6-methylmercaptopurine riboside, a thiopurine nucleoside with antiviral activity against canine distemper virus in vitro

VerodogSLAM cells were grown in Dulbecco’s modified Eagle’s medium (DMEM High Glucose, D7777, Sigma-Aldrich, Saint Louis, USA) supplemented with 10% fetal bovine serum (FBS, Gibco), 1% penicillin/streptomycin and 1 mM L-glutamine (Gibco) at 37 °C in a humidified incubator with 5% CO₂. Zeocin (Invitrogen) was added at 1 mg/mL for stable maintenance of SLAM (signaling lymphocytic activation molecule) tag expression. A CDV field strain (CDV/LDM-BTU-2, GenBank accession number KX434626) isolated from canine clinical specimens was used in this study. The wild-type CDV was propagated on VerodogSLAM cells and virus stocks were prepared by collecting the infected cells plus supernatant (SUP) when the cytopathic effect (CPE) was ~80%; samples were stored in aliquots at −80 °C. Virus titers were determined by the TCID₅₀ (50% tissue culture infective dose) method of Reed and Muench [21] and expressed as log₁₀ TCID₅₀/mL.

6-methylmercaptopurine riboside (6MMPr) (Fig. 1) and 1-β-D-ribofuranosyl-1,2,4-triazole-3-carboxamide (ribavirin) were purchased from Sigma-Aldrich (Saint Louis, USA). Ribavirin (RIB) was used as the positive control. Stock solutions of the compounds were prepared in Milli-Q H₂O and sterilized by filtering through a Millipore 0.22 μM filter. All stock solutions were stored at −20 °C and the working solutions were prepared immediately before the start of each experiment.

The cell toxicity of 6MMPr and RIB was tested on growing cells via in situ mitochondrial reduction of a tetrazolium dye, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma, St. Louis, USA). Briefly, VerodogSLAM cells (1 × 10⁴ cells/well) were seeded on 96-well microplates for 24 h. The medium was replaced with 200 μL fresh DMEM containing different concentrations of the compounds. After 72 h of incubation at 37 °C, the culture medium was removed and replenished with 50 μL of MTT working solution (1 mg/mL) to each well and the microplate was incubated for 4 h. MTT formazan crystals were solubilized by adding DMSO (dimethyl sulfoxide) and the optical densities were determined spectrophotometrically with an absorbance microplate reader (BioTek, ELX800, Winooski, Vermont, USA) at 540 nm. Cell viability was calculated by subtracting the optical density fraction of treated cells from the untreated cells. The cytotoxic concentration for 50% of the cell culture (CC₅₀) was expressed as the compound concentration required to reduce the absorbance of treated cells by 50% in comparison to control cells. CC₂₀ was defined as the limit point for treatment with the antiviral molecules [22]. At least two independent experiments were performed with eight replicates for each concentration level.

VerodogSLAM cells were grown a day prior in 24-well tissue culture plates at a density of 10⁵ cells/well in DMEM supplemented with 10% FBS. Cells were first infected with CDV/LDM-BTU-2 at a multiplicity of infection (MOI) of 0.1 and incubated for 2 h (37 °C, 5% CO₂). After virus internalization, viral inoculum was removed, cells were washed twice with DMEM and replaced with fresh medium containing several two-fold dilutions of the compounds tested (338, 169, 84.5, 42 μM of 6MMPr and 81.5, 40.8, 20.4, 10.2 μM of RIB). Infected non-treated and mock infected controls were set up in parallel. At 72 h post-infection (PI), 24-well plates were freeze/thawed once, and cell lysates plus SUP were harvested and stored at −80 °C until use for virus titration and real-time quantitative RT-PCR analysis. Virus titers are expressed as log₁₀ TCID₅₀/mL according to the method of Reed and Muench [21]. All antiviral assays were carried out in triplicate, and the results are shown as the mean values ± standard errors obtained from at least two individual experiments.

