Small nucleolar RNAs (snoRNAs) are dysregulated in many cancers, although their exact role in tumor genesis and progression remains unclear.
Methods
The expression profiles of snoRNAs in endometrial cancer (EC) tissues were analyzed using data from The Cancer Genome Atlas, and SNORD104 was identified as an upregulated snoRNA in EC. The tumorigenic role of SNORD104 in EC was established in CCK8, colony formation, EdU, apoptosis, Transwell, and in vivo xenograft experiments. The molecular mechanisms of SNORD104 were analyzed by RNA immunoprecipitation (RIP), Nm-seq, RTL-P assay, RNA stability assay, qRT-PCR, and western blotting.
Results
Antisense oligonucleotide (ASO)-mediated knockdown of SNORD104 in Ishikawa cells significantly inhibited their proliferation, colony formation ability, migration, and invasion in vitro and increased apoptosis. On the other hand, overexpression of SNORD104 promoted EC growth in vivo and in vitro. RIP assay showed that SNORD104 binds to the 2ʹ-O-methyltransferase fibrillarin (FBL), and according to the results of Nm-seq and RTL-P assay, SNORD104 upregulated PARP1 (encoding poly (ADP-ribose) polymerase 1) 2ʹ-O-methylation. The binding of FBL to PARP1 mRNA was also verified by RIP assay. Furthermore, SNORD104 expression was positively correlated with PARP1 expression in EC tissues. In the presence of actinomycin D, SNORD104 increased the stability of PARP1 mRNA and promoted its nuclear localization. Finally, silencing FBL or PARP1 in the HEC1B cells overexpressing SNORD104 inhibited their proliferative and clonal capacities and increased apoptosis rates.
Conclusions
SNORD104 enhances PARP1 mRNA stability and translation in the EC cells by upregulating 2ʹ-O-methylation and promotes tumor growth.
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Introduction
Endometrial cancer (EC) is one of the most common malignancies in menopausal and postmenopausal women in developed countries, and its incidence is increasing worldwide [1, 2]. Although surgery, chemotherapy, and radiotherapy have achieved satisfactory outcomes, the survival rate of EC patients is still dismal due to the tendency of the tumor cells to relapse and metastasize [3]. Therefore, it is crucial to elucidate the molecular mechanisms underlying the initiation, progression, and metastasis of EC in order to identify potential therapeutic targets for personalized treatment. Small nucleolar RNAs (snoRNAs) are a class of small non-coding RNAs (ncRNAs) with conserved structural elements that are widely distributed in the nucleolus of eukaryotic cells and broadly classified into the C/D box snoRNAs (SNORDs) and H/ACA box snoRNAs [4]. They are usually encoded by intron regions of coding genes or non-coding genes and are complicated by the transcription and processing of host genes, with only a few being encoded by independent genomic locations [5]. The snoRNAs were long considered to be involved in the nucleolar function. Recent studies show that snoRNAs mediate 2ʹ-O-methylation and pseudouridylation of rRNA, tRNA, mRNA, snRNA, and other RNAs via complementary base pairing and also regulate gene expression by forming snoRNP complexes with ribonucleolar proteins (RNPs) [6, 7]. We identified the snoRNAs potentially related to the development of EC by screening the transcriptomic data of The Cancer Genome Atlas (TCGA) database. SNORD104 (located at 17q23.3, also known as U104) was significantly upregulated in the EC tissues, although its role in cancer, particularly EC, remains unclear.
Fibrillarin (FBL) is a component of the small nucleolar ribonucleoprotein (snRNP) (including FBL, NOP56, NOP58) that contains N-terminal repeat domains rich in glycine and arginine residues, similar to the FBLs in other species. The central region of FBL resembles an RNA binding domain and contains a common RNP sequence [8]. FBL is a key 2ʹ-O-ribose methylase that catalyzes SNORD-dependent methylation of target RNAs [9]. However, whether FBL-catalyzed 2ʹ-O-methylation plays an important role in EC remains unknown. In this study, we evaluated the oncogenic effects of SNORD104 in EC through established in vitro and in vivo experiments, and explored the molecular mechanisms by 2ʹ-O-methylation sequencing (Nm-seq) and RNA immunoprecipitation.
