Background
The urinary bladder undergoes slow mechanical stretch during the storage phase of the micturition cycle without significant changes in intravesical pressure [
5,
29]. Previous animal studies provided evidence that bladder stretch can activate mechanosensitive two-pore domain potassium (K
2P) channels [
29,
46,
49]. The family of mechano-gated K
2P channels is highly expressed in the smooth muscle of visceral hollow organs where they regulate smooth muscle excitability by controlling the resting membrane potential [
3,
4,
29,
52,
53]. Our previous studies confirmed that bladder capacity and detrusor relaxation in the human urinary bladder depends on the expression and function of TREK-1 channel, one of the members of the K
2P channel family [
34]. TREK-1 has also been detected in the human myometrium, where it participates in the maintenance of uterine relaxation during pregnancy [
3,
10,
55]. Further, expression of TREK-1 channels in vascular smooth muscle suggests a role in the regulation of the vascular tone and endothelial production of nitric oxide [
44,
45].
A decrease in functional expression of TREK-1 channel in the bladder smooth muscle was shown to be associated with detrusor overactivity (DO) in the animal model of partial bladder outlet obstruction [
4]. In humans, increased expression of TREK-1 was detected in pregnant women’s myometrium. Interestingly, TREK-1 expression levels declined by the time of labor [
3,
10,
55]. Experimental data obtained by our group in bladder specimens from patients with idiopathic DO confirmed a decreased expression of TREK-1 channels along with an altered response to pharmacological stimulation and diminished smooth muscle relaxation. Additionally, DO specimens had an increased basal tone and increased spontaneous contractile activity suggestive that TREK-1 channels affect bladder compliance during storage phase of the micturition cycle [
48].
Limitations of in vitro experiments on isolated human bladders included the inability to assess the full spectrum of TREK-1 related effects on voiding function as the channel is also expressed in the nervous system and therefore, may indirectly participate in micturition modulation via a neural pathway. Members of the mechanosensitive K
2P channel family are abundantly expressed in the brain and sensory neurons of the dorsal root ganglia in humans [
18,
20,
41]. However, the studies of functional changes in human neurons and nerve fibers have several ethical challenges making the use of animal models necessary for this type of investigations. Additionally, the absence of TREK-1 selective activators and inhibitors makes it difficult to isolate TREK-1 from other K
2P channels in primary cultured cells. Therefore, in the present study, we aimed to evaluate the effects of TREK-1 gene knockout on bladder contractile function and voiding patterns by comparing wild-type (WT) and TREK-1 KO mice. We comprehensively assessed bladder phenotype in vivo and in vitro
, measured detrusor basal tone, spontaneous activity, contractile function and relaxation in response to nerve and muscle-mediated stimulation of bladder smooth muscle (BSM), as well as determined bladder responses to different pharmacological stimuli.
Methods
Animals and experimental groups
Adult male and female C57BL/6 J wild-type (WT,
N = 32) and TREK-1 knockout (
Kcnk2−/−, TREK-1 KO,
N = 33) mice were used in this study. Wild type mice (10–12 weeks old) were obtained from Jackson Laboratories (Bar Harbor, ME, USA). TREK-1 KO mice, a generous gift from the laboratory of Dr. Min Zhou (Department of Neuroscience, The Ohio State University, Columbus, OH), were bred in the Breeding Core Barrier Facility at the University of Colorado Anschutz Medical Campus. Originally, the
Kcnk2 −/− mice were generated as described in [
45]. Briefly, the TREK-1 gene,
Kcnk2, spans approximately 136 kbp of the
M. musculus genome and includes eight exons. The knockout mice were generated by replacing 4 kbp of the
Kcnk2 gene including the second exon (excluding the first 23 bp), the second intron, the third exon and the first 23 bp of the third intron with a β-galactosidase/Neomycin selection cassette producing a truncated, nonfunctional protein.
All animals were housed in a regulated environment on a 12:12-h light/dark cycle with free access to food and water. There were no overt differences in feeding behavior, litter size, growth rate and body weight between the WT and TREK1 KO mice. All protocols were approved by the University of Colorado Institutional Animal Care and Use Committee.