Antiviral efficacy of 6MMPr was also evaluated by measuring the reduction in the number of CDV infectious plaques. Confluent monolayers of VerodogSLAM cells by 2 × 10⁵ cells/well were seeded in 24-well plates and incubated for 24 h. Cell lysate + SUP from the various antiviral drug treatments, including RIB, were added to cells and, after 2 h of incubation, the inocula were removed and the cells were overlaid with DMEM supplemented with 2.5% carboxymethyl cellulose (CMC) and 2% FBS. The plates were incubated for 72 h at 37 °C in a 5% CO₂ incubator. Monolayers were fixed using 10% formalin in phosphate-buffered saline and then stained with crystal violet solution; plaque numbers were then quantified. The percentage of plaque reduction (PR%) in comparison to untreated infected cells was calculated using the following formula: PR (%) = (C - T) × 100/C, where C is the mean number of plaques from triplicate untreated control wells and T is the mean number of plaques from triplicate treated wells. The 50% inhibitory concentration (EC₅₀) was defined as the compound concentration required to reduce the CDV plaque count by 50% of the virus control. The selectivity index (SI) was obtained by calculating the ratio of the CC₅₀ and the EC₅₀ values.

Confluent 24 h–plated VerodogSLAM cells seeded into 24-well tissue culture plates were infected with CDV/LDM-BTU-2 at an MOI of 0.1. After an incubation time of 2 h at 37 °C in a 5% CO₂ atmosphere, the viral inoculum was removed and replaced by fresh medium containing 338 μM of 6MMPr. At different time points PI (24, 48 and 72 h), cells plus SUP were collected for virus titer estimates from the TCID₅₀, and viral RNA was extracted and quantified by qRT-PCR.

VerodogSLAM cells were first infected with CDV/LDM-BTU-2 at an MOI of 0.1. After 2 h of incubation at 37 °C and 5% CO₂, the viral inoculum was removed and replaced with culture medium containing 2% FBS. At several time points PI (2, 12 and 24 h), 6MMPr 338 μM was added to the infected cells. At each time point, virus and cell controls were included in the assay. At 72 h post viral infection, 24-well plates were freeze/thawed once, and cell lysates plus SUP were harvested and stored at −80 °C until use for TCID₅₀ virus titration and qRT-PCR analysis.

Total RNA was extracted from cell lysate plus SUP (500 μL) using Trizol reagent (Invitrogen) according the manufacturer’s instructions. The concentration and quality of RNA was checked using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). For each real-time assay, 100 ng of RNA template was analyzed by qRT-PCR using GoTaq 1-Step RT-qPCR System kit (Promega). CDV-specific primers for nucleoprotein gene (N) CDV-F (AGTTAGTTTCATCTTAACTATCAAATT) and CDV-R (TTAACTCTCCAGAAAACTCATGC) had been previously designed [23]. Primer sets were synthesized by Integrated DNA Technologies (IDT). RNA measurement by SYBR green incorporation was carried out using an Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems) with the following thermal cycling profile: reverse transcription at 50 °C for 30 min, activation of Taq polymerase at 95 °C for 10 min and 40 cycles consisting of denaturation at 95 °C for 10 s, annealing at 60 °C for 30 s and polymerization at 72 °C for 30 s. At the end of amplification, a melt curve was performed from 70 °C to 95 °C and fluorescence data were collected every 0.3 °C during melting. Real-time RT-PCR data were analyzed with Applied Biosystems 7500 Software v2.0.6 (Applied Biosystems). CDV RNA levels in treated and control cells were determined by absolute quantification with the standard curve method. Briefly, a 287-bp fragment resulting from conventional PCR with primers P1 (ACAGGATTGCTGAGGACCTAT) and P2 (CAAGATAACCATGTACGGTGC) described by Frisk et al. [24] was cloned into the pGEM-T Easy vector (Promega). The pGEM-inserted fragment contained the amplicon sequence used for the real-time qRT-PCR assay. After confirming and linearizing the pGEM-T Easy construct with the Spel restriction enzyme (Promega), the linearized plasmid was used as a template for in vitro transcription with the MEGAshortscript T7 Transcription Kit (Ambion), according to the manufacturer’s instructions. Turbo DNase-treated transcripts were ethanol-precipitated and resuspended in RNAse-free water. Synthetic RNAs were quantified using a Qubit 2.0 Fluorometer (Thermo Fischer Scientific) and the copy number was determined using the following formula: (X g/μL DNA/[transcript length in base pairs × 340]) × 6.022 × 10²³ = Y ssRNA molecules/μL. Standard curves were constructed with five points in triplicate from serial 10-fold dilutions of transcripts. RNA samples were tested in duplicate and the inhibition of CDV replication was expressed as RNA copy number.

