with fewer and shorter filopodia (Fig. 1D; Suppl. Fig. 1d–f), thus confirming previous findings [7, 25, 26].

Interestingly, in addition to the previously described phenotypes, loss of Pdgfb led to direct connections between arteries and veins at the vascular front, on average 1.7 connections per retina (arrowhead in Fig. 1D, quantified in E). To confirm whether these direct connections between arteries and veins are indeed AV shunts, we injected latex red-dye into the left side of the neonatal P7 hearts [20]. Due to its size, the latex cannot pass the capillary bed and remains confined to arterial branches. Yet, in Pdgfb^iΔEC retinas, latex was present in the enlarged capillaries and into the retinal veins, suggesting direct AV connections between arteries and veins upon Pdgfb LOF (Fig. 1F). To identify if Pdgfb loss leads to AV shunting in other organs, we analyzed other vascular beds following intracardial latex injection. Interestingly, we found AV shunting also in the pial vessels (Fig. 1G) and latex perfused veins in the skin of the scalp, gastrointestinal (GI) tract (small intestine) and lungs of mutant neonates, whereas no perfused veins were seen in control neonates (Fig. 1H–J). These findings may indicate either capillary enlargement in visceral organs, or presence of direct AV shunting at a downstream or upstream location from the visualized vascular field. Thus, PDGFB-mediated PC recruitment regulates retinal angiogenesis and capillary size.

To further understand if PDGFB-mediated maintenance of PCs on developing endothelium is required to control capillary size, we depleted Pdgfb at P5–P7 and analyzed retinas at P12 (Fig. 2A). Interestingly, loss of Pdgfb at this stage led to increased retinal hemorrhage (Fig. 2B), and impaired PC coverage as quantified by the NG2 + /IB4 + vascular area (Fig. 2C). By measuring vessel diameter at P12, we found a significantly altered capillary enlargement, while the diameter of veins or arteries remained unaffected (Fig. 2D). Retinal AV shunting occurred with an average of 1.7 connections per retina as shown by IB4 + endothelium and latex positive capillaries and veins (Fig. 2E, quantified in F). Surprisingly, at this stage, the AVM-like structures formed closer to the optic nerve, in higher flow regions (arrowheads in Fig. 2E), suggesting that blood flow participates in AV shunt formation upon Pdgfb depletion. Latex dye-positive veins were also observed in the GI tract (Fig. 2G). These findings argue that PDGFB is indispensable for the maintenance of PCs on developing endothelium to restrict capillary size and protect against retinal AV shunting.

The Pdgfb LOF phenotype was extensively described [7, 26], yet AV shunt formation hasn’t been reported so far. Therefore, we focused on characterizing the cellular hallmarks of AVM-like structures in P7 Pdgfb^iΔEC retinas. Upon staining retinas for alpha smooth muscle actin (αSMA), we found a strong reduction in arterial vascular smooth muscle cells (vSMC) coverage, with scattered αSMA + immunostaining in capillaries and more abundant in veins but no ectopic αSMA within the AV shunt capillaries (Suppl Fig. 2a, quantified in b). Labelling retinas for IB4 and ICAM2, a cell adhesion molecule located at the apical EC surface further confirmed an increase in capillaries’ lumen (Suppl Fig. 2c, quantified in d). Staining for Collagen IV (ColIV) that labels the basal surface identified a higher number of empty sleeves (IB4-/ColIV +) (Suppl Fig. 2e, quantified in f), indicating excessive vascular pruning events in Pdgfb^iΔEC retinas.

We next reasoned that the expansion of capillary diameter is due to, either an increase in the size of capillary ECs or due to proliferating ECs clustering within capillaries. Another possibility is that perhaps disrupted EC migration against the bloodstream contributes to lumen enlargement, as capillary regression in developing vascular plexus is a cell migration–driven process from low towards higher flow regions [27].