RT-PCR for genotyping and PKC isoform expression
Genomic DNA was extracted using the REDExtract-N-Amp Tissue PCR Kit (Sigma-Aldrich, St Louis, MO. USA) from the urinary bladders of WT and TREK-1 KO mice. Genotyping was performed as previously described [
45]. Briefly, the WT
Kcnk2 allele was detected by using the following primer pairs: forward 5′-GCTGGGTGAAGTTCTTCAGC-3′, and reverse: 5′- CATTACCTGGATGAGTTCGTC-3′. The
Kcnk2 KO allele was detected using the primer pairs: forward 5′-GCAGCGCATCGCCTTCTATC-3′ and reverse 5′-AGGAGATGAAGACCTCTGCAAAGG-3′. End-point RT-PCR products from WT and TREK-1 KO specimens were subsequently run on 2% agarose gels. Gel images were taken and analyzed using the Doc-It LS Image Acquisition & Analysis System (UVP, LLC, Upland, CA, USA).
To compare the gene expression levels of several protein kinase C (PKC) isoforms expressed in the bladder, whole bladder tissues were removed from WT and TREK-1 KO mice, and snap-frozen in liquid nitrogen. Posteriorly, total RNA was extracted and purified using TRIzol® Plus RNA Purification Kit (Ambion, Thermo Fisher Sci. Waltham, MA, USA) according to the manufacturer’s instructions. RNA concentrations and purity were determined spectrophotometrically on a Nanodrop device (Thermo Fisher Sci. Waltham, MA, USA). RNA integrity was evaluated by formaldehyde agarose gel electrophoresis, stained with ethidium bromide, and visualized under UV light. Isolated RNAs were stored at − 80 °C until use. First-strand complementary DNA (cDNA) was synthesized using the Qiagen OneStep RT-PCR kit (Qiagen, Valentia, CA. USA) by the manufacturer’s guidelines. Products were stored at − 20 °C until the use. End-point PCR was performed using the Qiagen Multiplex PCR plus kit (Qiagen, Valentia, CA. USA) following the manufacturer’s instructions. The following PKC isoforms were selected for comparison due to their significant level of expression in the urinary bladder: PKC-α (alpha), PKC-β (beta), PKC-γ (gamma), PKC- δ (delta), PKC-ε (epsilon), PKC-μ (mu) and PKC-τ (tau). Primer sequences for each isoform, gene accession numbers and predicted RT-PCR product sizes are listed in Table
1. Non-template control reactions were included in each reaction to test for possible RT-PCR contamination and were run in parallel with the experimental samples. End-point PCR products were analyzed by electrophoresis in 1.5% agarose gel, stained with ethidium bromide, and visualized under UV light.
Table 1
Primers for PKC isoforms expressed in the urinary bladder
PKCα-F | AGGAGCCACAAGCAGTATTC | 93 | NM_011101.3 |
PKCα-R | CCAGCTTCAGATCCCTGTAAAT | | |
PKCβ-F | GCAGAGCAAGGGCATTATTTAC | 114 | NM_001316672.1 |
PKCβ-R | CCATCCCAGATGTTCTCCTTAC | | |
PKCγ-F | GCACCTGAGATCATTGCCTATC | 90 | NM_011102.4 |
PKCγ-R | CTGTCCTGCCAACATCTCATAC | | |
PKCδ-F | TAGTGAGGAGGAGGCAAAGT | 105 | NM_001310682.1 |
PKCδ-R | CCGAAGAAGGTGGCGATAAA | | |
PKCε-F | GCTCGGAAACACCCTTATCT | 100 | NM_001310682.1 |
PKCε-R | ACATGAGGTCTCCACCATTTAC | | |
PKCμ-F | GCAGTGGAGTTAGAAGGAGAAG | 123 | XM_006515590.3 |
PKCμ-R | GGCTCACAGGAGACAGTAAAG | | |
PKCτ-F | CAGGGACCTGAAGCTTGATAAT | 96 | NM_008859.2 |
PKCτ-R | GCATCTCCTAGCATGTTCTCTT | | |
Western blotting
