Background
β1 adrenoceptor (β1AR) plays an important role in adrenergic regulation of myocardial contractility, which induces positive chronotropic, inotropic, and dromotropic action on myocardial through stimulatory Gs protein [
1]. However, from the past two decades, researchers found that the β1-adrenoceptor antibodies (β1AA) participate in the dilated cardiomyopathy (DCM). Peripartum cardiomyopathy (PPCM) is one kind of DCM. The pregnant women who are in good health seem to have cardiac failure for unknown reasons [
2]. Although patients with PPCM have no prior history of heart disease and there are no other known possible causes of heart failure, our previous study found that there was a high correlation between β1AA and the development of PPCM [
3]. However, the mechanisms involved in β1AA inducing PPCM are not fully understood.
PPCM, defined as idiopathic cardiomyopathy, represents heart failure secondary to left ventricular systolic dysfunction towards the end of pregnancy or in the months following delivery [
4]. It was found that inappropriate signaling and metabolic derangement at the level of the mitochondrion might be one of the key reason leading to myocardial hypertrophy [
5,
6]. In addition, mitochondria play a major role in apoptosis, which is greatly associated with heart failure [
7]. Reports state that β1AA induce apoptosis in cardio myocytes isolated from normal rats [
8], suggesting the mechanism of PPCM induced by β1AA may relate to mitochondrial dysfunction.
Peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α) is a key integrator of transcriptional circuits regulating mitochondrial biogenesis and function [
9]. Activation of the PGC-1α regulatory cascade increases cardiac mitochondrial oxidative capacity in the heart [
9] and protects the cells from apoptosis [
10]. To test the hypothesis that β1AA inducing PPCM relates to mitochondrial dysfunction, initially, we developed immune PPCM models by injecting the antigenic peptide segment of β1AR into postpartum Wistar rats and extracted the autoimmune β1AA from these animals. Later, we examined the effects of extractive β1AA on survival and apoptosis in myocardial H9C2 cells and the expression of β1AR, caspase3, PGC-1α, and vascular endothelial growth factor (VEGF), which is the downstream transcript of PGC-1α. Finally, we overexpressed the PGC-1α in H9C2 cells to observe whether it can rescue the cell’s apoptosis after β1AA treatment.
Methods
Study design
Previous study found that there was a high correlation between β1AA and development of PPCM [
3], indicating a possible involvement of β1AA in the development of PPCM. In the present study, β1AA were extracted from the postpartum Wistar rats, which were injected the antigen peptide segment of the β1 adrenoceptor to produce autoimmunity and the effects of extracted β1AA on the H9C2 cells were examined.
Animals and active immunity
Ten postpartum Wistar rats were obtained from Model Animal Research Center of Nanjing University, maintained in specific pathogen-free (SPF) conditions under a 12 h-light-12 h-dark cycle. All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of Nanjing University, Nanjing, China, and was conducted in accordance with the Guide for the Care and Use of Laboratory Animals from the National Institutes of Health (Bethesda, MD, USA). Animals were randomly divided into two groups, and five in each group. The antigenic peptide segment of β1 adrenoceptor was purchased from GL Biochem company (Shanghai, China). For first immunization, the antigenic peptide segment was dissolved into the Na2CO3 solution, and mixed the solution with freund’s incomplete adjuvant 1: 1. The final concentration of antigenic peptide segment in the mixture was 1 mg/ml. Then the mixture was injected subcutaneously in back of each animal with antigenic peptide segment 0.4 μg/g. For the negative control, Na2CO3 solution was injected with the same protocol. Two weeks after the first immunization, immune process was repeated again. Intravenous blood samples were performed on each groups in the third week. After animal experiments, the animals were euthanized with intraperitoneal injection of excessive pentobarbital (100-150 mg/kg).
Autoimmune β1AA procedure extraction
The affinity chromatography method was employed to extract proteins from serum. Four grams of the Sepharose4B (Sigma, Aldrich, USA) were immobilised onto 30 ml Sepharose column according to the manufacturer’s instructions (Amersham, Uppsala, Sweden). Three millilitres of conditioned or control serum were 1:8 diluted in PBS respectively, and applied onto the coupled-column at room temperature. After extensive washing with PBS until the value of OD280 < 0.05, the bound proteins were eluted with 3 M MgCl2. The eluted proteins were collected for each IgG according to the value of OD280 and dialyzed against PBS. The eluted proteins were analyzed by 12% SDS/PAGE under reducing conditions. In addition, quantification of the eluted proteins was determined by BCA (bicinchonininc acid) assay.