Staining retinas for VE-cadherin identified larger capillary single ECs and loss of VE-cadherin at cell–cell junctions (Fig. 3A, quantified in B), consistent with the increased hemorrhage observed in P12 mutant retinas (in Fig. 2B). Furthermore, labeling for the endothelial nuclear ERG1,2,3 transcription factor (ERG) [28] and IB4 identified an increase in the number of capillary EC nuclei per capillary width (Fig. 3C, quantified in D). In control retinas, capillaries contained a single EC, whereas in Pdgfb^iΔEC retinas, capillaries contained two to three EC nuclei (Fig. 3C, quantified in D).

To assess if EC proliferation leads to capillary expansion, we further quantified the proportion of ECs in S-phase (EdU + ERG + /ERG +) upon 5-ethynyl-2′-deoxyuridine (EdU) incorporation in capillary ECs at the vascular retinal front in Pdgfb^fl/fl and Pdgfb^iΔEC neonates. We found an overall decrease in the total number of ERG + ECs with fewer EdU + ERG + cells within the AVM-like structures (Fig. 3E, quantified in F), suggesting that capillary enhancement does not involve proliferation. Furthermore, labeling retinas for P21 encoded by CDKN1A (cyclin dependent kinase inhibitor 1A), an indicator of cell cycle arrest [29], showed an increase in the number of arrested ECs (P21 + ERG + cells) within the dilated capillaries (Suppl. Fig. 2g, quantified in h).

Failure of ECs to orient and migrate against the bloodstream was proposed to trigger AVM formation upon depletion of BMP9/10 signaling receptors, Alk1 and Eng in ECs [30, 31]. This physiological process is crucial for vessel regression-mediated vascular remodeling and artery formation [27, 32‐34]. To identify if defective flow-mediated EC migration contributes to capillary enlargement and AV shunting, we labelled Pdgfb^fl/fl and Pdgfb^iΔEC retinas for Golph4 (to detect the Golgi apparatus), ERG and IB4. Quantifying the Golgi position in relation to the nucleus and flow direction, we found a significant altered orientation of Pdgfb mutant ECs against the bloodstream in arteries, with a more pronounced EC polarization with the flow in veins and capillary ECs engaged in AV shunts (Fig. 3G–I, quantified in J). Taken together, these results suggest that capillary enlargement does not involve proliferation but instead an increase in single EC size and disrupted EC migration against the bloodstream.

As capillary enlargement leads to changes in blood flow or fluid shear stress (FSS), we further assessed the cellular effects of PDGFB depletion (using the siRNA strategy) in HUVECs subject to low fluid shear stress (L-FSS) (1 DYNE/cm²). Remarkably, PDGFB depleted HUVECs under 1 DYNE/cm² were larger, more elongated and aligned parallel to the direction of flow, whereas no significant changes were observed in CTRL siRNA HUVECs (Fig. 3K, quantified in L). We further addressed the effect of PDGFB loss on EC orientation in response to physiological flow (12 DYNES/cm²). Labelled HUVECs for GM130 (for Golgi apparatus), DAPI (for nucleus) and VE Cadherin showed dysregulated migration against the flow direction, with more ECs polarized with the flow upon PDGFB loss (Fig. 3M, quantified in N). Thus, PDGFB depletion amplifies morphological responses to FSS e.g. EC size, elongation and alignment and leads to disrupted EC orientation against the FSS direction.