Total protein was isolated from the urinary bladder by conventional tissue lysis with T-PER Tissue Protein Extraction Reagent (ThermoFisher Sci, Waltham, MA. USA) containing protease and phosphatase inhibitors (Sigma Aldrich, St Louis, MO. USA). Western blot experiments were performed with equal loads of the total protein per lane (20 μg). WT and KO samples were size fractionated by SDS-PAGE electrophoresis using 4–10% polyacrylamide Mini Protein gels (BioRad, Hercules, CA. USA). Proteins were then electrotransferred to polyvinylidene difluoride membranes (LICOR Biotechnology, Lincoln, NW. USA) and incubated for one hour at room temperature (RT) in Odyssey Blocking Buffer (TBS, LICOR Biotechnology, Lincoln, NW. USA). Membranes were subsequently washed three times in PBST for 10 min each and incubated with Anti-TREK-1 (F6, 1:1000, Santa Cruz Biotechnology, Dallas, TX. USA) and anti-Histone H3 as a house-keeping gene (1:2000, Abcam, Cambridge, MA. USA) in blocking buffer under constant agitation. We also tested other commercially available antibodies from the same company which included the C20, E-19, and H-75 anti-TREK-1 variants. The C20 and E19 anti-TREK-1 antibodies did not work for Western blotting, while H-75 antibody (aa352–426 within the C-terminus) showed two bands in WT animals and one band in TREK-1 KO (data not shown). Therefore, we used F6 anti-TREK-1 for Western blotting. The next day, membranes were rinsed three times with PBST for 10 min each time, and incubated with anti-mouse and anti-rabbit VRDye secondary antibodies (1:10000, LICOR Biotechnology, Lincoln, NW. USA) for 2 hrs at RT. Afterwards, membranes were rinsed three times with PBST for 10 min each and imaged using the Odyssey CLx imaging system (LICOR Biotechnology, Lincoln, NW. USA).
Tissue immunohistolabeling
WT and TREK-1 KO animals were anesthetized with isofluorane (2.5%) and perfused via the left cardiac ventricle with phosphate-buffered-saline (PBS, pH 7.4) followed by 4% paraformaldehyde in PBS (PFA) for 10 min. The colon, bladder, and kidneys were removed and placed in PFA for two hours at 4
o C. Subsequently; the tissues were placed in 70% alcohol for at least 2 days before being dehydrated and embedded in paraffin. 4 μm -thick sections were cut and mounted on “frosted” slides (Fisher Scientific Co, Waltham, MA. USA) at the Morphology and Phenotypic Core of the University of Colorado Anschutz Medical Campus. Before immunolabeling, sections were washed in Xylene (Sigma-Aldrich, St Louis, MO. USA) to remove paraffin, re-hydrated in a graded ethanol series, washed with distilled water, and rinsed in 50 mM Tris-buffered saline (TBS, pH 7.4) for 5 min. Heat-induced epitope retrieval was performed by incubating the slides at 85–90
0 C for 15 min in Target Retrieval Solution (DAKO, Agilent Pathology Solutions, Santa Clara, CA. USA). Once cold down to room temperature, the sections were washed twice in TBS containing 0.1% Tween 20 (TBST, Sigma-Aldrich, St Louis, MO. USA), and incubated for 30 min in casein blocking solution (CBS, DAKO, Agilent Pathology Solutions, Santa Clara, CA. USA). Slides were incubated overnight at 4
0 C (ON) in CBS with mouse monoclonal antibodies against the TREK-1 protein (F6, 1:300; Santa Cruz Biotechnology, Dallas, TX. USA). The next day, sections were rinsed three times with TBST for 5 min each time, and then incubated for 2 h at RT with a secondary antibody conjugated with Alexafluor 488-labeled anti-mouse IgG (1:500; Fisher Scientific Co, Waltham, MA. USA) in CBS. After incubation with secondary antibody, sections were washed three times with TBST for 5 min each, rinsed with TBS and counterstained with 200 nM 4′6-diamidino-2-phenylindoledihydrochloride (DAPI, Fisher Scientific Co, Waltham, MA. USA) in TBS for 3–5 min at RT and rinsed twice in TBS. Coverslips were mounted with Fluoromount-G (SoutherBiotech, Birmingham, AL. USA). Imaging was performed on an Olympus FV1000 confocal microscope with 40X plan-apo/1.4 numerical aperture objective and FV-viewer software (Olympus, Tokyo, JP). For visualization, three-dimensional z-stack images of x-y sections at 0.5 μm steps were collected. Two-dimensional average intensity projection images were generated for analysis in FIJI (Fiji Is Image J, [
50].
