Targeted nanopore sequencing for the identification of ABCB1 promoter translocations in cancer

THP-1 cells were from DSMZ (Braunschweig, Germany) and cultured in RPMI 1640 medium (Sigma Aldrich) supplemented with 2 mM L-Glutamine (Life Technologies, Carlsbad, CA) and 10% fetal bovine serum (Sigma Aldrich). Whilst under drug selection cells were counted and replated every third day. Cell lines were confirmed mycoplasma-free and authenticated by short tandem repeat DNA profiling.

Daunorubicin and verapamil were from Sigma Aldrich (St. Louis, MO); tariquidar was from Generon (Slough, UK). Compounds were resuspended in DMSO (tariquidar) or ddH20 (verapamil and daunorubicin), aliquoted and stored at − 20 °C. Final DMSO concentration was < 0.5% in all experiments.

Primary human AML and HGSC samples were from the Manchester Cancer Research Centre Tissue Biobank (approved by the South Manchester Research Ethics Committee). Their use was authorized by the Tissue Biobank’s scientific sub-committee, with the informed consent of donors. For relapsed AML, the Biobank archive was searched for all samples. Where there were too few cryopreserved cells available for potential downstream analyses, or where the percentage of blasts in the cryopreserved sample was less than 80%, cases were excluded. This left 21 separate samples for analysis (Table S1). Three presentation cases, selected at random, were also included for comparison. For ChIP sequencing, selected samples were thawed and immediately crosslinked.

Samples for ABCB1 quantitative PCR and nanopore sequencing were taken from ex vivo models established using primary ascitic fluid samples, as previously described [5]. Briefly, ascites was centrifuged (500×g for 10 min at 4 °C) and cell pellets pooled in HBSS (Life Technologies). Red blood cells were removed using a red blood cell lysis buffer (Miltenyi Biotec) as per the manufacturer’s instructions. Tumour cells were plated into Primaria flasks containing OCMI. All cultures were incubated for 2–4 days at 37 °C in a humidified 5% CO₂ and 5% O₂ atmosphere. Media was replaced every 3–4 days. Upon cell attachment, stromal cells were separated from the mixed sample using 0.05% trypsin-EDTA. Once tumour cells reached 95% confluency, cells were passaged using 0.25% Trypsin-EDTA, centrifuged in DMEM containing 20% FBS and re-plated at a 1:2 ratio. For long-term storage, cells were frozen in Bambanker (Wako pure chemical).

5 × 10³ cells were plated in each well of a 96-well plate with media containing a serial dilution of daunorubicin. Plates were incubated for 72 h at 37 °C. 20 μl of 140 μg/mL resazurin (Sigma Aldrich) was added to each well. Plates were then incubated for a further 4 h and read using a POLARstar Omega plate reader (BMG Labtech, Aylesbury, UK).

Total RNA was extracted from 5 × 10⁵ cells using QIAshredder spin columns and an RNeasy® Plus Micro kit (Qiagen, Manchester, UK). Prior to sequencing RNA integrity was checked using a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA). PolyA libraries were prepared using a SureSelect Strand Specific RNA Library Prep kit (Agilent Technologies) and samples were then barcoded and pooled. Sequencing was performed using a NextSeq system (Illumina, San Diego, CA). Two replicates were sequenced for each cell line (THP-1_S and THP-1_R). A single run of 150 bp paired-end sequencing produced a mean of 55.1 M reads per sample. Reads were aligned to the human genome (hg38) using STAR v2.4.2a [6]. DEseq2 was used to calculate FPKM (fragments per kilobase of transcript per million mapped reads) values for each transcript [7].

cDNA was generated using a High Capacity Reverse Transcription kit (Applied Biosystems, Foster City, CA). qPCR reactions were performed in MicroAmp® optical 384-well reaction plates and analysed using a QuantStudio® 5 PCR system (Applied Biosystems). Reactions were performed in quadruplicate and included primers for β-Actin (ACTB) as a housekeeping gene. Primers were designed using the Universal Probe Library (UPL) Assay Design Center (Roche, Basel, Switzerland) and purchased from Integrated DNA Technologies (Coralville, IA). Raw fluorescence data was converted to CT values using the Thermo Fisher Cloud facility (Waltham, MA) and normalised to ACTB. Primers were (i) ACTB (F) ATTGGCAATGAGCGGTTC, (R) GGATGCCACAGGACTCCAT, UPL probe #11 and (ii) ABCB1 (F) GGAAATTTAGAAGATCTGATGTCAAAC, (R) ACTGTAATAATAGGCATACCTGGTCA, UPL probe #65.

