Biological properties of Ceraputty as a retrograde filling material: an in vitro study on hPDLSCs

The protocol to obtain human PDLSCs (hPDLSCs) was approved by the Ethics Committee of University of Murcia (Murcia, Spain; IRB number 2199/2018). Written informed consent was obtained from healthy donors (n = 10, 18–23-years old), who provided molars (n = 10) from which to isolate hPDLSCs and agreed to their use in this study. The sample size was calculated using openepi software (www.​openepi.​com), with a confidence interval of 95% and a power of 80%, and was based on the methodology of a previous similar study [21]. Patient data and images that could be used to identify the study participants were not included in this work. Periodontal tissues were aseptically removed and immersed for incubation in 0.25% trypsin in 4 mL of EDTA (Life Technologies, USA) for 30 min at 37 °C. After neutralizing them with 4 mL of medium, the cells were detached by pipetting the solution, and then they were filtered via a strainer (70 μm, Corning, USA). The hPDLSCs were cultured in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum, penicillin (100 U/mL), and streptomycin (100 μg/mL) (Gibco, Life Technologies) supplemented with 100 mM ascorbic acid (Sigma) in a 37 °C incubator with 5% CO2 (Thermo Forma 3110, Thermo Fisher, USA).

Previously characterized hPDLSCs were used for the subsequent biological assays. The characterization process followed the International Society of Cellular Therapy (ISCT) guidelines, as follows: The overexpression of mesenchymal stem cell (MSC)-specific surface markers and the low rexpression of hematopoyetic markers were confirmed via flow cytometry (FACSCalibur Flow Cytometry System; BD Biosciences). The selection of markers was performed based on previous similar studies [22, 23]. Lastly, the trilineage mesenchymal differentiation potential was confirmed via their culture in osteogenic, chondrogenic, and adipogenic media (Miltenyi Biotec). hPDLSCs of passages 3 to 5 were used in this study.

Biodentine, Ceraputty, and Endosequence root repair material were tested in this study (Table 1). Cylindrical rubber molds (n = 30) were prepared with a diameter of 5 mm and height of 2 mm and were disinfected by exposure to UV light for 30 min. The number of discs was based on the protocol from a previous study with similar methodology [24]. CSMs were mixed according to their respective manufacturer’s instructions and allowed to set for 24 h. Each disc was placed in a separate well from a 24-well plate and immersed in a fresh growth medium for 24 h at 37 °C. The extraction was performed in accordance with ISO 10993–5 [25]. Thereafter, to study the effect of the concentration of each material on their biological properties, various dilutions (1:1, 1:2 and 1:4 v/v) of these extraction media were prepared using fresh complete DMEM [24]. The following in vitro biological assays were performed by a single operator.

The cytotoxicity of the three CSM eluates was evaluated using an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay, as previously reported by similar studies [26]. For this purpose, 4 × 10³ cells were seeded into 96-well culture plates. After 1, 2, and 3 days of culture with the material eluates, an MTT reagent (Sigma Aldrich) was added for 4 h, following its manufacturer’s instructions. When a purple precipitate was detectable, dimethylsulfoxide (DMSO) (Sigma-Aldrich) was added to each well (100 μl/well), and plates were covered and kept in dark conditions for 4 h to solubilize the formazan crystals produced by viable cells, after reducing the MTT reagent. Finally, absorbance was measured at 570-nm wavelength using a microplate reader (Synergy H1, BioTek,Winooski, VT, USA).

hPDLSCs (5 × 10³ cells/well) were cultured on disinfected tested material disks in 48-well plates and incubated at 37 °C for attachment in a 5% CO₂ incubator during 72 h. The cements with the hPDLSCs were washed with PBS thrice and were exposed to 4% glutaraldehyde (Sigma-Aldrich) solution for fixation. Then, the samples were washed with PBS thrice and serially dehydrated with ethanol and treated with hexamethyldisilazane (Sigma-Aldrich) for 5 min. The dehydrated samples were coated with gold and palladium and examined via SEM (Jeol 6100 EDAX; Jeol Inc.) at 100 × , 300 × , and 1500 × magnifications. In addition, the superficial chemical composition, and morphological properties of CSMs were assessed by energy-dispersive X-ray spectroscopy (EDX).

To determine mRNA transcript levels of differentiation and mineralization markers, hPDLSCs were cultured 21 days in undiluted (1:1) conditioned media from the three CSMs, in unconditioned culture media (negative control groups), or in osteogenic differentiation media (positive control; OsteoDiff media; Miltenyi Biotec). Culture media with fresh eluates from the respective groups were replaced every 3 days as previously reported by our research group [24].

