Ascorbic acid partly antagonizes resveratrol mediated heme oxygenase-1 but not paraoxonase-1 induction in cultured hepatocytes - role of the redox-regulated transcription factor Nrf2

For promoter analysis, sequences of HO-1 and PON1 genes were uploaded to MatInspector Software http://​www.​genomatix.​de in order to identify putative binding sites for Nrf2. The respective promoter sequences were obtained from Ensembl genome browser http://​www.​ensembl.​org and were adjusted to 2000 bp upstream and 600 bp downstream of transcriptional start site.

HUH7 human hepatoma cells (obtained from the Institute of Applied Cell Culture, Munich, Germany), were cultured in high glucose (4 g/l) Dulbecco's modified Eagle's medium supplemented with 10% (v/v) foetal bovine serum, 4 mmol/l L-glutamine, 100 U/ml penicillin and 100 μg/ml streptomycin (all PAA, Coelbe, Germany) and grown in a humidified incubator at 37°C and 5% CO₂. HUH7/PON1 cells were cultivated in high glucose (4 g/l) Dulbecco's modified Eagle's medium with 10% heat inactivated foetal bovine serum, 100 U/ml penicillin, 100 μg/ml streptomycin and 100 μg/ml G418 (all from PAA, Coelbe, Germany). For cell culture studies stock solutions were prepared as following: 100 mmol/l resveratrol (Sigma, Deisenhofen, Germany) dissolved in DMSO, and stored at -80°C until further use; 1 mol/l ascorbic acid (Carl Roth, Karlsruhe, Germany) was freshly prepared in PBS and adjusted to pH 7. For all cell culture assays vehicle controls have been performed and did not affect any of the parameters measured.

The neutral red assay [23, 24] was used to determine the cell viability after incubation with the different test compounds. HUH7 cells were seeded at a density of 0.2 × 10⁶ cells/well (for HUH7) or 0.15 × 10⁶ cells/well (for HUH7/PON1) for 24 h and treated with 5-100 μmol/l resveratrol and 10-1000 μmol/l ascorbic acid, respectively. HUH7 cells were incubated with test compounds for 24 h, HUH7/PON1 cells for 48 h. In brief, the culture medium containing the test substances was replaced with fresh serum-containing medium including 60 μg/ml of Neutral Red (Carl Roth, Karlsruhe, Germany). After incubation for 1.5 h the medium was removed and the cells were extracted using a solution comprising 50:49:1 (v/v/v) ethanol, water and glacial acetic acid. The absorbance was measured in a plate reader (Labsystems, Helsinki, Finland) at 540 nm.

HUH7 cells were seeded at a density of 1.0 × 10⁶ cells/well in a 6 well plate for 24 h. Subsequently, cells were treated with resveratrol (10 μmol/l) alone and in combination with 100 μmol/l and 1000 μmol/l ascorbic acid for 6 h, respectively. RNA was isolated using TRIsure (Bioline, Luckenwalde, Germany) according to manufacturer's instructions. Primers for human HO-1 gene (forward 5'CCAGGCAGAGAATGCTGAGT 3'; reverse 5' GTAGACAGGGGCGAAGACTG3') were designed by Primer3 software and ordered at MWG Biotech/Eurofins, Ebersberg, Germany. Real time PCR was performed with a SensiMix one step kit (Quantace, Berlin, Germany).

PON1 induction capacity of resveratrol in the presence of ascorbic acid was evaluated in cultured hepatocytes. HUH7 liver hepatoma cells of human origin had been stably transfected with a reporter plasmid containing 1009 bp [-1013, -4] of the PON1 gene 5'-region cloned into the firefly luciferase reporter vector pGL3 basic (Promega) as described previously [25]. Stable clones originated from X. Coumoul/R. Barouki, INSERM, France. HUH7/PON1 cells were seeded at an initial density of 150,000 cells per well (24 well plate) and incubated with 25 μmol/l resveratrol (Sigma, Deisenhofen, Germany) in the absence or presence of ascorbic acid (100 and 1000 μmol/l) for 48 h as recently described [26]. Then, the cells were washed with PBS, lysed and subjected to luciferase activity measurement (Luciferase assay system; Promega, Madison, WI, USA) by luminescence reading (Infinite 200 reader; Tecan, Crailsheim, Germany) and normalized to total cell protein (BCA Assay, Pierce, Illinois, USA).

HUH7 cells were seeded in a 24-well-plate at a density of 0.1 × 10⁶ cells for 24 h. Then cells were transfected with pARE_GIGPx_Luc (kindly provided by A. Banning/R. Brigelius-Flohé, DIFE, Potsdam, Germany), a luciferase reporter gene under the control of the ARE region found in the promoter of the human GIGPx, as described by Banning et al. 2005 [27]. The renilla reporter gene phRLTK (Promega, Mannheim, Germany) was applied for normalization. Both plasmids were transfected by using FuGene6 (Roche, Penzberg, Germany) according to manufacturer's protocol. 24 h post transfection medium was removed and the cells were simultaneously treated with 10 μmol/l resveratrol and 100 and 1000 μmol/l ascorbic acid for further 24 h. Following lysis with passive lysis buffer (Promega, Mannheim, Germany) firefly and renilla luciferase activity was determined using the Dual Luciferase Assay (Promega, Mannheim, Germany) according to manufacturer's description. Firefly luciferase values were normalized by renilla luciferase values. The experimental data represent the mean of three independent experiments performed in duplicate.