In vitro studies of bladder smooth muscle contractile function
Bladder smooth muscle (BSM) strips were isolated from WT (
N = 17) and TREK-1 KO (N = 17) mice following the previously described procedures [
23,
34]. Briefly, BSM strips (∼8–10 mg each, 2–3 mm wide and 7–8 mm long) were placed in individual organ baths (Radnoti LLC, Monrovia, CA, USA), containing 7 ml of normal Tyrode Buffer (TB, in mM: NaCl 130.0, KCl 5.0, CaCl
2 1.7, MgCl
2 1.0, NaH
2PO
4 1.3, NaHCO
3 17.0, Glucose, 10.0. pH 7.4) maintained at 37 °C and equilibrated with a constant supply of 95% O
2–5% CO
2. Strips were subjected to 1 h equilibration followed by determination of the length of optimal force development (
Lo). 1 μM of tetrodotoxin (TTX, Sigma-Aldrich) was added to fresh TB to minimize neural effects on BSM contractility. The strips were subjected to different pharmacological treatments including either arachidonic acid (AA; 10 μM), a TREK-1 channel agonist, or L-methionine (LM, 1 mM), a TREK-1 channel blocker [
5,
34,
42]. Untreated muscle strips served as controls. At the end of the incubation period, in order to assess the effects of TREK-1 channels on stress-relaxation, all strips were subjected to an additional 30% stretch to the initially established
Lo, and allowed for complete relaxation. Following the stretch protocol, a KCl test (bath solution was replaced with TB containing 125 mM KCl) was performed to ensure that the BSM could maintain the force after stretch [
23,
24]. After KCl stimulation, muscle strips were washed three times (10 min each time) in fresh TB and allowed to recover for 30 min. After recovery, all strips were incubated with a non-specific PKC activator, Phorbol 12,13-Dibutyrate (PDBu, 1 μM: Sigma; Greenwood Village, CO), for 45 min.
A separate set of experiments was performed to evaluate the contribution of active and passive basal tone components in BSM from WT and TREK-1 KO bladders. After establishing L0 in normal Ca2+ TB, the buffer was changed to Ca2+ free TB followed by 30 min incubation and measurements of the basal tone and spontaneous contractile activity of BSM strips. Some strips were subjected to an additional 30% stretch to evaluate stress-relaxation under Ca2 free conditions. At the end of the testing protocol, all strips were treated with 2 μM of nifedipine, an L-type Ca2+ channel blocker, to assess the role of Ca2+ entry via voltage-gated Ca2+ channels on BSM tone and spontaneous activity.
All BSM experiments were recorded and analyzed using LabChart 8 Pro (AD Instruments, Colorado Springs, CO, USA), pClamp 10 (Molecular Devices, LLC. San Jose CA, USA) and Matlab R2014b (MathWorks, Natick, MA, USA). The following parameters were measured and analyzed: basal muscle tone (in g/g, g of force per g of muscle strip weight), amplitude of spontaneous contractions (g/g, measured as amplitude from the baseline level of each strip and normalized to its weight), peak force (PF; in g or g/g when normalized to the weight of the muscle strip), and integral force (IF) which reflects how long a muscle strip can maintain the contractile force before it starts relaxing [
33].
Urodynamic evaluation of bladder function (awake cystometry)
Animals assigned for urodynamic evaluation of urinary bladder function (awake cystometry) underwent a survival surgical procedure to insert bladder catheters as previously described [
35]. Briefly, the animals were anesthetized with isofluorane (VEDCO, St.. Albans, VT) and the bladder was exposed through a lower midline abdominal incision. A polyethylene tubing (PE-50, I.D. 0.58 mm, O.D. 0.96 mm; Intramedic, Becton Dickinson. Parsippany, NY) with a flared end was inserted through a puncture at the bladder dome, and sutured in place with purse string suture and 7.0 silk (Ethicon, Somerville, NJ). The catheter was then tunneled subcutaneously and exteriorized at the scapular region where it was sutured to the skin and filled with sterile saline solution. After confirming no leakage in the bladder, the catheter was plugged with a metal rod, and the muscle and skin layers were closed with a 5.0 silk suture (Ethicon, Somerville, NJ). Particular care was taken not to stretch the bladder during the procedure or to restrict the normal bladder movement once the catheter was in place.