Cells culture and transfection experiments
H9C2 cells were purchased from cell bank of the Chinese Academy of Sciences (Shanghai, China, Cat#: CNR 5) and cultured in F12-DMEM medium with 10% fetal bovine serum. All these cells were incubated at 37 °C, 5% CO2. The medium was changed for 2 days and the cells were subcultured. One day before experiments, the cultured cells were digested with 0.25% trypsin + 0.02% EDTA. After digestion, cells were triturated to free collected by centrifugation (1500 rpm, 5 min). Then, cells were seeded in a 96-well plate at a density of 1 × 104 cells per well and incubated at 37 °C, 5% CO2 over night. After these treatments, 1 μM β1AA, 1 μM nonspecific IgG, 1 μM isoprenaline or mixture of 1 μM β1AA and 1 μM atenolol were added into the cell-culture medium with processing 12 h. Then, subsequent experiments were carried out. For overexpression of PGC-1α, the expression plasmid pcDNA3-PGC-1α encoding PGC-1α was constructed by our laboratory and plasmid expressing shRNA for PGC-1α and its control shRNA was purchased from Thermo Scientific. Cells were transiently transfected with plasmid for 24 h before the experiments, using Lipofectamine® 2000 Transfection Reagent (Invitrogen, Carlsbad, American, Cat#: 11668–019) according to the manufacturer’s recommendations.
CCK-8 assay
Cytotoxicity of β1AA was evaluated by CCK-8 assay in H9C2 cells. The CCK-8 detection kit was purchased from 7sea Biotech company (Shanghai, China, Cat#: 20140419). Briefly, after treatments, a 10-ul of CCK-8 or F12-DMEM medium were added to each well and the cells were further incubated for 1 h and the absorbance of each well was measured using a Microplate Reader (Model 680, BIO-RAD, USA) at the wavelength of 450 nm.
LDH assay
Measurements of LDH release were performed following the manufacturer’s instructions. The LDH detection kit was purchased from Promega company (Madison, American, Cat#: G7891) After cells were exposed to β1AA or nonspecific IgG suspensions, the exposure medium was collected and centrifuged at 1500 rpm for 10 min. The supernatant was mixed with the LDH assay mixture at a ratio of 1:1 and incubated at room temperature in the dark for 30 min. The reaction was stopped by the addition of 1 N HCl (1/10 of mixture volume), and the absorbance at 590 nm. Viability in relation to the control (the unexposed group) is calculated from equation:
Viability(%Control) = (LDHlysed − LDHExposed) / (LDHlysed − LDHcontrol)(100%).
where LDHlysed is the LDH released from wells treated with the LDH lysing solution (total cellular LDH content), LDHexposed is the LDH released from wells exposed to β1AA or nonspecific IgG suspensions, and LDH control is the LDH released from cells in the control group.
Terminal deoxynucleotidyltransferase-mediated dUTP nick-end labeling (TUNEL) of myocardial cells
A fluorometric TUNEL detection kit (Genecopoeia, Rockerville, USA, Cat#: A050) was used to detect apoptotic DNA strand breaks. The H9C2 cells were fixed with 4% neutral buffered formaldehyde in PBS (pH 7.4) at 25 °C for 30 min, permeated with 50 μg/ml proteinase K at 25 °C for 15 min, and incubated with the labeling reaction mixture in a humidified chamber at 37 °C for 1 h. The cells were then processed with a standard immunocytochemical staining procedure to incubate with antibody against DAPI (a cell nucleus marker; Invitrogen, Carlsbad, CA). Finally, a leica fluorescence microscope (DM6000B, Leica, Germany) was used to capture the images, and the ratio of TUNEL positive nuclei in total (DAPI positive nuclei) was computed to express the cells apoptosis.
Sa-ELISA
To test the concentration of VEGF, SA- ELISA was performed. Precisely, the medium of cell cultures was added into a 96-well plate 100 μl per well. The wells were then incubated for 1 h at 37 °C with antibody labeled with biotin anti-rat monoclonal IgG (1:1000, 50 μL/well) (BOSTER, Cat#: BA1005). Next, streptomycin with horseradish peroxidase (1:500, 50 μL/well) (Bioss, Cat#: bs-0437P-HRP) was added into the wells and incubated for 1 h at 37 °C. Finally, chromogenic tetramethylbenzidine (TMB) solution (50 μL/well) was added into each well and incubated for 10-30 min at 37 °C. Optical density (OD) was measured at 450 nm on a micro plate reader (Erba Lisa Scan II, Germany). The OD value was compared with the standard and the final concentration was obtained.