For HO-1 and PON1 detection cells were treated with the test compounds for 24 h. Subsequently, cells were washed with ice-cold PBS, scraped off, centrifuged and the remaining cell pellet was stored at -80°C. For Western Blotting, the cell pellet was lysed in RIPA buffer [50 mmol/l Tris-HCl, 150 mmol/l NaCl, 0.5% (w/v) sodium deoxycholate, 0.1% (w/v) sodium dodecyl sulphate (SDS), 1% (w/v) Nonidet-P40, 2 mmol/l EDTA, 1 mmol/l dithiothreitol (DTT), protease inhibitor cocktail (Sigma, Deisenhofen, Germany)] and stored until further analysis. Protein concentrations were determined with the BCA assay (Pierce, Illinois, USA) according to manufacturer's instructions. 40 μg protein of each sample were mixed with loading buffer, denatured at 95°C for 5 min and separated on a 12% SDS PAGE. Subsequently the samples were transferred onto a PVDF membrane and blocked with 5% (w/v) skim milk dissolved in TBS+0.05% (v/v) Tween-20 (TBST) for at least 1 h and probed with HO-1 (Stressgen, Michigan, USA; 1:1000) or PON1 (Abcam, Cambridge, UK; 1:1000) at 4°C over night. Following, the membranes were incubated with a secondary antibody (1:4000 anti-rabbit) for 45 min and the bands were visualized by using ECL reagent in a ChemiDoc XRS system (both BioRad, Munich, Germany).

Fox assay was carried out according to Long and coworkers [28]. Tests were performed in DMEM high glucose medium supplemented with 10% fetal bovine serum and 100 U/ml of penicillin and 100 μg/ml streptomycin. DMEM was supplemented with increasing concentrations of resveratrol (1, 5, 10, 25, 50 μmol/l) in combination with 100 and 1000 μmol/l ascorbic acid (adjusted to pH 7), respectively. A standard curve was prepared using H₂O₂ (0, 2.2, 8.8, 22, 88 μmol/l). The samples were mixed with FOX reagent and incubated at room temperature for 30 min. Following centrifugation at 15,000 × g for 4 min the absorbance was read at 560 nm.

Statistical analysis was conducted using SPSS software Version 15.0 (Munich, Germany). Data were analysed for normality of distribution (Kolmogorov-Smirnov or Shapiro-Wilk-test). In case of not normally distributed data the non-parametric Mann-Whitney-U test was applied. One-way analysis of variance (ANOVA) with a Dunnet's (homogeneous variances) or Games-Howell (heterogenous variances) post hoc test was performed. Data are expressed as mean ± SEM. Significance was accepted at p < 0.05.

To identify binding sites for Nrf2 in promoter regions of HO-1 and PON1, the respective promoter sequences were uploaded to MatInspector. As shown in figures 1a and 1b, four alternative promoter sequences have been identified for both HO-1 and PON1 genes. Importantly, binding sites (in total eight) for Nrf2 have been identified in all promoter sequences of HO-1 (Figure 1a). However, for the PON1 gene, only three promoter sequences have been identified comprising in total five Nrf2 binding sites (Figure 1b).

Resveratrol was not cytotoxic up to a concentration of 25 μmol/l. At 50 μmol/l resveratrol a slight 10% decrease in cell viability was observed (Figure 2a). Ascorbic acid (Figure 2b) did not exhibit any cytotoxicity up to a concentration of 1000 μmol/l each.

Incubation of HUH7 cells with 10 μmol/l resveratrol resulted in a significant increase in HO1 mRNA (Figure 3a) and protein levels (Figure 3b). Coincubation of resvertraol with ascorbic acid partly counteracted resveratrol mediated HO-1 induction.

HO-1 gene expression is highly regulated by the transcription factor Nrf2. Therefore we determined Nrf2 transactivation in the absence and presence of resveratrol and ascorbic acid. Resveratrol significantly enhanced Nrf2 transactivation (3.5 fold increase as compared to untreated cells). Coincubation of resveratrol with 1000 μmol/l ascorbic acid antagonized resveratrol mediated Nrf2 induction (Figure 4).

Incubation of HUH7 cells stably transfected with PON1 with resveratrol significantly increased PON1 transactivation (Figure 5a). Ascorbic acid concentration of 100 μmol/l did not affect PON1 transactivation, whereas 1000 μmol/l ascorbic acid slightly enhanced PON1 transactivation. Furthermore resveratrol induced PON1 protein levels in HUH7 cells. The induction of PON1 due to resveratrol was not counteracted by ascorbic acid (Figure 5b)

As shown in figure 6 resveratrol per se produced relatively low amounts (1.3-1.6 μmol/l) of hydrogen peroxide in the DMEM cell culture medium as determined with the Fox assay. The addition of 100 μmol/l and 1000 μmol/l ascorbic acid resulted in a dose-dependent increase in hydrogen peroxide formation. At 100 μmol/l ascorbic acid ~15 μmol/l hydrogen peroxide and at 1000 μmol/l ascorbic acid almost 50 μmol/l of hydrogen peroxide were generated.