Mice were allowed to recover from surgery (4–5 days) before the urodynamic study. Unanesthetized animals were placed in the cystometry cage, and allowed to acclimate for 30–40 min. Saline was slowly infused into the urinary bladder at a rate of 10 μl/min, and micturition cycles were recorded using the MED-CMG Small Animal Cystometry acquisition software (Catamount Research and Development). The following cystometric parameters were evaluated in this study: bladder capacity, pressure at the start of micturition, micturition rate, intravesical pressure, inter-micturition interval, and number of non-voiding contractions. Non-voiding contractions were defined as the increased values in detrusor pressure not associated with voiding, equal or larger than twice the mean value of baseline. The number of non-voiding contractions was measured for each micturition cycle, and then averaged per cycle based on the number of recorded cycles (e.g. voiding episodes) per animal. Normal voiding contractions had amplitudes of at least a third of maximal pressure recorded during a single micturition event.
Statistical analyses
The results are expressed as the mean ± standard error of the mean (SEM) with N reflecting the number of animals in each group and n being the number of recordings. Statistical significance between two groups was assessed by the Student two-way t-test followed by a comparison between groups using the Bonferroni’s correction. When comparing more than two groups, one-way ANOVA with the post hoc Newman-Keuls test was reported (Prism 7. GraphPad Software, La Jolla, CA. USA). Plots were made with OriginLab Data analysis software v 7.0 (OriginLab Co. Northampton, MA). Difference between the groups and treatments was considered statistically significant at p ≤ 0.05.
Discussion
Evaluation of bladder phenotype in TREK-1 KO animals revealed significant differences in comparison to WT mice including elevated basal muscle tone, increased amplitude of basal spontaneous activity, limited pharmacological responses to TREK-1 activators and inhibitors, and elevated contractile responses to EFS and high potassium without significant changes in bladder morphology/histology. However, urodynamic study in TREK-1 KO mice revealed a substantially longer inter-micturition interval, enhanced bladder capacity and increased number of non-voiding contractions in comparison to WT animals. Overall, the results of the combined in vivo and in vitro experiments provided evidence that global down-regulation of TREK-1 channel leads to “mixed” voiding phenotype in TREK-1 KO mice.
TREK-1 channel belongs to a family of mechanogated two-pore domain potassium channels (K
2P) that produce background conductances, and are regulated by a variety of stimuli (e.g., pH, temperature, stretch and lipids) to control resting membrane potential and cell excitability [
7]. The TREK subfamily, encoded by the
KCNK2 gene, consists of three known members (TREK-1, TREK-2 and TRAAK) which participate in diverse transduction processes including mechano-sensitivity [
6,
36,
38,
47], thermo-sensitivity [
2,
26,
39], chemo-sensitivity [
40], nociception, and neuroprotection [
12,
15,
20,
31].
The results of Western blotting and IHC demonstrated that TREK-1 protein was substantially diminished in the urinary bladder of TREK-1 KO mice. The antibodies used for WB and IHC should detect any TREK-1 protein being translated, regardless of which one of the multiple start codons was used to initiate translation. Since we used the TREK-1 KO strain created by Namiranian et al. [
45] in which both the second and third exons of
Kcnk2 gene were deleted, all start codons present in both exons were deleted in this strain. Another group [
17] created TREK-1 KO strain in which only the third exon was removed leaving an alternative start codon in exon 2, and, therefore, a truncated TREK-1 protein could be translated. In our study, we tested several TREK-1 antibodies. The anti-TREK-1 mouse monoclonal antibody from SantaCruz Biotechnology (F6, sc-398,449; mapped at aa354–380 near the C-terminus of hTREK-1) showed only one band ~ 50–52 kDa when used in WB (Fig.