Previous analysis of single-cell RNAseq datasets identified defective capillary zonation with venous skewing in the brain microvasculature of Pdgfb hypomorphs (Pdgfb^ret/ret), pointing towards the role of PCs in maintaining capillary arterio-venous differentiation [35]. To identify if an altered arterial-venous zonation occurs in AVM-like structures in the retina, we immunolabeled control and Pdgfb^iΔEC retinas for several arterial and venous markers at P7. While JAG1, a ligand of NOTCH1 marks predominantly the arteries and arterioles in control retinas [36], in Pdgfb LOF retinas, JAG1 expression was retained in arteries but decreased in the arterioles (red arrows in Fig. 4A, quantified in B). In contrast, Endomucin, a transmembrane sialomucin expressed exclusively on the surface of capillary and venous ECs [37, 38], displayed an opposite pattern in Pdgfb^iΔEC vasculature, its expression was upregulated in all capillary ECs expanding also into arterioles (Fig. 4C, quantified in D). These results suggest gain of venous identity and loss of arterial identity. To confirm venous skewing upon Pdgfb loss, we performed qPCR on isolated mLECs and observed upregulation of the venous markers, e.g. EphB4, Nrp2, Nr2f2 and Aplnr (Fig. 4E). Surprisingly though, we identified an upregulation of the arterial markers (Sox17, Nrp1, Efnb2) as well (Fig. 4F).

To dig further into possible gain of arterial identity, we labeled retinas for arterial markers: Sox17 (SRY-box transcription factor 17) which plays a crucial role in arterial identity maintenance [39] and Notch ligand Delta-like 4 (Dll4), another NOTCH1 ligand. Interestingly, upon Pdgfb loss, Sox17 expression extended exclusively throughout the AV shunt from the artery towards the vein, with some Sox17 positive ECs present within the vein (arrowheads in Fig. 4G, quantified in H). A similar pattern was observed also for Dll4 (arrowheads in Fig. 4I, quantified in J).

To test the hypothesis that AVMs-like structures upon Pdgfb LOF are of arterial origin, we intercrossed Pdgfb^fl/fl mice to an artery-specific BMX non-receptor tyrosine kinase (BMX) mouse line and mTmG reporter mice to lineage-trace green fluorescent protein (GFP) in Bmx + and Pdgfb depleted ECs (Pdgfb^iΔBMX;mTmG). Tx was injected at P0-P2, and retinas were analyzed at P7 (Fig. 5A). GFP was detected in arteries and some arterioli of Pdgfb^iΔBMX;mTmG retinas confirming Cre-mediated recombination specifically in arterial ECs (Fig. 5B). We found that Pdgfb^iΔBMX;mTmG mutants displayed no retinal AVMs (Fig. 5B), and loss of Pdgfb specifically in arterial ECs led to a non-significant loss of PCs (Fig. 5C, quantified in E) or αSMA (Fig. 5D, quantified in F) with no obvious vascular defects (Fig. 5G, H). These results imply that PDGFB is dispensable for artery maintenance and in the same time suggest a non-arterial origin for the AVM-like upon Pdgfb loss.

As we identified a mixed arterial-venous zonation within the AV shunts, we next focused on signaling pathways regulating arterial-venous identity, whose disruption may contribute to AV shunting in Pdgfb LOF mice. In addition to a well-described role of NOTCH signaling in maintaining arterial identity [33, 40, 41], more recently it has been proposed that TGFβ and BMP signaling pathways regulate arterial and venous identity, respectively [42].

As a readout for TGFβ/BMP pathway activation, we labelled Pdgfb^fl/fl and Pdgfb^iΔEC retinas for phosphorylated canonical SMADs. Surprisingly, we identified abundant expression in ECs of both activated canonical SMADs, the pSMAD3 (Fig. 6A, quantified in B) and pSMAD1/5 (Fig. 6C, quantified in D) at the highest intensity within the enlarged capillaries engaged in AVMs-like structures. Furthermore, activation of the canonical SMADs was accompanied by upregulation of TGFβ/BMP target genes [43‐45], ID1 (Fig. 6E, quantified in F) and ENG (Fig. 6G, quantified in H). To validate these results, we performed WB for the activated SMADs (Fig. 6I) and qPCR analysis for the TGFβ/BMP target genes in mLECs isolated from TX induced P7 Pdgfb^fl/fl and Pdgfb^iΔEC mice (Fig. 6J). We confirmed increased phosphorylation in SMAD3 and SMAD1/5 (Fig. 6I) and upregulation of TGFβ/BMP downstream target genes: Eng, Thbs1 (Thrombospondin1) and Fn1 (Fibronectin), thus validating activation of TGFβ/BMP signaling pathways upon loss of Pdgfb in ECs. Interestingly, opposite as expected, we identified upregulation of Apln (Apelin) (Fig. 6J), a known suppressed BMP target gene [46].

