A heterozygous duplication variant of the HOXD13 gene caused synpolydactyly type 1 with variable expressivity in a Chinese family

In this study, a five-generation pedigree of family with 33 individuals from northern China was studied (Fig. 1). There were nine affected members in the family. We comprehensively examined seven affected members (II-3, III-1, III-3, III-7, IV-2, IV-11, V-1) of the family with limb deformities. The clinical details and blood samples of the two affected persons IV-7 and IV-8 were not available for study. Photographs and radiographs were obtained after detailed clinical examination. Clinical information and peripheral blood were obtained from 12 persons of the family: V-1 (proband), V-2, IV-2, IV-3, IV-11, III-1, III-3, III-5, III-7, II-3, II-4, and II-5. The peripheral blood was collected into a qualified negative pressure vacuum EDTA anticoagulant tube. The study protocol (HMUIRB20180016) was approved by Institutional Research Board of Harbin Medical University and all participants provided signed informed consent.

There are many genes (SHH, GLI3, LMBR1/ZRS, GJA1, LRP4, BHLHA9, APC, etc.) which have important role in limb development. Genetic alteration in any of these genes could lead to limb deformities. To know about the specific gene mutation that caused SPD1 in the five generation Chinese family, WGS of the blood sample from the typical SPD1 patient IV-2 (affected with both hands and both feet) was performed by Novogene technology limited-liability Company (Beijing, China).

For library generation, 1 μg qualified genomic DNA per sample was needed, which was randomly fragmented to approximately 350-base pair by Covaris S220 sonicator. Then, DNA fragments were end-repaired and ligated to prepare DNA library. After determining the size distribution and concentration, the DNA library was sequenced on Illumina Hiseq X platform for paired-end 150-bp reads. The raw image files were processed by Base Calling analysis. The high-quality sequences are compared to the human reference genome (UCSC: GRCH37/hg19) by Burrows-Wheeler Aligner (BWA) software [14]. The variation information in the sample is detected, counted and annotated. Samtools mpileup and bcftools were used for variant calling to identify SNP, indels while Control-freec is utilized for CNV detection. The variant position, variant type, conservative prediction and other information are obtained at this step through a variety of databases, such as dbSNP, 1000 Genome, the Exome Aggregation Consortium (ExAC) and Human Gene Mutation Database (HGMD). Since we focused in exonic variants, gene transcript annotation databases, as Consensus CDS, RefSeq, Ensembl and UCSC were also applied for annotation to determine amino acid alternation. Using these annotation disease related harmful variations were screened. Finally, literature related to SPD1 was reviewed to identify the potential causative variant.

DNA extraction was performed using the DNeasy Blood & Tissue Kit (Qiagen, #69506, Dusseldorf, Germany) according to the manufacturer’s protocol. Set of primers were designed for exon 1 of HOXD13 (forward primer GGGAATGGGAGGTGGACCCT, and reverse primer CGTGCGGCGATGACTTGA) using the Primer Premier 5, Software and polymerase chain reaction (PCR) was performed. PCR was performed in a total volume of 20 μl (10 μl 2 × GC buffer, 2 μl 10 × dNTPs, 0.8 μl (10 pmol/μl) forward primer, 0.8 μl (10 pmol/μl) reverse primer, 0.2 μl taq DNA polymerase, 4 μl (5 mol/l) Betaine, 2 μl DNA and 0.2 μl water). The PCR reaction started with an initial 5 min denaturation step at 94 °C, followed by 30 cycles of 25 s denaturation (94 °C), 25 s annealing (60 °C), and 60 s extension (72 °C), ending with a final extension step of 5 min at 72 °C. The PCR was carried out on eppendorf Mastercycler nexus GSX1 PCR system. Amplified PCR products were sequenced by TsingKe Biological Technology (Beijing, China) using Sanger sequencing. Results of Sanger sequencing were analyzed using different softwares (Chromas, Megalign and Editseq).

Then the PCR products were purified using QIAquick Gel Extraction Kit following the manufacturer’s protocol. The purified PCR products were ligated to the T linear vector (pEasy-T1 Simple Cloning Kit, #CT111, Transgen, Beijing, China) according to the manufacturer’s protocol and sequenced by TsingKe Biological Technology using Sanger sequencing.