1b). We also tested other commercially available antibodies from the same company which included the C20, E-19, and H-75 anti-TREK-1 variants. The C20 and E19 anti-TREK-1 antibodies did not work for Western blotting, while H-75 antibody (aa352–426 within the C-terminus) showed two bands in WT animals and one band in TREK-1 KO (data not shown) suggesting that it might be recognizing alternatively spliced variants or “off-target” proteins.
Increased basal muscle tone in the bladder of TREK-1 KO mice supports previous suggestions about the role of TREK-1 channel in maintaining the negative resting membrane potential in visceral smooth muscle [
45]. Bladder muscle strips from TREK-1 KO mice also revealed the presence of spontaneous activity at both resting level and after additional stretch. Spontaneous contractions have been previously recorded in a variety of bladder smooth muscle types including human [
21,
58], rabbit [
11,
24], rat [
23], guinea pig [
56], pig [
25,
56], and mouse [
28,
54]. It is possible that knockdown of TREK-1 may affect calcium mobilization and modify the threshold for smooth muscle excitability and/or contractility, thereby, increasing spontaneous activity, as observed in our study. To test this hypothesis, we incubated BMS strips in Ca
2+-free TB followed by the application of nifedipine, a L-type calcium channel blocker (Fig.
4). Incubation of TREK-1 KO strips in Ca
2+ − free solution effectively reduced the basal tone to the levels similar to those observed in WT BMS strips. Interestingly, the reduced muscle tone observed in Ca
2+-free solution was associated with a 2-fold increase in the amplitude of spontanous contractions in TREK-1 KO group. The total elimination of spontaneous contractions and further reduction in basal tone by nifedipine suggests that TREK-1 channels participate in regulation of spontaneous contractions by stabilizing the membrane potential at voltages closer to the potassium resting potential. Overall, in addition to previously published data on human [
3,
34] and animal [
22,
42] visceral smooth muscle, our data provide additional evidence that TREK-1 channel plays a critical role in maintaining bladder basal tone, bladder compliance and modulates the response of the detrusor to stretch.
The contractile responses of BSM to EFS are mainly mediated by the release of neurotransmitters from intramural nerve terminals in the bladder wall causing detrusor contraction. We compared the responses of TREK-1 KO and WT muscle strips in their ability to generate force in response to EFS. The data showed that the loss of TREK-1 channels was associated with a significant increase in peak contractility in response to EFS (Fig.
5) while slowing the rate of relaxation in the TREK-1 KO muscle strips when compared to WT group. While EFS induces a contraction mainly via the release of acetylcholine from bladder nerves, KCl-induced contractions result from direct activation and depolarization of the detrusor muscle due to rapid membrane depolarization and the associated influx of Ca
2+ via voltage-gated Ca
2+ channels. Similar to EFS, high potassium solution also caused a significantly elevated amplitude of the contractile response in TREK-1 KO strips suggesting that increased contractility in the absence of TREK-1 channels is due to a partial membrane depolarization which shifts the resting membrane potential towards more positive values closer to the activation threshold of voltage-gated calcium channels.
Prior studies have reported that protein kinase C (PKC) may be able to phosphorylate TREK-1 channels in smooth muscle, thereby, modulating the contractile force [
30,
37,
43]. We previously showed that activation of PKC by general PKC activator, PDBu, at low levels of stimulation could inhibit spontaneous contractions in rabbit [
24] and rat [
23] BSM while higher levels of PKC stimulation had the opposite effect. These data predict that upon down-regulation of TREK-1, the PKC activator, PDBu, should have a more positive contractile effect on KO muscle strips when compared to WT group. Our data are consistent with this analysis in that PDBu, indeed, increased both the PF and the amplitude of spontaneous contractions in TREK-1 KO muscle strips compared to the WT mice. Analysis of gene expression of different PKC isoforms expressed in the urinary bladder did not reveal significant differences between WT and TREK-1 KO mice. Therefore, additional studies will be required to evaluate if the elevated response to PKC activation in TREK-1 KO bladder is due to the changes in PKC phosphorylation or activation of different downstream signaling pathways.