Anzeige
Methods
Human tissue samples
Tumor tissue samples were collected from 71 treatment-naïve EC patients who underwent surgery at the Third Affiliated Hospital of Guangzhou Medical University. The samples were snap frozen in liquid nitrogen immediately after resection and stored at − 80 °C. The study protocol was approved by the ethics committee of the hospital, and all patients provided written informed consent.
Cell culture and transfection
Human EC cell lines (Ishikawa, HEC1A, HEC1B, and KLE) and immortalized endometrial cells (EEC) were purchased from ATCC (Manassas, VA, USA) or Jennio Biotech (Guangzhou, China). HEC1B cells were cultured in DMEM (HyClone, Logan, UT, USA), HEC1A and Ishikawa cells in RPMI-1640 medium (HyClone), and the KLE cells in DMEM-F12 (HyClone). All media were supplemented with 10% fetal bovine serum (FBS; Gibco, Grand Island, NY, USA) and 100 U/ml penicillin and streptomycin (Gibco). The cell lines were incubated at 37 °C under 5% CO2. As per the experimental requirements, the cells were transfected with SNORD104 ASO (TCTTTCTCGTAAATGCTGAG), si-FBL (GGGCTAAGGTTCTCTACCT), or si-PARP1 (CACGGACTCTCTACCGTAT) using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The oligonucleotides were synthesized by RIBOBIO (Guangzhou, China).
The cells were seeded in a 96-well plate at the density of 2000 cells/100 μl per well and transfected with the respective constructs. The CCK8 reagent (Yeasen Biotechnology, Shanghai, China) was added to the cells at 0, 24, 48, and 72 h, and the absorbance of each well was measured at 450 nm using a microplate reader (BioTek, Winooski, VT, USA). The experiment was repeated thrice.
Anzeige
Colony formation assay
The cells were seeded in a 6-well plate at the density of 500 cells/2 ml per well and transfected with the respective constructs once they adhered. After culturing for 7–10 days, the colonies were fixed using formaldehyde for 15 min, washed thrice with PBS, and stained with crystal violet for 10 min. The plates were rinsed with tap water to remove the excess dye and dried, and the number of colonies was counted.
EdU assay
The Ishikawa/HEC1B cells were seeded in 96-well plates, and EdU solution (Thermo Scientific, USA) was added. The cells were incubated for 16 h, and the subsequent steps were followed as per the manufacturer's instructions. The stained cells were observed under a microscope (Olympus, Tokyo, Japan).
Apoptosis assay
Apoptosis was detected by propidium iodide (PI) and fluorescein isothiocyanate (FITC)-Annexin V (BD Pharmingen, San Diego, CA, USA) staining according to the manufacturer's instructions. Briefly, the cells were harvested 48 h after transfection and washed twice with cold PBS. The suspension was stained with 100 μl 1 × buffer and 5 μl FITC-Annexin V and PI in the dark for 15 min. The reaction was terminated by adding 400 μl 1 × buffer, and the cells were analyzed by flow cytometry within 1 h.
Quantitative real‐time reverse transcription PCR
Total RNA was extracted from EC cell lines or tissues using TRIzol reagent (1 ml; Takara, Shiga, Japan) and reverse transcribed to cDNA. Quantitative real-time PCR was performed using the SYBR PreMix Ex TAQ II kit (Takara). The primer sequences were as follows: U6: forward: 5ʹ CTCGCTTCGGCAGCACA 3ʹ; reverse: 5ʹ AACGCTTCACGAATTTGCGT 3ʹ; GAPDH: forward: 5ʹ CCCATCACCATCTTCCAGGAG 3ʹ; reverse: 5ʹ GTTGTCATGGATGACCTTGGC 3ʹ; SNORD104: forward: 5ʹ CATTCCAATTAAAGCACG 3ʹ; reverse: 5ʹ CAGACTCCAGTTCGCATC 3ʹ; PARP1: forward: 5ʹ CGGAACAAGGATGAAGTGAA 3ʹ; reverse: 5ʹ TTGGTGGAGGCGGAGA 3ʹ; PARP4: forward: 5ʹ TAGCCTGGTCATTTGGT 3ʹ; reverse: 5ʹ AGATGGCATTCTTCACG 3ʹ; 18S: forward: 5ʹ GAAACGGCTACCACATCC 3ʹ; reverse: 5ʹ ACCAGACTTGCCCTCCA 3ʹ; ITPR3: forward: 5ʹ CCAAGCAGACTAAGCAGGACA 3ʹ; reverse: 5ʹ ACACTGCCATACTTCACGACA 3ʹ; LMNB1: forward: 5ʹ AAGCATGAAACGCGCTTGG 3ʹ; reverse: 5ʹ AGTTTGGCATGGTAAGTCTGC 3ʹ; TUBA1C: forward: 5ʹ TGTTTGTAGACTTGGAACCCAC 3ʹ; reverse: 5ʹ GCCAATGGTGTAGTGCCCT 3ʹ.
