Skip to main content
Erschienen in: BMC Medical Genetics 1/2005

Open Access 01.12.2005 | Research article

Association study of functional genetic variants of innate immunity related genes in celiac disease

verfasst von: B Rueda, A Zhernakova, MA López-Nevot, J Martín, BPC Koeleman

Erschienen in: BMC Medical Genetics | Ausgabe 1/2005

Abstract

Background

Recent evidence suggest that the innate immune system is implicated in the early events of celiac disease (CD) pathogenesis. In this work for the first time we have assessed the relevance of different proinflammatory mediators typically related to innate immunity in CD predisposition.

Methods

We performed a familial study in which 105 celiac families characterized by the presence of an affected child with CD were genotyped for functional polymorphisms located at regulatory regions of IL-1α, IL-1β, IL-1RN, IL-18, RANTES and MCP-1 genes. Familial data was analysed with a transmission disequilibrium test (TDT) that revealed no statistically significant differences in the transmission pattern of the different genetic markers considered.

Results

The TDT analysis for IL-1α, IL-1β, IL-1RN, IL-18, and MCP-1 genes genetic variants did not reveal biased transmission to the affected offspring. Only a borderline association of RANTES promoter genetic variants with CD predisposition was observed.

Conclusion

Our results suggest that the analysed polymorphisms of IL-1α, IL-1β, IL-1RN, IL-18, RANTES and MCP-1 genes do not seem to play a major role in CD genetic predisposition in our population.
Hinweise

Competing interests

The author(s) declare that they have no competing interests.

Authors' contributions

B.R., carried out the genotyping and statistical analysis and drafted the manuscript.
A.Z., participated in the genotyping and helped in the use of the ABI PRIM 7900 Sequence Detection Systems and SDS 2.2.1 software.
M.A. L-N., collected the samples and revised the manuscript.
J.M., participated in the manuscript design and coordination and helped to draft the manuscript
B.K., reviewed the statistical analysis and helped to draft the manuscript.
All authors read and approved the final manuscript.

Background

Celiac disease (CD) is an autoimmune disorder of the small intestine in which dietary gluten ingestion leads to a chronic inflammatory status of the mucosa [1]. There is strong evidence for a genetic component for CD, with the HLA genes being the strongest genetic locus associated with CD predisposition known to date. About 95% of CD patients are carriers of the DQ2 molecule, encoded by DQA1*05/DQB1*02 alleles, compared to ~10% of healthy control subjects. Furthermore, the DQ8 molecule (DQA1*0301/DQB1*0302 is also found more frequently in CD patients although to a lesser extent [2]. Finally, a role for genes located outside the HLA region has been suggested since the overall contribution of HLA genes to CD genetic predisposition is no more than 40% [1].
T CD4+ lymphocytes are key elements in the induction and progression of CD pathogenesis. Certain gluten peptides bound to DQ2 or DQ8 molecules cause proliferation and production of proinflammatory cytokines by lamina propria CD4 +T cells [3]. Besides this activation of adaptive immune response, recent evidences suggest that there is an implication of the innate immunity in the initial phases of CD [4]. In this regard, some gluten peptides have been demonstrated to drive a danger signal that leads to an activation of the innate immune system [5, 6] and additionally it is thought that bacteria may play a role in CD [7]. In fact, CD patients show an up-regulation in the expression of pro-inflammatory cytokines typically related to the innate immune response, such us IL1, IL-18 and chemokines [6, 810].
The IL1 gene cluster located in the chromosomal region 2q12-22 codifies for three proteins: IL-1α, IL-1β and IL-1 receptor agonist (IL-1RN), of which the two first are strong inducers of inflammation while IL-1RN is an effective antagonist binding to the IL-1 receptor without activating the target cell [11]. These genes are polymorphic bearing well-characterized single nucleotide polymorphisms (SNPs). Polymorphisms in IL-1α at position -889 C/T (rs1800587) and IL-1β at position -511 C/T (rs1143627) were described [12, 13]. Furthermore, recent findings showed that the -511 C/T IL-1β genetic variant is related to differences in IL-1β protein secretion [14]. The IL-1RN gene contains within its second intron a variable number of an 86-bp tandem repeats (rs380092) [15], showing the allele 2 (IL-1RN*2; two repeats) an increased frequency in a variety of autoimmune and inflammatory disorders [16].
Another important member of the proinflammatory IL-1 family is IL-18, which is thought to be a key regulator of cytokine expression [17]. Furthermore, a role for IL-18 in the induction of an anti-gluten inflammatory response has been suggested [10, 18, 19]. It is thought that IL-18 gene variation in the promoter region regulates the expression of this cytokine [20]. Interestingly, in the IL-18 promoter region two SNPs -607 A/C (rs1946518) and -137 G/C (rs187238) were described, which are supposed to alter the IL-18 promoter activity [21].
Moreover, raised levels of chemokines such us RANTES (regulated upon activation, normal T-cells expressed and secreted) and monocyte chemoatractant protein-1 (MCP-1) have been observed in the primary immune response to gluten in CD patients [6, 8]. Interestingly, genetic variants within regulatory regions that can affect trancription and protein production levels, RANTES -403 G/A (rs2107538) and -28 G/C (rs2280788) and MCP-1 -2518 G/A (rs1024611) SNPs, were described [2224].
Taking into consideration these findings, in this work we aimed to investigate the possible implication of IL-1α, IL-1β, IL-1RN, IL-18, RANTES and MCP-1 functional polymorphisms in CD susceptibility.

Methods

Patients

In the present work we have analysed a panel of 105 celiac families characterised by the presence of an affected child with CD. The study participants were recruited at "Hospital Materno-Infantil" and "Hospital Clinico Universitario", Granda, (Spain) and were of Spanish Caucasian origin. All patients were diagnosed following the European Society of Paediatric Gastroenterology, Hepatology and Nutrition (ESPGHAN) criteria for CD [25]. Their age at study was 7.1 ± 3.9 years and the mean age for disease diagnosis was 2.7 ± 2.72. A 60% were women and 40 % men, showing an anthropometry at diagnosis (weight and height) of P 3–100 percentile. The mean age of gluten introduction was 6.4 ± 1.5 months. Typical symptoms were observed in 72.2 % of patients and 27.8 % showed atypical symptoms. All family members were genotyped in DRB1 and DQB1. DQA1 typing was deduced from DQB1 and DRB1 typing on the basis of the strong linkage disequilibrium among HLA class II alleles.