The frequency of variants were evaluated in the 1000 Genome Project (www.​1000genomes.​org) and ExAC (exac.​broadinstitute.​org). Suspected variants with frequency < 0.01 were considered for analysis.

The significance of variants were assessed to evaluate their impact on protein structure, protein function and evolutionary conservation using different mutation predictor softwares like Mutation Taster (www.​mutationtaster.​org), PROVEAN (provean.​jcvi.​org) and SIFT (sift.​bii.​a-star.​edu.​sg). Conservation of the mutation locus was patterned through Aminode (www.​aminode.​org). The effects of the mutation on protein structure were assessed using SWISS-MODEL (www.​swissmodel.​expasy.​org/​).

The standard, guidelines and recommendations for the classification of variants given by American College of Medical Genetics and Genomics (ACMG) were also analyzed for the candidate gene variant [15].

The proband (V-1) was a 12-year-old boy who has been diagnosed with SPD1. The family medical history was further investigated for the disease occurrence. The affected family includes 33 persons in five generations (Fig. 1). Generally, nine members of this family have been suffered from autosomal dominant SPD1. The seven affected members of the family from whom blood samples had been obtained were carefully examined for SPD1 (Table 1). Photographs and radiographs were obtained for affected family members of the family (Figs. 2 and 3). Clinical examination of other family members did not show any sign and symptoms of SPD1 or other limb abnormalities.

To identify the disease gene behind SPD1, we performed WGS of patient (IV-2) as she was the only patient with the typical symptoms of SPD1 in the family affected with both hands and both feet. Pathogenic analysis of WGS data revealed 16 pathogenic, 1 likely pathogenic, 2511 variants of uncertain significance (VUS) and 24,319 benign variants. Further analysis of WGS results revealed total of 10,883 missense mutations, 57 frameshift insertions, 183 non-frameshift insertions, and 194 non-frameshift deletions. We have checked all the rare variants falling in syndactyly/limb developmental genes which have been presented in Additional file 1: Table S1. We found their population frequencies were higher than 0.01. The literature related to SPD1 disease was reviewed, and we found that mutation in HOXD13 gene is the most widely reported for SPD1 disease. Comprehensive analysis of WGS results revealed the duplication of 24-base pair at chr2:176957801–176,957,823 (GRCH37/hg19), which caused a non-frameshift mutation in HOXD13. A heterozygous duplication variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in exon one of HOXD13 gene was identified in patient (IV-2) by WGS. This mutation is predicted to results in addition of eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The WGS data can be accessed at SRA accession: PRJNA504318 (www.​ncbi.​nlm.​nih.​gov/​ sra/PRJNA504318).

To determine whether the mutation in HOXD13 gene was co-segregated in other family members or not, targeted DNA fragments from the patient (IV-2) and other 11 individuals including six patients (II-3, III-1, III-3, III-7, IV-11, V-1) and five normal persons (II-4, II-5, III-5, IV-3, V-2) were first amplified by PCR and then sequenced by Sanger sequencing. The Sanger sequencing results showed that five normal persons did not carry the duplication variant (Fig. 4A. V-2) and all the affected persons carried the 24-base pair duplication variant (Fig. 4B. V-1 & 4C. IV-11).

Further investigation was performed into the two affected persons (V-1 and IV-2) sequence by ligating the purified PCR products with the T linear vector, then followed by subcloning and Sanger sequencing. The sequencing results showed that both patients (V-1 and IV-2) carried one normal sequence (Fig. 5A. V-1) and one mutated sequence (Fig. 5B. V-1) which indicated that mutation exists in heterozygous form. The normal sequence and the mutation sequence can be accessed at GenBank: MK290763 for normal one, and MK290762 for the HOXD13 c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC.

According to classification of ACMG for assessing the pathogenicity of different variants, the 24-base pair duplication variant of HOXD13 is “likely pathogenic” as it is in mutation hot spot (PM1), absent in population data bases (PM2), co-segregated in affected members of the family (PP1), computational evidence showed deleterious effect (PP3), and highly specific disease phenotype (SPD1) with single gene (HOXD13) (PP4). Thus, according to ACMG the 24-base pair duplication mutation of HOXD13 has two moderate (PM1, PM2) and more than two supportive (PP1, PP3, PP4) evidences of pathogenicity, fulfilled the criteria of ACMG for “likely pathogenic” variant.