In contrast to in vitro contractility results, the urodynamic evaluation of voiding function in vivo by awake cystometry revealed a significant increase in the duration of inter-micturition interval and enhanced bladder capacity, both of which usually define an underactive bladder phenotype. Despite these changes, the intravesical pressure during micturition was not affected by the TREK-1 knockdown, and the number of non-voiding contractions was almost 2-fold higher in these animals which is in line with the increased contractility of the detrusor observed during the in vitro studies discussed above. Taken together, these results suggest that knock-down of
Kcnk2 gene has dual or “mixed” effects on detrusor contractility and micturition patterns. One of the possible explanations could be associated with expression of the channel on vascular and visceral smooth muscle cells as well as on the fibers and neurons of the peripheral and central nervous system [
19,
41]. The functional role of TREK-1 in smooth muscle cells is mainly to contribute to the “leak” current responsible for the maintenance of hyperpolarized resting membrane potential to keep the cells more relaxed during resting state [
5,
10].
In the nervous system, TREK-1 was shown to control electrogenesis, differentiation, axonal migration, synaptogenesis, and neural response to temperature and mechanical stretch [
1,
9,
13,
16,
19,
27,
31,
51]. In comparison to smooth muscle cells, where action potentials are driven by the influx of Ca
2+ via L-type Ca
2+ channels, excitability of neurons is regulated mainly by voltage-gated Na
+ channels. The lack of TREK-1 channel in neurons would shift the resting membrane potential towards more positive values (just like in smooth muscle cells) allowing for the rapid influx of Na
+ inside the cell, and, therefore, making both afferent and efferent neurons more excitable. The final result of this neuronal activity would depend on what neurons are more affected by these changes. An increase in afferent activity from the urinary bladder to the brain is usually associated with an increase in urgency and frequency of micturition associated with bladder overactivity. However, the efferent output from the brain to the bladder is mainly inhibitory to allow for the voluntary control of micturition. Therefore, increased excitability of efferent neurons would lead to increased inter-micturition interval and bladder underactivity, which we observed in our study in vivo. Future studies focused on manipulations of either afferent or efferent neural pathways are warranted to test this hypothesis.
Another possible explanation for the differences between in vitro and in vivo bladder phenotypes could be associated with some unknown alterations occurring during genetic modifications of the parental strain. TREK-1 was determined to mediate changes in the actin cytoskeleton independently of its channel activity in fetal neurons during development in a different strain of TREK-1 KO mice [
32]. The same mouse strain showed an increased efficacy of 5-HT neurotransmission and resistance to depression [
20]. Previous studies from our [
35] and other [
57] groups provided evidence that lower urinary tract function in mice varies in a consistent manner with strain and/or sex. For instance, voiding spot assay and cystometry performed in male and female C57BL/6 J, 129S1/SvImJ, NOD/ShiLtJ, and CAST/EiJ mice [
8] to evaluate bladder function, established a significantly prolonged duration of the micturition cycle in genetically modified animals (129S1/SvImJ, NOD/ShiLtJ, and CAST/EiJ) in comparison to C57BL/6 J strain [
8]. These results are in line with our cystometric recordings from TREK-1 KO mice. The differences between our study and the published results included the use of both sexes (males and females), the use of WT controls which were not littermates, and performance of cystometry without anesthesia in our experiments, as well as the absence of in vitro experiments in the previously published study.
The choice of the approach to create a genetically modified strain also seems to affect the function of different organs and tissues in genetically modified animals. For instance, the TREK-1 KO strain we adopted and used in our study, provided no evidence that TREK-1 is involved in the regulation of arterial diameter in cerebral arteries [
45]. However, another TREK-1 KO strain [
32] did present with the vascular phenotype. There is also a possibility that genetic knockdown of TREK-1 expression could trigger compensatory changes in other mechano-gated ion channels or related signaling cascades, thereby, affecting the final voiding phenotype as well as the response of the detrusor to stretch. Further studies are warranted to address these questions.
Acknowledgements
We thank Dr. Min Zhou and his lab members for providing the TREK-1 KO mice for our study, as well as Dr. John A Thompson from the Department of Neurosurgery, University of Colorado Denver for help with data analyses. Imaging experiments were performed in the University of Colorado Anschutz Medical Campus Advance Light Microscopy Core supported in part by Rocky Mountain Neurological Disorders Core (P30 NS048154) and by NIH/NCATS Colorado CTSI Grant (UL1 TR001082).