Genotyping

DNA from patients and controls was obtained from peripheral blood using standard methods. For all of the considered SNPs, except IL-1RN and RANTES -403, samples were genotyped using a Taqman 5' allelic discrimination assay. Table 1 shows the Taqman MGB probes sequences used for each polymorphism provided by the Custom-Taqman-SNP-Genotyping-Assay (Applied Biosystems, Foster City, CA, USA). PCR reaction was carried in a total reaction volume of 5 μl with the following amplification protocol: denaturation at 92°C for 10 min, followed by 50 cycles of denaturation at 92°C for 15 sec and annealing and extension at 58°C for 1 min. Post-PCR, the genotype of each sample was attributed automatically by measuring the allelic specific fluorescence on the ABI PRIM 7900 Sequence Detection Systems using the SDS 2.2.1 software for allelic discrimination (Applied Biosystems, Foster City, CA, USA). RANTES -403 genotyping was performed using a TaqMan SNP-Genotyping-Assay (part number: C__15874407_10, Applied Biosystems, Foster City, CA, USA).
Table 1
Taqman probes used for cytokine genotyping
Polymorphism
Taqman probe sequence
IL-1A -889 C/T (rs1800587)
VIC – CCTTCAATGGTGTTGCC
 
FAM – CCTTCAATGATGTTGCC
IL-1B -551 C/T (rs1143627)
VIC – CTGTTTTTATGGCTTTCA
 
FAM – CTGTTTTTATAGCTTTCA
IL-18 -607 C/A (rs1946518)
VIC – ATCATTAGAATTTTATGTAATAAT
 
FAM – ATCATTAGAATTTTATTTAATAAT
IL-18 -137 G/C (rs187238)
VIC – ACTATTTTCATGAAATCTTTTCT
 
FAM – TTTTCATGAAATGTTTTCT
RANTES -28 G/C (rs2280788)
VIC – CCCCTCAACTGGC
 
FAM – CCCCTGAACTGGC
MCP-1 -2518 G/A (rs1024611)
VIC – CAGACAGCTGTCACTTT
 
FAM – CAGACAGCTATCACTTT
The IL-1RN polymorphism was genotyped by PCR as previously described [26]. Briefly, we used a froward primer 5'- CTC AGC AAC ACCT CCT AT and reverse primer 5'- TCC TGG TCT GCA GGT AA, two amplify five possible alleles with different PCR fragment size: 410 bp (allele 1: 4 repeats), 240 bp (allele 2: two repeats), 325 bp (allele 3: 3 repeats), 500 bp (allele 4: 5 repeats), and 595 bp (allele 5: 6 repeats).

Statistical analysis

We used the UNPHASED software created for TDT and case-control analysis [27]. We performed a Transmission Disequilibrium Test (TDT), which assesses allele transmission rates in simplex families and tests for deviation from expected 50% transmission. For the haplotype analysis, pair-wise linkage disequilibrium measures were investigated and haplotypes constructed using the expectation-maximization (EM) algorithm implemented in UNPHASED software. The power of the study to detect an effect of a polymorphism in disease susceptibility was estimated using the Quanto v 0.5 software (Department of Preventive Medicine University of Southern California, California, USA) [28].

Results

IL1 gene cluster

The transmission pattern for IL-1α -889, IL-1β -511 and IL-1RN VNTR polymorphisms is shown in table 2. When transmission of these genetic variants was analysed, none of the alleles showed statistically significant skewing. IL-1α -889 T allele was slightly more transmitted to the affected children (58% transmission for allele T vs 47% for allele C), however the p value failed to reach statistically significant level (Table 2). With regard to IL-1RN we observed that alleles IL-1RN*1 and IL-1RN*2 were the most frequent in our population (71.6% and 26.8% respectively), accordingly with previously studies in Caucasian populations [26].
Table 2
Allelic frequencies and percentage of transmission of IL-1α, IL-1β, IL-1RN, IL-18, RANTES and MCP-1 genetic variants in CD families.
 
Alelle frequency in parents (%)
T:NT
% T
P
IL-1A -551
    
C
70.4
111:125
47
0.08
T
29.6
52:38
58
0.08
IL-1B -889
    
T
67.6
110:111
49.7
NS
C
32.4
47:46
50.5
NS
IL-1RN VNTR
    
1
71.6
107:107
50
NS
2
26.8
43:42
50.6
NS
3
1.6
2:2
50
NS
IL-18 -607
    
C
61.7
102:103
49.7
NS
A
38.3
59:58
50.4
NS
IL-18 -137
    
G
75.9
124:124
50
NS
C
24.1
47:47
50
NS
RANTES -28
    
C
84.1
155:148
51
0.04
G
15.9
3:10
23
0.04
RANTES -403
    
G
85.7
141:128
52
0.06
A
14.3
23:36
39
0.06
MCP-1
    
A
72.8
117:129
47
NS
G
27.2
48:36
57
NS
T = transmitted, NT = not transmitted %T = percentage transmitted

IL18 gene

The TDT analysis for -607 A/C and -137 G/C IL-18 promoter genetic variants did not reveal biased transmission of any of the alleles to the affected offspring (Table 2).
The haplotype estimation for the -607 A/C and -137 IL-18 promoter variants revealed complete linkage disequilibrium between the two variants (D' = 1). We observed three out of the four possible haplotypic combinations in CD families (Table 3). The transmission pattern of IL-18 promoter haplotypes did not show any statistically significant skewing (Table 3).
Table 3
Transmission pattern of haplotypes inferred for IL-18 and RANTES promoter genetic variant in CD families
Gene
Haplotype
Transmitted (%)
No transmitted (%)
P
Il-18
-607A/-137G
37 (24)
35 (22.5)
NS
 