Western blotting
Total protein was extracted from cultured cells or tissues using radioimmunoprecipitation assay (RIPA) buffer containing protease inhibitors and quantified using the BCA Protein Assay Kit (Beyotime, China). The protein samples were diluted with the appropriate amount of loading buffer and PBS to 2 μg/l, and denatured by heating at 95 °C for 15 min. The samples were resolved by 10% or 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene fluoride (PVDF) membranes (Amersham, Munich, Germany). Following overnight incubation with rabbit anti-FBL (1:2000 Magna, Proteintech, Rosemont, IL, USA), rabbit anti-PARP1 (1:2000 Magneto, Proteintech), rabbit anti-PARP4 (1:2000, Bioss, Woburn, MA, USA), anti-ITPR3 (1:2000, LSBio), anti-LMNB1 (1:10,000, Proteintech), anti-Vinculin (1:10,000, Proteintech), anti-GAPDH (1:5000, Proteintech) and anti-α-tubulin (TUBA1B/1C) (1:2000, Proteintech) antibodies at 4 ℃, the membranes were washed thrice with 1% Tris-buffered saline-Tween20 (TBST) buffer for 10 min each time. The membranes were then incubated with the secondary antibody for 2 h, and washed again with 1% TBST buffer for 10 min. The bands were visualized using an enhanced chemiluminescence system (NCM Biotech, Suzhou, China), and the protein levels were quantified using grayscale values.
RNA immunoprecipitation (RIP) assay
RIP assay was performed using the Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore, Bedford, MA, USA) as per the manufacturer's instructions. Cells growing at 80–90% confluence were harvested and lysed using RIPA lysis buffer. The cell extracts were incubated with magnetic beads with anti-mouse FBL (Santa Cruz Biotechnology, Santa Cruz, CA, USA) or normal mouse IgG (negative control) in the RIPA lysis buffer. After digesting the protein using protease K, the immunoprecipitated RNA was isolated and analyzed using qRT-PCR.
Nm-seq analysis
Nm-sequencing was performed by the Shanghai Cloud-seq Biotech Co. Ltd. as previously described [12] using the Illumina NovaSeq 6000 sequencer.
Reverse transcription at low dNTPs-PCR (RTL-P) assay
RTL-P assay was performed to detect the 2′-O-methylation level (Nm) of PARP1 according to published methods [13, 14]. Briefly, 5 μg total RNA was incubated with low (1 μM) or high (1 mM) concentration of dNTPs (Takara) and 1 μl specific RT primers at 65 °C for 5 min and then placed on ice. The reaction was performed using 4 μl M-MLV RT 5 × buffer (PROMEGA), 1 μl 200 U/μl M-MLV Reverse Transcriptase (PROMEGA), 1 μl 0.1 M DTT (PROMEGA), and 1 μl 40 U/μl RNase inhibitor (PROMEGA) at 50 °C for 1 h, and then at 70 °C for 15 min. QRT-PCR was performed on the SYBR Prime X Ex-TAQ Patent II Suite (Takara) using PARP1-specific primers. The relative expression of the gene was calculated by comparing the period threshold (Ct) of the target gene in the experimental group and the control group at low concentrations according to the 2−ΔCt method.
Anzeige
RNA stability assay
Stably transfected cells were seeded into a 6-well plate and incubated until they reached 70% confluence. Actinomycin D (Sigma, St. Louis, MO, USA) was added (Act D, 5 µg/ml), and the cells were harvested at 0, 6, and 12 h. Total RNA was extracted using TRIzol reagent, and PARP1 mRNA levels were detected by qRT-PCR.