As gain of NOTCH signaling in ECs also leads to AV shunting, and we detected increased Dll4 within the enlarged capillary ECs, we performed qPCR for NOTCH transducers and transcriptional effectors and identified an increase in the expression of Notch1 and Notch4 receptors and upregulated transcription factors Hey1, Hey2 and Hes1 (Fig. 6K), indicating, additionally, EC NOTCH activation upon Pdgfb loss.

Physiological blood flow-induced FSS maintains vascular stability by mediating MC recruitment [3, 4] and promoting EC elongation, alignment [47] and arterial cell fate [48, 49]. In turn, MCs regulate the blood flow and vascular tone [5], but also the blood flow directionality [10].

Capillary expansion upon Pdgfb loss results in an altered blood flow and/or an altered FSS within the capillaries. To visualize changes in flow patterns upon Pdgfb loss, we labelled retinas for KLF4, a mechanosensor previously identified as a robust readout of physiological FSS in the retina vasculature [21]. Whereas KLF4 is little expressed in low flow regions-vascular front and capillary ECs in control retinas, in Pdgfb^iΔEC retinas, KLF4 expression expanded throughout the capillary plexus with more KLF4 + ECs in the capillaries and veins engaged in the direct connections at the vascular front (Fig. 7A and B, quantified in C).

Interestingly, measuring KLF4 labeling intensity per single EC as a readout for its activation upon flow, KLF4 appeared more enhanced in capillaries and veins engaged in AV shunts in contrast to control retinas where KLF4 was intensely labeling the high flow arteries and the arterial branch points (Fig. 7D). Upregulation of Klf4 expression was also validated by qPCR in Pdgfb^iΔEC mLECs (Fig. 7E). Together, these results emphasize that high KLF4 within the enlarged capillaries is likely a consequence of the combination of pathological flow and increased sensitivity of ECs to flow, thus supporting our in vitro data (Fig. 3K–L).

Interestingly, KLF4 was previously identified as a direct transcriptional activator of BMP6 [50], TGF-β1 [51] and Dll4 [52] ligands. As increased Dll4 and NOTCH activation was already confirmed (Fig. 4I, 6K), we performed qPCR and WB for Tgf-β1 and Bmp6 in Pdgfb^fl/fl and Pdgfb^iΔEC mLECs. Both Tgf-β1 and Bmp6 mRNAs and proteins were upregulated upon Pdgfb loss (Fig. 7F, G). Interestingly, Acvr1 and Tgfbr1 coding for the Alk2 and Alk5 receptors were also upregulated (Fig. 7H).To validate these findings, we next labelled retinas for Bmp6 (Fig. 7I) and Tgf-β1 (Fig. 7J). While, the ligands were very little expressed in control retinas, both BMP6 and TGF-β1 showed increased expression at the vascular front and in the AV shunts (Fig. 7I–L). Thus, within the dilated capillaries, endothelial overactivation of KLF4 is associated with TGF-β1 and BMP6 upregulation that presumably mediates the downstream activation of canonical SMADs simultaneously with increased Dll4-mediated NOTCH activation.