-607A/-137C
19 (12.2)
20 (13)
NS
 
-607C/-137G
99 (63.8)
100 (64.5)
NS
RANTES
-403G/-28A
3 (1.4)
8 (5.2)
NS
 
-403A/-28C
19 (12.3)
26 (16.8)
NS
 
-403G/-28C
132 (85.7)
119 (81.5)
0.05

MCP-1 and RANTES

After analyzing the MCP-1 -2518 G/A alleles transmission we observed that none of the alleles was preferentially transmitted from heterozygous parents to the affected offspring (Table 2). Regarding to the RANTES promoter genetic variants the mutant alleles -403 A and -28 G showed an overall allele frequency similar to that expected for Caucasian populations (84.1% and 96.5% respectively in our population) [29, 30]. The transmission of both -403G/A and -28 C/G SNPs showed a slightly deviation from the 50% expected transmission pattern (Table 2). Alleles -403 G and -28 C were more transmitted to the affected offspring with borderline significance (P = 0.04 and P = 0.06 respectively) (Table 2). In addition, we estimated haplotypes for both genetic variants. Three out of the four haplotypic combinations were observed, being the -403G/-28C and -403A/-28C haplotypes the most common in CD families. No significant distorted transmission pattern for RANTES promoter haplotypes was observed (Table 3).

Discussion

CD is considered a model for autoimmune disorders since many of the components that generate the altered immune response to gluten have been well characterized [1]. However, there are some relevant events of CD pathogenesis that remain unclear, for instance the stimuli that drives the high IFNγ levels in the small intestine of CD patients and why only one out of 20–30 DQ2-positive individuals develops CD [3]. An explanation for these questions might be provided from recent studies that point out a role for the innate immunity in CD [4]. This finding supports a novel focus of research in CD molecular and genetic basis, opening a new field for the functional search of CD candidate genes.
In this work, for the first time we have assessed the relevance of IL-1α, IL-1β, IL-1RN, IL-18, RANTES and MCP-1 genes in CD predisposition. All these genes have been previously associated with susceptibility to several autoimmune disorders [3140]. However, we failed to detect an association of IL-1α, IL-1β, IL-1RN, IL-18, and MCP-1 genes with CD predisposition using a TDT analysis in our cohort of 105 simplex CD families. Only a borderline significant association of RANTES promoter genetic variants with CD predisposition was observed.
Several studies have focused on the role of RANTES -403G/A and -28 G/C promoter polymorphisms in susceptibility to different autoimmune disorders. The RANTES -403A allele has been associated with susceptibility to multiple sclerosis (MS) and polymialgia rheumatica [41, 42]. On the other hand, the RANTES -28G allele was observed to be a genetic risk for clinical complications such us diabetic neprhopathy, early onset of MS, lower levels of C3 in SLE, and higher incidence of central nervous system lupus [37, 38, 41]. Both RANTES -403A and -28G alleles were associated with higher RANTES expression levels [22, 23]. However, considering the multiple testing of the 6 different genes of our study, the association observed for RANTES promoter variants in our population can not be considered as being significant. Therefore, our results of RANTES suggest that further studies should be performed to clarify the role of RANTES in CD and autoimmune diseases in general.
Using a familial approach we eliminate the risk of population stratification derived from case-control association studies. In addition, we estimated that our study design would have considerable power to detect the effect of a polymorphism with moderate to high risk for CD. Assuming an additive model, a minor allele frequency of 0.30 (corresponding to a median value of the majority of markers considered) and RR of 1.8 we would reach 81% power to detect an association in our population. Nevertheless, under a dominant model the power drops to 49% and considering a lower disease allele frequency, for instance 0.16 as is the case of RANTES -28, our study power would decrease to a 64% for a RR of 1.8, and increases to 82% when we assume a RR of 2.0. For this reason, the low level of significance that our TDT analysis reached for RANTES promoter genetic variants might well reflect a true positive, and therefore needs further confirmation using a larger group of CD families.
Taking into account our findings, it is suggested that the analysed genetic polymorphisms of IL-1α, IL1-β, IL-1RN, IL-18, RANTES and MCP-1 genes seem not to play a major role in CD susceptibility in our population. It might be possible that the release of these cytokines and chemokines observed in CD patients could be derived from the activity of other innate immunity related pro-inflammatory mediators with higher influence in disease pathogenesis. In this regard, it is known that in CD the cytokine expression pattern in response to gluten is strongly dominated by IFNγ [43]. Of note, in a recent work we assessed the influence of a functional dinucleotide polymorphism of IFNγ gene in CD predisposition. An association of a higher IFNγ producer allele with CD was observed, supporting a possible explanation for the high levels of INFγ observed in intestinal mucosa of CD patients [44].
Other proinflammatory mediators related with innate immunity such as, TNF-α and IL-12, has been analysed with respect to CD susceptibility. In accordance with our findings no evidence of association was found between IL-12 and CD in two independent studies [45, 46]. Regarding TNF-α it has been difficult to dissect the relevance of this genetic marker in CD since it maps within HLA clas III region and it shows linkage disequilibrium with CD disease predisposing DQ2 alleles. In fact controversial results have been obtained, and there is no consensus about an independent or due to linkage disequilibrium role of TNF-α in CD susceptibility [47, 48].

Conclusion

Our results suggest that IL-1α, IL1-β, IL-1RN, IL-18, RANTES and MCP-1 genetic variants do not play a major role in CD genetic predisposition, although the suggestive evidence for RANTES deserves further investigation. Furthermore, we consider the innate response an intriguing focus of research and it should be of interest to investigate the role of other cytokines up-regulated in the early events of CD.

Acknowledgements

This work was supported by grant SAF03-460 from Plan Nacional de I+D (CICYT), and in part by Consejería de Educación, Junta de Andalucía, grupo CTS-180.
B.K. is supported by the Dutch Diabetes Research Foundation, The Netherlands Organisation for Health Research and Development (ZonMW) and The Juvenile Diabetes Research Foundation International (JDRF) (2001.10.004).
Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://​creativecommons.​org/​licenses/​by/​2.​0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Competing interests

The author(s) declare that they have no competing interests.