The primer sequences for the differentiation markers used for the assay were as follows (5′–3′): Cementum attachment protein or CAP (forward: TTTTTCTGGTCGCGTGGACT, reverse: TCACCAGCAACTCCAACAGG), cementum protein 1 or CEMP1 (forward: GGGCACATCAAGCACTGACAG, reverse: CCCTTAGGAAGTGGCTGTCCAG), alkaline phosphatase or ALP (forward: TCAGAAGCTCAACACCAACG, reverse: TTGTACGTCTTGGAGAGGGC), runt-related transcription factor 2 or RUNX2 (forward: TCCAC ACCATTAGGGACCATC, reverse: TGCTAATGCTTCGT GTTTCCA), bone sialoprotein or BSP (forward: TGCC TTGAGCCTGCTTCCT, reverse: CTGAGCAAAATTAA AGCAGTCTTCA), amelogenin X, or AMELX (forward: CACCCTGCAGCCTCATCACC, reverse: GTGTT GGATTGGAGTCATGG).

Differentiation marker expression was measured relative to the expression of the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH), with the following sequence (5′-3′): (forward: TCAGCAATGCCTCCTGCAC, reverse: TCTGGG TGGCAGTGATGG). To calculate the relative gene expression, the standardized 2 − ΔΔCT method was used [27].

Mineralization or calcification ability of the tested CSMs on hPDLSCs were evaluated by Alizarin Red S staining after 21 days of culturing with undiluted (1:1) cement-conditioned medium, as follows: (A) control (DMEM), (B) Osteodiff, (C) Ceraputty, (D) ERRM, and (E) Biodentine. After the culture period, the samples were rinsed with fetal bovine serum and fixed with 70% ethanol for 1 h. Then, samples were stained with 2% Alizarin Red solution (Sigma Aldrich) for 30 min in controlled conditions (dark ambient and room temperature) and solubilized using 10% cetylpyridinium chloride monohydrate solution (Sigma-Aldrich). Finally, Synergy H1 multi-mode microplate reader (BioTek, Winooski, VT, USA) was used to measure the absorbance values of the samples at 570 nm. The methodology for Alizarin Red S staining assay was based on a previous similar study [21].

All assays which were statistically assessed were performed three times. For quantification, data were calculated as means and standard deviations (SDs). The normality in the distribution of the data was previously confirmed via a Q-Q plot. Statistical significance was tested using one way ANOVA (MTT assay) or two-way ANOVA (ARS assay; RT-qPCR assay) and Tukey’s post hoc test using Graph-Pad Prism v8.1.0 (GraphPad Software). Each dilution was considered an independent treatment. Here, * indicates a P value below 0.05, ** indicates a P value below 0.01, and *** indicates a P value below 0.001.

The MTT assay revealed an adequate cell viability from all hPDLSCs cultured with 1:2 and 1:4 eluates of Biodentine and ERRM at all the tested time points (24, 48, and 72 h of culture), similar to that of the control group. Undiluted Biodentine and ERRM-treated cells, however, showed slight decreases in viability compared with the control group (p < 0.05 and p < 0.001, respectively). Ceraputty-treated cells exhibited a moderately lower viability compared with the untreated group (control) after all time-points (p < 0.001; Fig. 1A).

hPDLSCs seeded on Biodentine and ERRM showed a better cell adhesion process in terms of substrate attachment, spreading, and cytoskeleton development on the niche-like structures of the cement than Ceraputty, which evidenced a moderate quantity of cells and less cytoplasmatic interaction between cells (Fig. 1B).

The EDX analysis provided the qualitative and semi-quantitative superficial elemental composition of each cement, which are represented in Fig. 2. SEM micrographs evidenced that the particle sizes and shapes differed between the tested materials. Ceraputty exhibited a large number of petal-like crystallized structures whereas the particle size and shape were more homogeneous in Biodentine. Peaks of Zr were detected in both ERRM and Ceraputty with similar percentages. With regards to Ca²⁺, Biodentine contained a higher percentage of Ca²⁺ compared with ERRM and Ceraputty. On the other hand, the percentage of Si in ERRM was higher compared with Biodentine.

The evaluation of the differentiation ability of the hPDLSCs cultured with the cement eluates were performed using RT-qPCR (Fig. 3). ALP expression decreased in hPDLSCs exposed to the tested materials and Osteodiff group (negative control) for 21 days, probably related to the early expression of osteoblastic differentiation. On the other hand, the expression of the genes CEMP, BSP, AMELX, and AMBN induced by Biodentine was significantly higher than the other groups (***p < 0.001). hPDLSCs exposed to Biodentine and ERRM produced a few folds more of CAP and RUNX2 genes than the other groups. Finally, the expression of ON, was also highly expressed in hPDLSCs exposed to ERRM (**p < 0.01) compared to the untreated group. Ceraputty, on the other hand, did not show a significant upregulation of any of the tested markers.

Alizarin Red S Staining (ARS) serves as a marker of mineralization and osteo/cementogenesis by detecting the formation of calcified nodules. As shown in Fig. 4, more pronounced calcium deposits were observed in the tested groups compared with the control and Osteodiff groups (***p < 0.001). Meanwhile, the results showed deeper staining with undiluted concentrations of Biodentine (***p < 0.001). These data suggest that Biodentine could significantly promote the osteo/cementogenic differentiation of hPDLSCs.