ChIP was performed using anti-H3K27Ac (ab4729, Abcam, Cambridge, UK). 10⁸ cells (THP-1) or 10⁷ cells (primary AML samples) were used for each precipitation using the method described by Lee et al. [8]. Briefly, cells were cross-linked with 1% formaldehyde for 10 min at room temperature before the reaction was quenched with 0.125 M glycine. Cell pellets were washed twice with PBS and nuclear lysates sonicated for 6 cycles using a Bioruptor® Pico (Diagenode, Liege, Belgium). 10 μg of antibody bound to 100 μl of magnetic beads (Dynabeads Protein G, Invitrogen, Carlsbad, CA) was added to each sample and immunoprecipitation performed overnight on a rotator at 4 °C and 20 rpm. After five washes with RIPA buffer (50 mM HEPES pH 7.6, 1 mM EDTA, 0.7% Na deoxycholate, 1% NP-40, 0.5 M LiCl), chromatin IP-bound fractions were extracted by incubating for 15 min at 65 °C with elution buffer (50 mM TrisHCl pH 8, 10 mM EDTA, 1% SDS). Crosslinking was then reversed by incubation at 65 °C for 6 h. RNaseA (1 mg/ml) and proteinase K (20 mg/ml) were added to eliminate RNA and protein from the samples. DNA was extracted using phenol:chloroform:isoamyl alcohol and precipitated by adding 2 volumes of ice-cold 100% ethanol, glycogen (20 μg/μl), 200 mM NaCl and freezing at − 80 °C for at least 1 h. Pellets were washed with 70% ethanol and eluted in 50 μl 10 mM TrisHCl pH 8.0.

Libraries were prepared for sequencing using a Microplex Library Preparation Kit (Diagenode). 200-800 bp fragments were selected using AMPure XP beads (Beckman Coulter, Brea, CA). Sequencing was performed using a NextSeq desktop sequencing system (Illumina) with 75 bp, paired-end high output generating 65-80 M (THP-1_S and THP-1_R) and 34-45 M reads per sample (primary AML samples). Reads were aligned to the human genome (hg38) using BWA-MEM v0.7.15 [9]. Read duplicates were removed using Picard v2.1.0. Reads were further filtered using Bedtools v2.25.0 to keep only paired reads that mapped to standard chromosomes and to remove reads with a mapping quality of less than 10. Reads mapped to blacklisted regions defined by ENCODE were then removed using Bedtools (http://​mitra.​stanford.​edu/​kundaje).

4C primer sequences and enzyme combinations were selected using the University of Chicago online tool (http://​mnlab.​uchicago.​edu/​4Cpd) with co-ordinates from the ABCB1 promoter active in THP-1_R cells (hg38, chr7:87,598,302-87,601,399). 4C sequencing was performed according to the protocol developed by Splinter et al. [10]. Briefly, 10⁷ cells were cross-linked with 2% formaldehyde for 10 min at room temperature before the reaction was quenched with 0.125 M glycine. Cells were lysed with buffer containing 50 mM Tris–HCl pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.5% NP-40, 1% TX-100 and 1x complete protease inhibitors (Roche, #11245200). The cross-linked nuclear preparation was then incubated with DpnII. Digestion was confirmed by reversing crosslinking for an aliquot and running on a 0.6% agarose gel. Samples were then ligated overnight at 16 °C using T4 DNA ligase (Roche, #799009). Ligation efficiency was again confirmed with 0.6% agarose gel. Crosslinking was reversed and DNA extracted using phenol-chloroform. Samples were then subjected to a second digestion using Csp6I. Ligation was again performed overnight at 16 °C using T4 DNA ligase. DNA was then extracted using phenol-chloroform and purified with a QIAquick PCR purification kit (Qiagen, #28104). PCR primers were designed to incorporate 4C primers with a barcode and Illumina adapter sequences thus:

Reading primer: 5′ P5-Barcode-Primer 3′.

Non-reading primer: 5′ P7-Primer 3′.

Reading: GAGATACCAGGTCTGATC.

Non-reading: AGGGTAGGTATTCCACTTTT.

Illumina adapter sequences:

P5: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGA TCT.

P7: CAAGCAGAAGACGGCATACGAGAT.