Authors' contributions

B.R., carried out the genotyping and statistical analysis and drafted the manuscript.
A.Z., participated in the genotyping and helped in the use of the ABI PRIM 7900 Sequence Detection Systems and SDS 2.2.1 software.
M.A. L-N., collected the samples and revised the manuscript.
J.M., participated in the manuscript design and coordination and helped to draft the manuscript
B.K., reviewed the statistical analysis and helped to draft the manuscript.
All authors read and approved the final manuscript.
Literatur
1.
Zurück zum Zitat Sollid LM: Coeliac disease: dissecting a complex inflammatory disorder. Nature Review Immunology. 2002, 2: 647-10.1038/nri885.CrossRef Sollid LM: Coeliac disease: dissecting a complex inflammatory disorder. Nature Review Immunology. 2002, 2: 647-10.1038/nri885.CrossRef
2.
Zurück zum Zitat Louka AS, Sollid LM: HLA in coeliac disease: Unravelling the complex genetics of a complex disorder. Tissue Antigens. 2003, 61: 105-117.CrossRefPubMed Louka AS, Sollid LM: HLA in coeliac disease: Unravelling the complex genetics of a complex disorder. Tissue Antigens. 2003, 61: 105-117.CrossRefPubMed
3.
Zurück zum Zitat Green PH, Jabri B: Coeliac disease. Lancet. 2003, 362: 383-391. 10.1016/S0140-6736(03)14027-5.CrossRefPubMed Green PH, Jabri B: Coeliac disease. Lancet. 2003, 362: 383-391. 10.1016/S0140-6736(03)14027-5.CrossRefPubMed
4.
Zurück zum Zitat Schuppan D, Esslinger B, Dieterich W: Innate immunity and coeliac disease. Lancet. 2003, 362: 3-4. 10.1016/S0140-6736(03)13843-3.CrossRefPubMed Schuppan D, Esslinger B, Dieterich W: Innate immunity and coeliac disease. Lancet. 2003, 362: 3-4. 10.1016/S0140-6736(03)13843-3.CrossRefPubMed
5.
Zurück zum Zitat Maiuri L, Ciacci C, Ricciardelli I, Vacca L, Raia V, Auricchio S, Picard J, Osman M, Quaratino S, Londei M: Association between innate response to gliadin and activation of pathogenic T cells in coeliac disease. Lancet. 2003, 362: 30-37. 10.1016/S0140-6736(03)13803-2.CrossRefPubMed Maiuri L, Ciacci C, Ricciardelli I, Vacca L, Raia V, Auricchio S, Picard J, Osman M, Quaratino S, Londei M: Association between innate response to gliadin and activation of pathogenic T cells in coeliac disease. Lancet. 2003, 362: 30-37. 10.1016/S0140-6736(03)13803-2.CrossRefPubMed
6.
Zurück zum Zitat Tuckova L, Novotna J, Novak P, Flegelova Z, Kveton T, Jelinkova L, Zidek Z, Man P, Tlaskalova-Hogenova H: Activation of macrophages by gliadin fragments: isolation and characterization of active peptide. J Leukoc Biol. 2002, 71: 625-631.PubMed Tuckova L, Novotna J, Novak P, Flegelova Z, Kveton T, Jelinkova L, Zidek Z, Man P, Tlaskalova-Hogenova H: Activation of macrophages by gliadin fragments: isolation and characterization of active peptide. J Leukoc Biol. 2002, 71: 625-631.PubMed
7.
Zurück zum Zitat Forsberg G, Fahlgren A, Horstedt P, Hammarstrom S, Hernell O, Hammarstrom ML: Presence of bacteria and innate immunity of intestinal epithelium in childhood celiac disease. Am J Gastroenterol. 2004, 99: 894-904. 10.1111/j.1572-0241.2004.04157.x.CrossRefPubMed Forsberg G, Fahlgren A, Horstedt P, Hammarstrom S, Hernell O, Hammarstrom ML: Presence of bacteria and innate immunity of intestinal epithelium in childhood celiac disease. Am J Gastroenterol. 2004, 99: 894-904. 10.1111/j.1572-0241.2004.04157.x.CrossRefPubMed
8.
Zurück zum Zitat Chowers Y, Marsh MN, De Grandpre L, Nyberg A, Theofilopoulos AN, Kagnoff MF: Increased proinflammatory cytokine gene expression in the colonic mucosa of coeliac disease patients in the early period after gluten challenge. Clin Exp Immunol. 1997, 107: 141-147. 10.1046/j.1365-2249.1997.d01-892.x.CrossRefPubMedPubMedCentral Chowers Y, Marsh MN, De Grandpre L, Nyberg A, Theofilopoulos AN, Kagnoff MF: Increased proinflammatory cytokine gene expression in the colonic mucosa of coeliac disease patients in the early period after gluten challenge. Clin Exp Immunol. 1997, 107: 141-147. 10.1046/j.1365-2249.1997.d01-892.x.CrossRefPubMedPubMedCentral
9.
Zurück zum Zitat Fornari MC, Pedreira S, Niveloni S, Gonzalez D, Diez RA, Vazquez H, Mazure R, Sugai E, Smecuol E, Boerr L, et al: Pre- and post-treatment serum levels of cytokines IL-1beta, IL-6, and IL-1 receptor antagonist in celiac disease. Are they related to the associated osteopenia?. Am J Gastroenterol. 1998, 93: 413-418.CrossRefPubMed Fornari MC, Pedreira S, Niveloni S, Gonzalez D, Diez RA, Vazquez H, Mazure R, Sugai E, Smecuol E, Boerr L, et al: Pre- and post-treatment serum levels of cytokines IL-1beta, IL-6, and IL-1 receptor antagonist in celiac disease. Are they related to the associated osteopenia?. Am J Gastroenterol. 1998, 93: 413-418.CrossRefPubMed
10.