Statistical analysis was performed to assess the differences in viral yield of infected cells in contact with 6MMPr for different doses and time intervals. Data were submitted to two-way ANOVA (analysis of variance) using GraphPad Prism Software version 5.01 for Windows (GraphPad Software, La Jolla, California, USA). The Tukey test was carried out to perform pairwise comparisons among means. Values of CC₅₀ and EC₅₀ were calculated from a linear regression equation. All the graphs show the mean ± standard error from three independent experiments. A p-value <0.05 was considered statistically significant.

Cytotoxicity data were analyzed to determine the non-toxic concentrations of 6MMPr and RIB to VerodogSLAM cells. 6MMPr was 3.3 times less toxic in comparison to RIB. The average CC₅₀ values of 6MMPr and RIB were 1409 μM and 424 μM, respectively (Table 1). The maximum non-toxic concentrations (MNTC) employed in the antiviral assays, previously defined as CC₂₀, were 338 μM for 6MMPr and 81.5 μM for RIB, and none of them induced any visible cell morphological changes.

Analysis of the antiviral activity assays demonstrated a 6MMPr dose-dependent inhibition of CDV replication (Fig. 2). We observed a clear reduction in CPE levels in the infected cells treated with 6MMPr. At the highest concentrations (169 and 338 μM), 6MMPr reduced CDV RNA copy number by 94%, and there were no virus particles detected by TCID₅₀ assay. RIB showed lower antiviral effects with significant inhibition of the virus transcript level by 60% and a virus titer reduction of 77%, which was displayed only at the highest concentration (81.5 μM). While RIB activity decreased approximately 0.5 log₁₀ of viral growth and RNA synthesis, 6MMPr reduced up to 1.3 log₁₀ of virus RNA and over 2.2 log₁₀ of infectious titers (Table 1).

The plaque-reduction assay (PRA) was used to confirm compound activity and to determine the 50% inhibitory concentration (EC₅₀). PRA analysis showed strong agreement with antiviral activity assays. 6MMPr and RIB exhibited EC₅₀ values of 28.7 and 52 μM, respectively. As shown in Table 1, the SI value of 6MMPr was 49.1, which is approximately six times higher than the SI value of 8.2 for RIB. 6MMPr displayed the greatest effects regarding inhibition of CDV-induced plaques, with a maximum reduction of 99%. Indeed, it caused a clear decrease in plaque number and size (Fig. 3).

We evaluated the reduction of CDV RNA levels and virus infectious titers in the presence of 6MMPr 338 μM at different times PI (Fig. 4a, b). TCID₅₀ virus titration and absolute quantitative real-time RT-PCR methods were used to measure the virus yield from cells plus SUP collected at the 24, 48 and 72 h time points. We observed that 6MMPr was able to reduce RNA synthesis at all time points. Virus titration showed that 6MMPr could completely inhibit viral growth at all measured time points.

To investigate the 6MMPr antiviral activity at different time points post-infection, a time-based approach was carried out by adding 6MMPr 338 μM at 2, 12 and 24 h after virus infection. The CDV RNA level measured at 2 and 12 h showed no difference for 6MMPr activity. The observed viral RNA reduction at 2 and 12 h ranged from 90.5 to 94.3%, and was greater than that at 24 h (76.5%). As shown in Fig. 4c and d, although the CDV RNA level varied between time points, 6MMPr completely inhibited viral infectivity at each time point.