Deletion of endothelial Pdgfb (Pdgfb^iΔEC) was achieved by crossing Pdgfb fl/fl with Tx inducible Cdh5-Cre^ERT2 mice. Deletion of Pdgfb in the arterial ECs (Pdgfb^iΔBMX) was achieved by crossing Pdgfb fl/fl to the Tx inducible Bmx-Cre^ERT2;mTmG mice. Gene deletion was achieved by i.p injections of 100 µg Tx (Sigma, T5648) into Pdgfb^iΔEC or Pdgfb^iΔBMX at postnatal days (P0–P2) or (P5–P7). Tx-injected Cre-negative littermates (fl/fl) were used as controls. Mice were maintained under standard specific pathogen-free conditions, and animal procedures were approved by the animal welfare commission of the Regierungspräsidium Karlsruhe (Karlsruhe, Germany) and The Comité Institutionnel des Bonnes Pratiques Animales en Recherche (CIBPAR), Canada.

P7 or P12 pups were anaesthetized and perfused with 2 ml of PBS. Latex dye (Connecticut Valley Biological Supply Company) was slowly injected through left ventricle with an 1 ml insulin syringe. To visualize pulmonary arteries, latex was injected into the right ventricle. Tissues were fixed in 4% PFA at 4 °C overnight and washed in PBS the following day. The dissected organs were imaged under a dissection microscope.

For immunodetection: anti-NG2 (#AB5320, 1:200, millipore), Isolectin B4 (IB4, #121412, 10 μg/ml, Life Technologies), anti-GOLPH4 (#ab28049; 1:200, Abcam), anti-ERG (#92513; 1:200, Abcam), anti-KLF4 (#AF3158, 1:200, R&D systems), anti-SOX17 (#AF1924, 1:200, R&D systems), anti-VE-cadherin (#555289, 1:400, BD), anti-Jag1 (#AF599, 1:200, R&D systems), anti-Endomucin (#sc-65495, 1:200, Santa Cruz), anti-Dll4 (#AF1389, 1:200, R&D systems), anti-phospho-SMAD3 (#ab52903, 1:100, Abcam), anti-phospho-SMAD1/5 (#13820S, 1:100, Cell Signalling), anti-ID1 (#AF4377, 1:100, R&D systems), anti-Endoglin (#AF1320, 1:100, R&D systems), anti-GM130 (#610823; 1:600 BD Bioscience), anti-BMP6 (#ab15640, 1:100, Abcam), anti-TGF-β1 (#MAB7666, 1:100, R&D systems), anti-αSMA (#ab184675,1:600, Abcam), anti-ICAM2 (#553326, 1:200, BD), anti-Collagen IV (#ab6586, 1:200, Abcam) and anti-P21 from CNIO-Centro Nacional de Investigaciones Oncológicas).

For WB: anti-PPDGFB (#ab23914, 1:1,000, Abcam), anti-SMAD1 (#6944S, 1:1,000, Cell Signalling), anti-SMAD2/3 (#8685S; 1:1000; Cell Signalling), anti-phospho-SMAD1/5/8 (#13820S, 1:1000, Cell Signalling), anti-phospho-SMAD3 (#ab52903, 1:1000, Abcam), anti-TGF-β1 (#sc52893, 1:500, Santa cruz) and anti-VE-cadherin (#sc9989, 1:200, Santa cruz).

Appropriate secondary antibodies were fluorescently labelled (Alexa Fluor donkey anti-rabbit, #R37118, Alexa Fluor donkey anti-goat 555, #A-21432, 1:250, Thermo Fisher) or conjugated to horseradish peroxidase for WB (Anti-Rabbit #PI-1000-1 and Anti-mouse #PI-2000-1 IgG (H + L), 1:5000, Vector Laboratories).

For analysis of cell proliferation in the retinas, pups were injected i.p with 5-ethynyl-2-deoxyuridine (EdU, 100 mg/Kg; Thermo Fischer Scientific) 4 h before dissection. Retinas were collected and EdU labelling was detected with the Click-it EdU Alexa Fluor-488 Imaging Kit (C10337, Life Technologies) according to the manufacturer’s instructions.