Zurück zum Zitat Salvati VM, MacDonald TT, Bajaj-Elliott M, Borrelli M, Staiano A, Auricchio S, Troncone R, Monteleone G: Interleukin 18 and associated markers of T helper cell type 1 activity in coeliac disease. Gut. 2002, 50: 186-190. 10.1136/gut.50.2.186.CrossRefPubMedPubMedCentral Salvati VM, MacDonald TT, Bajaj-Elliott M, Borrelli M, Staiano A, Auricchio S, Troncone R, Monteleone G: Interleukin 18 and associated markers of T helper cell type 1 activity in coeliac disease. Gut. 2002, 50: 186-190. 10.1136/gut.50.2.186.CrossRefPubMedPubMedCentral
11.
Zurück zum Zitat Arend WP: The balance between IL-1 and IL-1Ra in disease. Cytokine Growth Factor Rev. 2002, 13: 323-340. 10.1016/S1359-6101(02)00020-5.CrossRefPubMed Arend WP: The balance between IL-1 and IL-1Ra in disease. Cytokine Growth Factor Rev. 2002, 13: 323-340. 10.1016/S1359-6101(02)00020-5.CrossRefPubMed
12.
Zurück zum Zitat di Giovine FS, Takhsh E, Blakemore AI, Duff GW: Single base polymorphism at -511 in the human interleukin-1 beta gene (IL1 beta). Hum Mol Genet. 1992, 1: 450-CrossRefPubMed di Giovine FS, Takhsh E, Blakemore AI, Duff GW: Single base polymorphism at -511 in the human interleukin-1 beta gene (IL1 beta). Hum Mol Genet. 1992, 1: 450-CrossRefPubMed
13.
Zurück zum Zitat McDowell TL, Symons JA, Ploski R, Forre O, Duff GW: A genetic association between juvenile rheumatoid arthritis and a novel interleukin-1 alpha polymorphism. Arthritis Rheum. 1995, 38: 221-228.CrossRefPubMed McDowell TL, Symons JA, Ploski R, Forre O, Duff GW: A genetic association between juvenile rheumatoid arthritis and a novel interleukin-1 alpha polymorphism. Arthritis Rheum. 1995, 38: 221-228.CrossRefPubMed
14.
Zurück zum Zitat Hall SK, Perregaux DG, Gabel CA, Woodworth T, Durham LK, Huizinga TW, Breedveld FC, Seymour AB: Correlation of polymorphic variation in the promoter region of the interleukin-1 beta gene with secretion of interleukin-1 beta protein. Arthritis Rheum. 2004, 50: 1976-1983. 10.1002/art.20310.CrossRefPubMed Hall SK, Perregaux DG, Gabel CA, Woodworth T, Durham LK, Huizinga TW, Breedveld FC, Seymour AB: Correlation of polymorphic variation in the promoter region of the interleukin-1 beta gene with secretion of interleukin-1 beta protein. Arthritis Rheum. 2004, 50: 1976-1983. 10.1002/art.20310.CrossRefPubMed
15.
Zurück zum Zitat Tarlow JK, Blakemore AI, Lennard A, Solari R, Hughes HN, Steinkasserer A, Duff GW: Polymorphism in human IL-1 receptor antagonist gene intron 2 is caused by variable numbers of an 86-bp tandem repeat. Hum Genet. 1993, 91: 403-404. 10.1007/BF00217368.CrossRefPubMed Tarlow JK, Blakemore AI, Lennard A, Solari R, Hughes HN, Steinkasserer A, Duff GW: Polymorphism in human IL-1 receptor antagonist gene intron 2 is caused by variable numbers of an 86-bp tandem repeat. Hum Genet. 1993, 91: 403-404. 10.1007/BF00217368.CrossRefPubMed
16.
Zurück zum Zitat Witkin SS, Gerber S, Ledger WJ: Influence of interleukin-1 receptor antagonist gene polymorphism on disease. Clin Infect Dis. 2002, 34: 204-209. 10.1086/338261.CrossRefPubMed Witkin SS, Gerber S, Ledger WJ: Influence of interleukin-1 receptor antagonist gene polymorphism on disease. Clin Infect Dis. 2002, 34: 204-209. 10.1086/338261.CrossRefPubMed
17.
Zurück zum Zitat Gracie JA, Robertson SE, McInnes IB: Interleukin-18. J Leukoc Biol. 2003, 73: 213-224. 10.1189/jlb.0602313.CrossRefPubMed Gracie JA, Robertson SE, McInnes IB: Interleukin-18. J Leukoc Biol. 2003, 73: 213-224. 10.1189/jlb.0602313.CrossRefPubMed
18.
Zurück zum Zitat Eaton AD, Xu D, Garside P: Administration of exogenous interleukin-18 and interleukin-12 prevents the induction of oral tolerance. Immunology. 2003, 108: 196-203. 10.1046/j.1365-2567.2003.01570.x.CrossRefPubMedPubMedCentral Eaton AD, Xu D, Garside P: Administration of exogenous interleukin-18 and interleukin-12 prevents the induction of oral tolerance. Immunology. 2003, 108: 196-203. 10.1046/j.1365-2567.2003.01570.x.CrossRefPubMedPubMedCentral
19.
Zurück zum Zitat Lettesjo H, Hansson T, Bergqvist A, Gronlund J, Dannaeus A: Enhanced interleukin-18 levels in the peripheral blood of children with coeliac disease. Clin Exp Immunol. 2005, 139: 138-143. 10.1111/j.1365-2249.2005.02661.x.CrossRefPubMedPubMedCentral Lettesjo H, Hansson T, Bergqvist A, Gronlund J, Dannaeus A: Enhanced interleukin-18 levels in the peripheral blood of children with coeliac disease. Clin Exp Immunol. 2005, 139: 138-143. 10.1111/j.1365-2249.2005.02661.x.CrossRefPubMedPubMedCentral
20.
Zurück zum Zitat Tone M, Thompson SA, Tone Y, Fairchild PJ, Waldmann H: Regulation of IL-18 (IFN-gamma-inducing factor) gene expression. J Immunol. 1997, 159: 6156-6163.PubMed Tone M, Thompson SA, Tone Y, Fairchild PJ, Waldmann H: Regulation of IL-18 (IFN-gamma-inducing factor) gene expression. J Immunol. 1997, 159: 6156-6163.PubMed
21.