Quantitative real time-PCR (qRT-PCR)
Total RNA of H9C2 cells was isolated using Ultrapure RNA Kit (Cat#: CW0581S, CWBio). 400 ng of RNA was subjected to reverse transcription-PCR with SuperRT cDNA Synthesis Kit (Cat#: CW0741S, CWBio) according to the instruction. Quantitative RT-PCR was performed with PCR primers listed in Table
1. UltraSYBR Mixture Kit (Cat#: CW2602M, CWBio) was employed to detect mRNA levels of these genes. All reactions were repeated 3 times and GAPDH was used to normalize target.
Table 1List of utilized primers for qRT-PCR
β1AR | CGACTGCTGGTGCTCGCGTCG | AGCGAAAGGGCAGCGTGATGGC |
PGC-1α | CGCACAACTCAGCAAGTCCTC | CCTTGCTGGCCTCCAAAGTCTC |
PGC-1β | CAAGAAGCGGCGGGAAA | GCTCATGTCACCGGAGAGATTT |
VEGF | GCAGCGACAAGGCAGACTATT | ACCGTTGGCACGATTTAAGAG |
NRF1 | CCACGTTGGATGAGTACACG | CTGAGCCTGGGTCATTTTGT |
ERRα | AAGCCCTGATGGACACCTC | GAAGCCTGGGATGCTCTTG |
GAPDH | TGGAGTCTACTGGCGTCTT | TGTCATATTTCTCGTGGTTCA |
Western blot analysis
The H9C2 cells were lysed in RIPA buffer (P0013C, Beyondtime) containing 1 mM PMSF (ST505, Beyondtime). Total protein of 30 μg was subjected to electrophorese on 12–6% SDS-Page gels and transferred to PVDF membranes. Antibodies against β1AR (1:1000; cat. bs-0498R, Bioss), VEGF (1:800; cat. AF5131, Affinity), PGC-1α (1:1000, cat. bs-1832R, Bioss), and caspase3 (1:1000; cat. bs-0081R, Bioss) were used as primary antibodies. Rabbit IgG antibodies coupled to horseradish peroxidase (HRP) were used as secondary antibodies. GAPDH (1:1000; cat. BA2913, Boster) was used as loading control. An enhanced chemiluminescence (ECL) system was used for detection of protein bands.
Statistical analysis
All data were presented as mean ± SEM. One-way ANOVA was conducted to evaluate the one-way layout data. If a significant difference was observed, Bonferroni’s post-hoc test was conducted to identify groups with significant differences. The relative mRNA levels were calculated using the 2-ΔΔCt method. All analyses were performed using SPSS 19.0. Differences were considered significant with p < 0.05.
Discussion
The Heart Failure Association of the European Society of Cardiology Working Group defined PPCM as idiopathic cardiomyopathy presenting with heart failure secondary to left ventricular systolic dysfunction towards the end of pregnancy or in the months following delivery, where no other cause of heart failure is found [
4]. PPCM occurs in 1/1000–1/4000 pregnancies, more commonly in women of African ancestry [
13]. Perhaps it is found up to 1% of all pregnancies in countries like Haiti and Nigeria [
14,
15]. Only 25% of PPCM patients in developing countries survive up to 5 years, with associated infant mortality of 50–75% [
16]. Our results showed that β1AA, which were extracted from postpartum Wistar rats that were injected by the antigen peptide segment of the β1 adrenoceptor, could induce apoptosis of cardiac myocytes of H9C2 cell line and the effect of β1AA on H9C2 cells might be caused by inhibition of PGC-1α related pathway.