Mouse lung ECs were isolated using MACS (Miltenyi Biotec). Mice were sacrificed and lungs were harvested immediately. Lungs were cut into small pieces and digested with collagenase I at 37 °C for 45 min. Tissue suspension was passed through 70 μm cell strainer, incubated with red blood cell lysis Buffer (11814389001, Sigma) and washed several times with PEB buffer (0.5% BSA, 2 mM EDTA in PBS). Cell suspension was incubated with CD45 MicroBeads (1:10) for 15 min at 4 °C and passed through the MS columns. The unlabeled cells were collected and centrifuged at 1000 rpm at 4 °C for 10 min. Cell pellets was resuspended with PEB buffer and incubated with CD31 MicroBeads (1:10) for 15 min at 4 °C and applied onto MS columns, eluted from the columns with PEB buffer and directly used for RNA or protein extraction.

RNA extraction from mLECs were performed using RNeasy-kit (74106, Qiagen) according to the manufacturer’s instructions. The RNA was reverse transcribed using High-Capacity cDNA Reverse Transcription Kit (4368813, Thermo Fisher) and quantitative PCR assays were carried out using PowerUP SYBR Green Master Mix (A25778, Thermo Fisher) with a QuantStudio 3 (Thermo Fisher) according to the manufactures protocol. The following primers were used for mLECs: Eng (Forward: AGGGGTGAGGTGACGTTTAC, Reverse: GTGCCATTTTGCTTGGATGC), Thbs1 (Forward: CCTGCCAGGGAAGCAACAA, Reverse: ACAGTCTATGTAGAGTTGAGCCC), Fn1 (Forward: ATGTGGACCCCTCCTGATAGT, Reverse: GCCCAGTGATTTCAGCAAAGG), Dll4 (Forward: TTCCAGGCAACCTTCTCCGA, Reverse: ACTGCCGCTATTCTTGTCCC), Notch1 (Forward: GATGGCCTCAATGGGTACAAG, Reverse: TCGTTGTTGTTGATGTCACAGT), Notch4 (Forward: GAACGCGACATCAACGAGTG, Reverse: GGAACCCAAGGTGTTATGGCA), Hey1 (Forward: CCGACGAGACCGAATCAATAAC, Reverse: TCAGGTGATCCACAGTCATCTG), Hey2 (Forward: CGCCCTTGTGAGGAAACGA, Reverse: CCCAGGGTAATTGTTCTCGCT), Hes1 (Forward: TCAACACGACACCGGACAAAC, Reverse: ATGCCGGGAGCTATCTTTCTT), Klf4 (Forward: GGCGAGTCTGACATGGCTG, Reverse: GCTGGACGCAGTGTCTTCTC), Bmp6 (Forward: GCGGGAGATGCAAAAGGAGAT, Reverse: ATTGGACAGGGCGTTGTAGAG), Tgf-β1 (Forward: CCACCTGCAAGACCATCGAC, Reverse: CTGGCGAGCCTTAGTTTGGAC), Pdgfb (Forward: CATCCGCTCCTTTGATGATCTT, Reverse: GTGCTCGGGTCATGTTCAAGT), Ephb4 (Forward: GGAAACGGCGGATCTGAAATG, Reverse: TGGACGCTTCATGTCGCAC), Nrp2 (Forward: GCTGGCTACATCACTTCCCC, Reverse: GGGCGTAGACAATCCACTCA), Nr2f2 (Forward: CATCGAGAACATTTGCGAACTG, Reverse: GTCGGCTGACATGGGTGAAG), Aplnr (Forward: CCAGTCTGAATGCGACTACG, Reverse: CTCCCGGTAGGTATAAGTGGC), Sox17 (Forward: GATGCGGGATACGCCAGTG, Reverse: CCACCTCGCCTTTCACCTTTA), Nrp1 (Forward: ACCTCACATCTCCCGGTTACC, Reverse: AAGGTGCAATCTTCCCACAGA), Unc5b (Forward: CGGGACGCTACTTGACTCC, Reverse: GGTGGCTTTTAGGGTCGTTTAG), Efnb2 (Forward: TTGCCCCAAAGTGGACTCTAA, Reverse: GCAGCGGGGTATTCTCCTTC), Tgfbr1 (Forward: AAAACAGGGGCAGTTACTACAAC, Reverse: TGGCAGATATAGACCATCAGCA), Acvr1 (Forward: ATGGTCGATGGAGTAATGATCCT, Reverse: TGCTCATAAACCTGAAAGCAGC).