Zurück zum Zitat Giedraitis V, He B, Huang WX, Hillert J: Cloning and mutation analysis of the human IL-18 promoter: a possible role of polymorphisms in expression regulation. J Neuroimmunol. 2001, 112: 146-152. 10.1016/S0165-5728(00)00407-0.CrossRefPubMed Giedraitis V, He B, Huang WX, Hillert J: Cloning and mutation analysis of the human IL-18 promoter: a possible role of polymorphisms in expression regulation. J Neuroimmunol. 2001, 112: 146-152. 10.1016/S0165-5728(00)00407-0.CrossRefPubMed
22.
Zurück zum Zitat Liu H, Chao D, Nakayama EE, Taguchi H, Goto M, Xin X, Takamatsu JK, Saito H, Ishikawa Y, Akaza T, et al: Polymorphism in RANTES chemokine promoter affects HIV-1 disease progression. Proc Natl Acad Sci U S A. 1999, 96: 4581-4585. 10.1073/pnas.96.8.4581.CrossRefPubMedPubMedCentral Liu H, Chao D, Nakayama EE, Taguchi H, Goto M, Xin X, Takamatsu JK, Saito H, Ishikawa Y, Akaza T, et al: Polymorphism in RANTES chemokine promoter affects HIV-1 disease progression. Proc Natl Acad Sci U S A. 1999, 96: 4581-4585. 10.1073/pnas.96.8.4581.CrossRefPubMedPubMedCentral
23.
Zurück zum Zitat McDermott DH, Beecroft MJ, Kleeberger CA, Al-Sharif FM, Ollier WE, Zimmerman PA, Boatin BA, Leitman SF, Detels R, Hajeer AH, et al: Chemokine RANTES promoter polymorphism affects risk of both HIV infection and disease progression in the Multicenter AIDS Cohort Study. Aids. 2000, 14: 2671-2678. 10.1097/00002030-200012010-00006.CrossRefPubMed McDermott DH, Beecroft MJ, Kleeberger CA, Al-Sharif FM, Ollier WE, Zimmerman PA, Boatin BA, Leitman SF, Detels R, Hajeer AH, et al: Chemokine RANTES promoter polymorphism affects risk of both HIV infection and disease progression in the Multicenter AIDS Cohort Study. Aids. 2000, 14: 2671-2678. 10.1097/00002030-200012010-00006.CrossRefPubMed
24.
Zurück zum Zitat Rovin BH, Lu L, Saxena R: A novel polymorphism in the MCP-1 gene regulatory region that influences MCP-1 expression. Biochem Biophys Res Commun. 1999, 259: 344-348. 10.1006/bbrc.1999.0796.CrossRefPubMed Rovin BH, Lu L, Saxena R: A novel polymorphism in the MCP-1 gene regulatory region that influences MCP-1 expression. Biochem Biophys Res Commun. 1999, 259: 344-348. 10.1006/bbrc.1999.0796.CrossRefPubMed
25.
Zurück zum Zitat Revised criteria for diagnosis of coeliac disease. Report of Working Group of European Society of Paediatric Gastroenterology and Nutrition. Arch Dis Child. 1990, 65: 909-11. Revised criteria for diagnosis of coeliac disease. Report of Working Group of European Society of Paediatric Gastroenterology and Nutrition. Arch Dis Child. 1990, 65: 909-11.
26.
Zurück zum Zitat Craggs A, West S, Curtis A, Welfare M, Hudson M, Donaldson P, Mansfield J: Absence of a genetic association between IL-1RN and IL-1B gene polymorphisms in ulcerative colitis and Crohn disease in multiple populations from northeast England. Scand J Gastroenterol. 2001, 36: 1173-1178. 10.1080/00365520152584806.CrossRefPubMed Craggs A, West S, Curtis A, Welfare M, Hudson M, Donaldson P, Mansfield J: Absence of a genetic association between IL-1RN and IL-1B gene polymorphisms in ulcerative colitis and Crohn disease in multiple populations from northeast England. Scand J Gastroenterol. 2001, 36: 1173-1178. 10.1080/00365520152584806.CrossRefPubMed
28.
Zurück zum Zitat Gauderman WJ: Candidate gene association analysis for a quantitative trait, using parent-offspring trios. Genet Epidemiol. 2003, 25: 327-338. 10.1002/gepi.10262.CrossRefPubMed Gauderman WJ: Candidate gene association analysis for a quantitative trait, using parent-offspring trios. Genet Epidemiol. 2003, 25: 327-338. 10.1002/gepi.10262.CrossRefPubMed
29.
Zurück zum Zitat al Sharif F, Ollier WE, Hajeer AH: A rare polymorphism at position -28 in the human RANTES promoter. Eur J Immunogenet. 1999, 26: 373-374. 10.1046/j.1365-2370.1999.00162.x.CrossRefPubMed al Sharif F, Ollier WE, Hajeer AH: A rare polymorphism at position -28 in the human RANTES promoter. Eur J Immunogenet. 1999, 26: 373-374. 10.1046/j.1365-2370.1999.00162.x.CrossRefPubMed
30.
Zurück zum Zitat Hajeer AH, al Sharif F, Ollier WE: A polymorphism at position -403 in the human RANTES promoter. Eur J Immunogenet. 1999, 26: 375-376. 10.1046/j.1365-2370.1999.00163.x.CrossRefPubMed Hajeer AH, al Sharif F, Ollier WE: A polymorphism at position -403 in the human RANTES promoter. Eur J Immunogenet. 1999, 26: 375-376. 10.1046/j.1365-2370.1999.00163.x.CrossRefPubMed
31.
Zurück zum Zitat Parks CG, Cooper GS, Dooley MA, Treadwell EL, St Clair EW, Gilkeson GS, Pandey JP: Systemic lupus erythematosus and genetic variation in the interleukin 1 gene cluster: a population based study in the southeastern United States. Ann Rheum Dis. 2004, 63: 91-94. 10.1136/ard.2003.007336.CrossRefPubMedPubMedCentral Parks CG, Cooper GS, Dooley MA, Treadwell EL, St Clair EW, Gilkeson GS, Pandey JP: Systemic lupus erythematosus and genetic variation in the interleukin 1 gene cluster: a population based study in the southeastern United States. Ann Rheum Dis. 2004, 63: 91-94. 10.1136/ard.2003.007336.CrossRefPubMedPubMedCentral
32.