Nucleocytoplasmic separation assay
The confluent cells were harvested using a scraper and centrifuged at 1500 rpm for 5 min. The supernatant was removed, and the nuclear and cytoplasmic fractions were extracted from the cells using a specific kit (Beyotime, Shanghai, China). Both fractions were analyzed by western blotting as per standard protocols.
Nude mouse xenograft assay
All animal experiments were conducted in accordance with the guidelines of the National Institute of Health on the Care and Use of Experimental Animals and were approved by the Animal Care and Use Committee of Guangzhou Medical University. Four-week-old female BALB/c nude mice were purchased from Guangdong Experimental Animal Center (Foshan, China) and housed under controlled temperature and light (12 h dark/12 h light) with ad libitum access to food and water. The mice were injected subcutaneously into their right flanks with 1 × 107 tumor cells suspended in 200 μl of FBS-supplemented culture medium. The tumors were measured twice a week, and the volume was calculated according to the formula (length × width2)/2. At the end of the experiment (or when the mice died), the mice were euthanized, and the tumors were excised.
Statistical analysis
GraphPad Prism [version 8.02(263)] was used for statistical analysis. Non-parametric Mann–Whitney test for small samples that do not meet the normal distribution; Student's t-test was used for the normal distribution and when the sample size was large; Correlations between groups were determined using the Pearson correlation coefficient. The CCK-8 assay data were analyzed using ANOVA. All data were presented as the mean ± S.D of at least three independent experiments. Statistical significance was set at P < 0.05.
Anzeige
Results
SNORD104 is upregulated in EC tissues
We analyzed the transcriptomic profiles of 548 EC tissue samples and 35 normal endometrial tissue samples from TCGA datasets (Fig. 1A), and found that SNORD104 was upregulated in the EC samples. To verify these results, we analyzed the expression of SNORD104 in post-operative EC tissues collected from the Third Affiliated Hospital of Guangzhou Medical University and analyzed the correlation between the expression of SNORD104 and clinicopathological features (Additional file 1: Table S1). SNORD104 expression was higher in patients with stage III/IV disease (n = 13) compared to those with stage I/II disease (n = 46) (Fig. 1B). In addition, SNORD104 was upregulated in the poorly differentiated (n = 15) versus the moderately or well-differentiated (n = 44) tumors (Fig. 1C). SNORD104 expression was also higher in patients with deep myometrial invasion (n = 26) compared to those with shallow myometrial invasion (n = 33) (Fig. 1D), as well as in patients with lymph node metastasis (n = 26) relative to those without lymph node metastasis (n = 33) (Fig. 1E). In contrast, there was no significant correlation between SNORD104 expression and vascular invasion (Fig. 1F). Therefore, we hypothesized that SNORD104 functions as an oncogene in EC.
Fig. 1
SNORD104 is upregulated in EC tissues and associated with clinicopathological features. A TCGA data set analysis showing SNORD104 expression levels in EC tissue samples (n = 548) and normal endometrial tissue samples (n = 35). B–F Correlation of SNORD104 with FIGO stage, differentiation, myometrial invasion, lymph node metastasis, and vascular invasion. G Schematic and genomic location of SNORD104. Data were calculated and shown as the mean ± SD (error bars) from three independent experiments. *P < 0.05, ns means P > 0.05
×
SNORD104 knockdown inhibited the malignant potential of EC cells in vitro
Genome sequence analysis showed that SNORD104 was processed from the first intron region of the primary transcript of the SNHG25 gene (small nucleolar RNA host gene 25, located at 17q21.3) (Fig. 1G), and the mature SNHG25 RNA was transcribed from the exons. We found that SNHG25 was also upregulated in EC tissues (Additional file 2: Fig. S1A, *P < 0.05). In addition, SNORD104 was upregulated in the EC cell lines compared to that in the immortalized endometrial cells. Both SNORD104 and SNHG25 were highly expressed in the Ishikawa cells, but showed relatively low expression levels in the HEC1B and HEC1A cells (Fig. 2A, Additional file 2: Fig. S1B, *P < 0.05). Previous studies have shown that the host genes of snoRNAs regulate their respective snoRNAs and play a role in tumor development [15, 16]. To determine the role of SNORD104 and SNHG25 in EC cells, we respectively transfected the Ishikawa cells with SNHG25-specific small interfering RNA (siRNA) and the HEC1B cells with SNHG25-overexpression plasmid, and an antisense oligonucleotide sequence (ASO) targeting SNORD104 in HEC1B cells. The knockdown efficiency was verified by qRT-PCR (Fig. 2B, Additional file 2: Fig. S1C, D, *P < 0.05). SNORD104 knockdown significantly decreased the viability, proliferation (Fig. 2C, D, *P < 0.05), clonal capacity (Fig. 2E, P < 0.05), migration, and invasion (Fig. 2G, *P < 0.05) of Ishikawa cells, and increased the apoptosis rates (Fig. 2F, *P < 0.05). In contrast, knocking down or overexpressing SNHG25 had almost no effect on the proliferation and apoptosis of endometrial cancer cells (Additional file 2: Fig. S1E–H, ns means P > 0.05).