Non-reading primer: CAAGCAGAAGACGGCATACGAGATAGGGTAGGTATTCCACTTTT.

Reading primer THP-1_S: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTA CACGACGCTCTTCCGATCTGCCAATGAGATACCAGGTCTGATC (barcode GCCAAT).

Reading primer THP-1_R: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCT.

ACACGACGCTCTTCCGATCTCTTGTAGAGATACCAGGTCTGATC (barcode CTTGTA).

PCR was performed with Expand Long Template Polymerase (Roche, #11759060001) using 3.2 μg of 4C template product and then purified using a High Pure PCR Product Purification Kit (Roche. #11732676001). Library quality was assessed using a 2100 Bioanalyzer (Agilent Technologies). Samples were sequenced with 10% phiX using a MiSeq desktop sequencing system (Illumina) with 75 bp single-end settings generating a mean of 1.4 M reads per sample. Sequencing data was deconvoluted using cutadapt v1.18. Reads were mapped and analysis performed using 4Cseqpipe [11].

Genomic DNA was extracted from 5 × 10⁶ cells using a QIAamp DNA mini kit (Qiagen, Manchester, UK). 1 μg of genomic DNA was sheared with a g-TUBE™ (Covaris, Inc., Woburn, MA) using 50 μl sample volume and a 30s spin at 11,000 rpm followed by inversion and a further 30s at 11,000 rpm. Barcoded libraries were prepared from 45 μl of fragmented DNA using a Ligation Sequencing Kit SQK-LSK108 / SQK-LSK109 (Oxford Nanopore Technologies, Oxford, UK) according to the 1D Sequence Capture protocol with the following modifications: the pre hybridisation PCR was replaced by a custom PCR with 6 cycles using Herculase II fusion DNA polymerase (Agilent Technologies). The subsequent AMPure XP purification was performed using a 0.6x bead to sample volume ratio. All purified product was used for the hybridization using an oligonucleotide designed using the online Agilent SureDesign service (https://​earray.​chem.​agilent.​com/​suredesign/​home.​htm). The library targeted a 500 kb region that included ABCB1 and upstream neighbouring genes (RUNDC3B, SLC25A40, DBF4 and ADAM22; chr7:87,132,949-87,632,948 hg19). Following pull-down, the post-capture amplification was replaced by a custom PCR with 14 cycles as described above. Amplified libraries were quantified by Qubit (Invitrogen) and TapeStation 2200 (Agilent Technologies). An additional amplification was performed using 10 cycles of PCR and the product was quantified. Amplified libraries were again quantified by Qubit and 1 μg of each library used for the End-prep. AMPure XP purification was performed using a 0.47x bead to sample ratio. Four end-prepped libraries were pooled into one adapter ligation reaction using 125 ng of each, as measured by Tapestation. A 0.47x bead to sample ratio was used for the AMPure XP bead binding. Sequencing was performed on the MinION using the R9.4 / 9.4.1 Flow Cell FLO-MIN106 / FLO-MIN106D (Oxford Nanopore Technologies) according to the manufacturer’s instructions. Target enriched DNA from THP-1_R was also subjected to conventional sequencing using a MiSeq desktop sequencing system (Illumina) with 1% phiX and 251 bp, paired-end settings generating 1.92 M reads. Nanopore sequencing of THP-1_R generated 0.92 M reads with a mean read length of 1901 bp and a maximum read length of 224.8 kb. The coverage of the targeted region was 58.1x. Nanopore sequencing of AML/HGSC generated an average of 1.6 million reads per sample (range 0.8–3.0 million) with a mean read length of 1581 bp. FASTQ files were aligned against the GRCh38/hg38 reference human genome using LAST after training the aligner with a subsample of 10,000 reads [12]. Structural variant calling was performed using NanoSV [13]. Structural variants were confirmed through manual inspection and identification of chimeric reads using IGV (https://​software.​broadinstitute.​org/​software/​igv/​).

Flow cytometry was performed using an LSR II flow cytometer (BD Biosciences, Franklin Lakes, NJ). FlowJo v10.1 (BD Biosciences) was used to analyze data. To assess daunorubicin retention 5 × 10⁵ cells were resuspended in PBS containing 1 μM daunorubicin with 40 μM verapamil or 5 nM tariquidar or vehicle. Samples were incubated for 2 h at 37 °C then placed on ice to prevent further efflux. Daunorubicin accumulation was assessed by flow cytometry.