Zurück zum Zitat Timms AE, Crane AM, Sims AM, Cordell HJ, Bradbury LA, Abbott A, Coyne MR, Beynon O, Herzberg I, Duff GW, et al: The interleukin 1 gene cluster contains a major susceptibility locus for ankylosing spondylitis. Am J Hum Genet. 2004, 75: 587-595. 10.1086/424695.CrossRefPubMedPubMedCentral Timms AE, Crane AM, Sims AM, Cordell HJ, Bradbury LA, Abbott A, Coyne MR, Beynon O, Herzberg I, Duff GW, et al: The interleukin 1 gene cluster contains a major susceptibility locus for ankylosing spondylitis. Am J Hum Genet. 2004, 75: 587-595. 10.1086/424695.CrossRefPubMedPubMedCentral
33.
Zurück zum Zitat Mann CL, Davies MB, Stevenson VL, Leary SM, Boggild MD, Ko Ko C, Jones PW, Fryer AA, Strange RC, Thompson AJ, et al: Interleukin 1 genotypes in multiple sclerosis and relationship to disease severity. J Neuroimmunol. 2002, 129: 197-204. 10.1016/S0165-5728(02)00181-9.CrossRefPubMed Mann CL, Davies MB, Stevenson VL, Leary SM, Boggild MD, Ko Ko C, Jones PW, Fryer AA, Strange RC, Thompson AJ, et al: Interleukin 1 genotypes in multiple sclerosis and relationship to disease severity. J Neuroimmunol. 2002, 129: 197-204. 10.1016/S0165-5728(02)00181-9.CrossRefPubMed
34.
Zurück zum Zitat Kaijzel EL, van Dongen H, Bakker AM, Breedveld FC, Huizinga TW, Verweij CL: Relationship of polymorphisms of the Interleukin-1 gene cluster to occurrence and severity of rheumatoid arthritis. Tissue Antigens. 2002, 59: 122-126. 10.1034/j.1399-0039.2002.590208.x.CrossRefPubMed Kaijzel EL, van Dongen H, Bakker AM, Breedveld FC, Huizinga TW, Verweij CL: Relationship of polymorphisms of the Interleukin-1 gene cluster to occurrence and severity of rheumatoid arthritis. Tissue Antigens. 2002, 59: 122-126. 10.1034/j.1399-0039.2002.590208.x.CrossRefPubMed
35.
Zurück zum Zitat Ide A, Kawasaki E, Abiru N, Sun F, Fukushima T, Ishii R, Takahashi R, Kuwahara H, Fujita N, Kita A, et al: Association of interleukin-18 gene promoter polymorphisms in type 1 diabetes and autoimmune thyroid disease. Ann N Y Acad Sci. 2003, 1005: 436-439. 10.1196/annals.1288.074.CrossRefPubMed Ide A, Kawasaki E, Abiru N, Sun F, Fukushima T, Ishii R, Takahashi R, Kuwahara H, Fujita N, Kita A, et al: Association of interleukin-18 gene promoter polymorphisms in type 1 diabetes and autoimmune thyroid disease. Ann N Y Acad Sci. 2003, 1005: 436-439. 10.1196/annals.1288.074.CrossRefPubMed
36.
Zurück zum Zitat Novota P, Kolostova K, Pinterova D, Novak J, Treslova L, Andel M, Cerna M: Interleukin IL-18 gene promoter polymorphisms in adult patients with type 1 diabetes mellitus and latent autoimmune diabetes in adults. Immunol Lett. 2005, 96: 247-251. 10.1016/j.imlet.2004.08.016.CrossRefPubMed Novota P, Kolostova K, Pinterova D, Novak J, Treslova L, Andel M, Cerna M: Interleukin IL-18 gene promoter polymorphisms in adult patients with type 1 diabetes mellitus and latent autoimmune diabetes in adults. Immunol Lett. 2005, 96: 247-251. 10.1016/j.imlet.2004.08.016.CrossRefPubMed
37.
Zurück zum Zitat Nakajima K, Tanaka Y, Nomiyama T, Ogihara T, Ikeda F, Kanno R, Iwashita N, Sakai K, Watada H, Onuma T, et al: RANTES promoter genotype is associated with diabetic nephropathy in type 2 diabetic subjects. Diabetes Care. 2003, 26: 892-898.CrossRefPubMed Nakajima K, Tanaka Y, Nomiyama T, Ogihara T, Ikeda F, Kanno R, Iwashita N, Sakai K, Watada H, Onuma T, et al: RANTES promoter genotype is associated with diabetic nephropathy in type 2 diabetic subjects. Diabetes Care. 2003, 26: 892-898.CrossRefPubMed
38.
Zurück zum Zitat Liao CH, Yao TC, Chung HT, See LC, Kuo ML, Huang JL: Polymorphisms in the promoter region of RANTES and the regulatory region of monocyte chemoattractant protein-1 among Chinese children with systemic lupus erythematosus. J Rheumatol. 2004, 31: 2062-2067.PubMed Liao CH, Yao TC, Chung HT, See LC, Kuo ML, Huang JL: Polymorphisms in the promoter region of RANTES and the regulatory region of monocyte chemoattractant protein-1 among Chinese children with systemic lupus erythematosus. J Rheumatol. 2004, 31: 2062-2067.PubMed
39.
Zurück zum Zitat Tucci M, Barnes EV, Sobel ES, Croker BP, Segal MS, Reeves WH, Richards HB: Strong association of a functional polymorphism in the monocyte chemoattractant protein 1 promoter gene with lupus nephritis. Arthritis Rheum. 2004, 50: 1842-1849. 10.1002/art.20266.CrossRefPubMed Tucci M, Barnes EV, Sobel ES, Croker BP, Segal MS, Reeves WH, Richards HB: Strong association of a functional polymorphism in the monocyte chemoattractant protein 1 promoter gene with lupus nephritis. Arthritis Rheum. 2004, 50: 1842-1849. 10.1002/art.20266.CrossRefPubMed
40.
Zurück zum Zitat Kim HL, Lee DS, Yang SH, Lim CS, Chung JH, Kim S, Lee JS, Kim YS: The polymorphism of monocyte chemoattractant protein-1 is associated with the renal disease of SLE. Am J Kidney Dis. 2002, 40: 1146-1152. 10.1053/ajkd.2002.36858.CrossRefPubMed Kim HL, Lee DS, Yang SH, Lim CS, Chung JH, Kim S, Lee JS, Kim YS: The polymorphism of monocyte chemoattractant protein-1 is associated with the renal disease of SLE. Am J Kidney Dis. 2002, 40: 1146-1152. 10.1053/ajkd.2002.36858.CrossRefPubMed