Fig. 2
SNORD104 knockdown repressed EC growth in vitro. A SNORD104 expression levels in EC cell lines and immortalized endometrial EEC cells. B Transfection of ASO in Ishikawa cells inhibited SNORD104 levels. C Viability, D Proliferation rates, E Colony formation, F apoptosis rates, and G migration and invasion of EC cells with SNORD104 knockdown. Data were calculated and shown as the mean ± SD (error bars) from three independent experiments. *P < 0.05
×
SNORD104 promotes EC progression in vitro and in vivo
HEC1B cells stably transfected with the SNORD104 plasmid (Fig. 3A, *P < 0.05) exhibited high proliferative capacity (Fig. 3B–D, *P < 0.05), along with increased invasion and migration rates (Fig. 3E, *P < 0.05). Furthermore, SNORD104 overexpression reduced apoptosis rates of HEC1B cells (Fig. 3F, *P < 0.05). Consistent with the in vitro results, HEC1B cells stably expressing SNORD104 formed significantly larger tumors in nude mice compared to the control cells inoculated with the empty vector (Fig. 3G, *P < 0.05). Taken together, overexpression of SNORD104 significantly enhanced the proliferation, invasion, and migration of EC cells in vitro and promoted tumor growth in vivo.
Fig. 3
SNORD104 overexpression promoted EC growth in vitro and in vivo. A SNORD104 expression in HEC1B cells transfected with the overexpression plasmid. B Viability, C colony formation, D proliferation rates, E apoptosis rates, and F migration and invasion of HECB1 cells overexpressing SNORD104. G Tumor volumes in nude mice inoculated with control or SNORD104-overexpressing HEC1B cells. Data were calculated and shown as the mean ± SD (error bars) from three independent experiments. *P < 0.05
×
SNORD0104 upregulates and stabilizes PARP1 by promoting 2ʹ-O-methylation
The SNORDs and H/ACA box snoRNAs regulate gene expression via 2ʹ-O-methylation and pseudouridylation, respectively. Therefore, we hypothesized that SNORD104 might be involved in FBL-mediated 2ʹ-O-methylation. Indeed, the RIP assay of the lysates from SNORD104-overexpressing HEC1B cells using anti-FBL antibodies revealed significant enrichment of SNORD104 in the immuno-precipitate (Fig. 4A, *P < 0.05). However, SNORD104 overexpression did not affect the FBL protein level (Fig. 4B).