The eyes from P7 or P12 pups were fixed in 4% PFA for 17 min at room temperature (rt). Post dissection, the retinas were washed 3 times with PBS and then incubated in blocking buffer (1% fetal bovine serum, 3% BSA, 0.5% Triton X-100, 0.01% sodium deoxycholate, 0.02% sodium azide in PBS at pH 7.4) for 15 min at rt. Post-blocking, retinas were incubated with specific antibodies diluted in blocking buffer overnight, at 4 °C. The next day, retinas were washed and incubated with anti-IB4 together with the corresponding secondary antibody in PBLEC buffer (1 mM CaCl₂, 1 mM MgCl₂, 1 mM MnCl₂ and 0,25% Triton X-100 in PBS) for 1 h at rt, postfixed for 20 min with 4% PFA in rt, washed and mounted in fluorescent mounting medium (RotiMount FluorCare #HP19.1, CarlRoth). Whole-mount retina images were acquired using Zeiss LSM800 confocal microscope with Airyscan Detector and the Zeiss ZEN software. Quantification of retinal vasculature was analyzed using Fiji.

Total protein from the mLECS were lysed with Laemmli buffer (1610747, Biorad). Samples were separated on 10% SDS-PAGE gels and transferred on 0.2 µm nitrocellulose membranes (10600004, GE Healthcare). Western blots were developed with the Clarity Western ECL Substrate (1705061, Biorad) on a Luminescent image Analyzer, Fusion FX (Vilber). Bands’ intensity were quantified using ImageJ.

Human umbilical vein endothelial cells (HUVECs), from Lonza (#C2519A), were grown in culture using Endothelial Cell Growth Medium MV2 supplemented with a mix of additives (#C-22022, PromoCell) and 1% Penicillin/Streptomycin solution (#P4333, Sigma-Aldrich). These cells were cultured in an incubator set at 37 °C, with a 5% CO2 atmosphere and 100% humidity. Deletion of PDGFB was carried out by transfecting 25 pmol of PDGFB siRNA (ON-TARGETplus Human PDGFB siRNA Smart Pool, #L-011749-00-0005) using Lipofectamine RNAiMax (Invitrogen) in OPTI-MEM. The experiments were conducted within the window of 48 to 72 h post-transfection, and the results were compared to HUVECs transfected with siRNA CTRL (ON-TARGETplus Non-Targeting Pool D-001810-10-05).

siRNA tansfected HUVECs were placed onto a µ-Slide VI^0.4 (Ibidi, #80601) and exposed to laminar fluid shear stress levels of 1 and 12 DYNES/cm² for 24 h using the Ibidi pump system (Ibidi, #10902).

PC and αSMA coverage were assessed by quantifying the area of NG2-positive or αSMA positive area normalised to the area of IB4-positive vasculature. The vascular area was quantified by determining the threshold value of EC area relative to the total field area. The radial length was determined by measuring the distance from the optic nerve to the outer edge of the vascular front for each leaflet. The vessel diameter was calculated by averaging of six-eight measurements per retina. The number of side branches (intersections in major vessels) was calculated in 3–4 major vessels per retina. The number of tip cells in sprouting vascular fronts was measured in four pictures per retina.

All data are presented as mean ± standard error of the mean (SEM). Samples with equal variances were tested using Mann–Whitney U test or two-tailed Student’s t test between groups using GraphPad Prism (GraphPad Software). P value < 0.05 was considered to be statistically significant. Statistical analyses were performed for all quantitative data using Prism 9.0 (Graph Pad).