41.
Zurück zum Zitat Gade-Andavolu R, Comings DE, MacMurray J, Vuthoori RK, Tourtellotte WW, Nagra RM, Cone LA: RANTES: a genetic risk marker for multiple sclerosis. Mult Scler. 2004, 10: 536-539. 10.1191/1352458504ms1080oa.CrossRefPubMed Gade-Andavolu R, Comings DE, MacMurray J, Vuthoori RK, Tourtellotte WW, Nagra RM, Cone LA: RANTES: a genetic risk marker for multiple sclerosis. Mult Scler. 2004, 10: 536-539. 10.1191/1352458504ms1080oa.CrossRefPubMed
42.
Zurück zum Zitat Makki RF, al Sharif F, Gonzalez-Gay MA, Garcia-Porrua C, Ollier WE, Hajeer AH: RANTES gene polymorphism in polymyalgia rheumatica, giant cell arteritis and rheumatoid arthritis. Clin Exp Rheumatol. 2000, 18: 391-393.PubMed Makki RF, al Sharif F, Gonzalez-Gay MA, Garcia-Porrua C, Ollier WE, Hajeer AH: RANTES gene polymorphism in polymyalgia rheumatica, giant cell arteritis and rheumatoid arthritis. Clin Exp Rheumatol. 2000, 18: 391-393.PubMed
43.
Zurück zum Zitat Nilsen EM, Jahnsen FL, Lundin KE, Johansen FE, Fausa O, Sollid LM, Jahnsen J, Scott H, Brandtzaeg P: Gluten induces an intestinal cytokine response strongly dominated by interferon gamma in patients with celiac disease. Gastroenterology. 1998, 115: 551-563.CrossRefPubMed Nilsen EM, Jahnsen FL, Lundin KE, Johansen FE, Fausa O, Sollid LM, Jahnsen J, Scott H, Brandtzaeg P: Gluten induces an intestinal cytokine response strongly dominated by interferon gamma in patients with celiac disease. Gastroenterology. 1998, 115: 551-563.CrossRefPubMed
44.
Zurück zum Zitat Rueda B, Martinez A, Lopez-Nevot MA, Mas-Fontao A, Paco L, Ortega E, Fernandez-Arquero M, Urcelay E, Gomez de la Concha E, Martin J: A functional variant of IFNgamma gene is associated with coeliac disease. Genes Immun. 2004, 5: 517-519. 10.1038/sj.gene.6364115.CrossRefPubMed Rueda B, Martinez A, Lopez-Nevot MA, Mas-Fontao A, Paco L, Ortega E, Fernandez-Arquero M, Urcelay E, Gomez de la Concha E, Martin J: A functional variant of IFNgamma gene is associated with coeliac disease. Genes Immun. 2004, 5: 517-519. 10.1038/sj.gene.6364115.CrossRefPubMed
45.
Zurück zum Zitat Louka AS, Torinsson Naluai A, D'Alfonso S, Ascher H, Coto I, Ek J, Giordano M, Gudjonsdottir AH, Mellai M, Momigliano-Richiardi P, et al: The IL12B gene does not confer susceptibility to coeliac disease. Tissue Antigens. 2002, 59: 70-72. 10.1034/j.1399-0039.2002.590117.x.CrossRefPubMed Louka AS, Torinsson Naluai A, D'Alfonso S, Ascher H, Coto I, Ek J, Giordano M, Gudjonsdottir AH, Mellai M, Momigliano-Richiardi P, et al: The IL12B gene does not confer susceptibility to coeliac disease. Tissue Antigens. 2002, 59: 70-72. 10.1034/j.1399-0039.2002.590117.x.CrossRefPubMed
46.
Zurück zum Zitat Seegers D, Borm ME, van Belzen MJ, Mulder CJ, Bailing J, Crusius JB, Meijer JW, Wijmenga C, Pena AS, Bouma G: IL12B and IRF1 gene polymorphisms and susceptibility to celiac disease. Eur J Immunogenet. 2003, 30: 421-425. 10.1111/j.1365-2370.2003.00428.x.CrossRefPubMed Seegers D, Borm ME, van Belzen MJ, Mulder CJ, Bailing J, Crusius JB, Meijer JW, Wijmenga C, Pena AS, Bouma G: IL12B and IRF1 gene polymorphisms and susceptibility to celiac disease. Eur J Immunogenet. 2003, 30: 421-425. 10.1111/j.1365-2370.2003.00428.x.CrossRefPubMed
47.
Zurück zum Zitat de la Concha EG, Fernandez-Arquero M, Vigil P, Rubio A, Maluenda C, Polanco I, Fernandez C, Figueredo MA: Celiac disease and TNF promoter polymorphisms. Hum Immunol. 2000, 61: 513-517. 10.1016/S0198-8859(99)00187-1.CrossRefPubMed de la Concha EG, Fernandez-Arquero M, Vigil P, Rubio A, Maluenda C, Polanco I, Fernandez C, Figueredo MA: Celiac disease and TNF promoter polymorphisms. Hum Immunol. 2000, 61: 513-517. 10.1016/S0198-8859(99)00187-1.CrossRefPubMed
48.
Zurück zum Zitat Woolley N, Mustalahti K, Maki M, Partanen J: Cytokine gene polymorphisms and genetic association with coeliac disease in the Finnish population. Scand J Immunol. 2005, 61: 51-56. 10.1111/j.0300-9475.2005.01525.x.CrossRefPubMed Woolley N, Mustalahti K, Maki M, Partanen J: Cytokine gene polymorphisms and genetic association with coeliac disease in the Finnish population. Scand J Immunol. 2005, 61: 51-56. 10.1111/j.0300-9475.2005.01525.x.CrossRefPubMed
Metadaten
Titel
Association study of functional genetic variants of innate immunity related genes in celiac disease
verfasst von
B Rueda
A Zhernakova
MA López-Nevot
J Martín
BPC Koeleman
Publikationsdatum
01.12.2005
Verlag
BioMed Central
Erschienen in
BMC Medical Genetics / Ausgabe 1/2005
Elektronische ISSN: 1471-2350
DOI
https://doi.org/10.1186/1471-2350-6-29

Weitere Artikel der Ausgabe 1/2005

BMC Medical Genetics 1/2005 Zur Ausgabe