Although the pathophysiological mechanism is not known, abnormal autoimmunity response to pregnancy and β1AA are associated with high risk for the progression and prevalence of PPCM. Because the serum level of β1AA in patients with DCM is higher than in normal people [
17,
18] and later the immunization of animals with a synthetic peptide corresponding to the second extracellular loop of β1AR leads to the production of IgG autoantibodies against this domain [
19]. After several months of immunization, the animals showed left ventricular hypertrophy and contractile dysfunction [
20]. β-blockers have been used successfully for decades to treat several pathologies, including hypertension, congestive heart failure, and post-MI dysfunction [
21]. Moreover, chronic β-blocker treatment could alter baseline leukocyte characteristics that decrease their responsiveness to acute injury, and it means prior β-blockade may act to reduce the severity of innate immune responses [
22]. Since β1AA is a weak agonist of β1AR, its accumulation might lead to the opposite effect of the blockers. Finally, as an adrenoceptor ligand, the sirloin protein fully involves in cardiac inflammatory, oxidative, and apoptotic processes [
23,
24]. Although in diabetic patients, the protective anti-apoptotic and anti-remodeling effect played by drugs on the cardiovascular system not implies in the regulation of sympathetic tone and β-adrenoreceptors [
25,
26], our previous study found that there was a high correlation between β1AA and development of PPCM [
3]. This difference may be due to the effects of different diseases on cardiomyocytes. Most recently, experimental progress has strongly suggested a causal role for hormonal insults in PPCM [
2]. However, there is no direct evidence for β1AA induced PPCM. Here, we first proved that β1AA, which were extracted from the postpartum rats with autoimmunity, directly induce apoptosis in H9C2 cardiac myocytes through β1AR. It signifies that apoptosis plays a pathophysiological role in heart failure [
27]. Thus, these results suggest that β1AA may directly contribute to the pathogenesis of PPCM.
Our data show that β1AA inhibited the PGC-1α related factor expression and VEGF secretion. Moreover, PGC-1α overexpression rescued apoptosis of cardiac myocytes induced by β1AA and the inhibitory effect of β1AA on PGC-1α related factor expression and VEGF secretion. It suggests that the mechanism of β1AA induced apoptosis is through inhibiting the PGC-1α related pathway. PGC-1α plays a critical role in the augmentation of mitochondrial biogenesis, cellular respiration rates, and energy substrate uptake and utilization [
10]. Down regulation of the PGC-1α has been described both in patients with nonischemic cardiomyopathy and in animal models of pressure overload and heart failure [
28‐
30]. Furthermore, in the PGC-1α-KO models, PGC-1α deletion resulted in reduced palmitate oxidation and increased glucose oxidation. PGC-1α-KO hearts exhibited impaired inotropic and chronotropic response [
31‐
33]. In addition, in present study, β1AA showed specific down-regulation of genes associated with mitochondrial biogenesis (NRF1 and ERRα). Therefore, the inhibitory effect of β1AA on PGC-1α related factor expression might cause mitochondria dysfunction, later leading to heart failure. On the other hand, under the ischemia condition, PGC-1α expression can induce skeletal muscle cells leading to VEGF secretion to regenerate the blood vessels [
34]. Recently, heart failure remains associated with microvascular sparsity [
35]. Our data shows β1AA inhibition of VEGF secretion, leading to a decrease in microvascular density, suggesting another reason for β1AA induced PPCM. The diagnosis of PPCM is difficult to make, as it is a diagnosis of exclusion, with a considerable overlap with other conditions. Especially in women who present with acute heart failure at the end of pregnancy or directly postpartum, thorough investigations and intensive follow-up may often lead to alternative diagnoses [
4]. Our findings suggest the increase of β1AA together with the decrease of PGC-1α as a diagnostic tool for PPCM. However, more clinical studies are needed to prove this deduction.
β1AA are the weak agonist of β1AR. We also found atenolol, the antagonist of β1AR can inhibit the effect of β1AA, suggesting the function of β1AA, realized through β1AR. However, isoprenaline is the non-selective agonist of β adrenoceptor, it cloud active both β1AR and β2 adrenoceptors (β2AR) [
1]. The difference between effects of β1AA and isoprenaline on the expression of β1AR might be caused by mechanism of function, including receptor affinity and dynamic properties of the β-agonist. Activation of β2AR has been reported to promote VEGF secretion [
36] and restore mitochondrial function of kidney [
37] and podocyte [
38] through PGC-1α dependent mitochondrial biogenesis. It seems that the activation of β2AR would lead to increase of VEGF and PGC-1α expression. We thought the different effects of isoprenaline on PGC-1α and VEGF are the result of the integration of its activation of β1AR and β2AR at the same time. However, the effects of activations of different β adrenergic receptor on expression of β adrenergic receptor and PGC-1α related pathway should be further studied.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.