Fig. 4
SNORD104 upregulated PARP1 expression in vitro and in vivo. A Immunoprecipitation of SNORD104 using anti-FBL antibodies. B Immunoblot showing FBL protein levels in SNORD104-overexpressing HEC1B cells. C The 2ʹ-O-methylation level up-regulated RNA in the Nm-seq data set was intersected with the RNA data set of SNORD104-Blast, and the KEGG pathway enrichment analysis showed that the apoptotic pathway ranked first. D Anti-FBL antibody was used to perform RIP assay in HEC1B cells, and the mRNA enrichment of PARP1, ITPR3, TUBA1C, PARP4, LMNB1 was detected by qRT-PCR. E Evaluation of PARP1, ITPR3, TUBA1C, PARP4, LMNB1 protein levels after overexpression of SNORD104, and only PARP1 RNA and protein level were changed. F PARP1 mRNA and protein levels in SNORD104-knockdown Ishikawa cells. G SNORD104 and PARP1 mRNA expression in EC tissues (n = 71) and the correlation between the expression levels (R = 0.3222, P < 0.0001). H PARP1 protein levels in the nuclear fraction of SNORD104-overexpressing cells. I, J PARP1 protein levels in the SNORD104-overexpressing subcutaneous xenografts in nude mice. *P < 0.05, ns means P > 0.05
×
Anzeige
To identify potential target genes regulated by SNORD104-mediated 2ʹ-O-methylation, we performed NM-seq in the control and SNORD104-overexpressing cells. As shown in Fig. 4C, 2ʹ-O-methylation was upregulated (fold change ≥ 2) at 928 methylated sites (671 RNAs). It’s reported small nucleolar RNAs generally guide the modification of target RNAs through complementary base pairing. Therefore, we intersect the RNAs with up-regulated 2ʹ-O-methylation levels and the RNAs with complementary base pairing fragments of SNORD104. Next, we performed Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis of these hypermethylated RNAs. And the results showed that the apoptosis-related pathway ranked first (Fig. 4C). Further, we analyzed the enriched RNAs in apoptosis pathways, and the CPTAC database showed that their encoded proteins were upregulated in endometrial cancer tissues, including ITPR3, LMNB1, PARP1, PARP4, and TUBA1C (Additional file 3: Fig. S2A). Next, we used RIP assay to detect whether FBL protein binds to these 5 RNAs, and western blot to detect whether the proteins encoded by these 5 RNAs changed. The results show that only PARP1 mRNA binds to FBL protein (Fig. 4D, *P < 0.05), and only PARP1 mRNA and protein level changes (Fig. 4E, F, *P < 0.05). Therefore, we next analyzed the expression of PARP1 in post-operative EC tissues and observed a positive correlation between SNORD104 and PARP1 expression levels (Fig. 4G, *P < 0.05). PARP1 is primarily localized in the nucleus and is involved in DNA damage repair and ribosome biogenesis. Consistent with this, SNORD104 overexpression increased PARP1 protein levels in the nuclear fraction (Fig. 4H). In addition, the SNORD104-overexpressing xenografts also showed increased PARP1 protein levels (Fig. 4I, J).
RTL-P assay was next performed to detect the level of 2ʹ-O-methylation in PARP1 mRNA (Fig. 5A). SNORD104 knockdown and overexpression respectively decreased and increased the 2ʹ-O-methylation level of PARP1 mRNA (Fig. 5B, C, *P < 0.05). Furthermore, FBL knockdown in the SNORD104-overexpressing HEC1B cells decreased both 2ʹ-O methylated PARP1 mRNA as well as PARP1 protein levels (Fig. 5D, F, *P < 0.05). The biological role of ribose 2ʹ-O-methylation in mRNA is still unclear, although there are reports that it can improve the stability of nucleic acids against alkaline or enzymatic hydrolysis, most likely by altering their physical and chemical properties [17, 18]. To test this hypothesis, we treated the SNORD104-overexpressing or knockdown cells with transcription inhibitor actinomycin D. Compared to the control group, the SNORD104-overexpressing cells had significantly higher PARP1 mRNA stability (Fig. 5G, *P < 0.05), while knocking down either SNORD104 or FBL reduced the stability of PARP1 mRNA (Fig. 5H, I, *P < 0.05) (Additional file 3).
Fig. 5
SNORD104 stabilizes PARP1 mRNA via 2ʹ-O-methylation. (A) Schematic diagram of RTL-P experiment. B 2ʹ-O-methylated PARP1 mRNA levels in SNORD104-knockdown cells. C 2ʹ-O-methylated PARP1 mRNA levels in SNORD104-overexpressing HECB1 cells. D 2ʹ-O-methylated PARP1 mRNA levels in SNORD104-overexpressing HECB1 cells with FBL knockdown. E, F PARP1 protein levels in SNORD104-overexpressing HECB1 cells with FBL knockdown. GPARP1 mRNA stability in SNORD104-knockdown cells treated with Act D (5 μg/ml). HPARP1 mRNA stability in SNORD104-overexpressing cells. IPARP1 mRNA stability in FBL-knockdown cells. *P < 0.05
×
SNORD104 promotes EC growth by regulating PARP1
PARP1 functions as an oncogene in various cancers [19, 20]. A search of TCGA and CPTAC datasets [10] revealed that PARP1 RNA and protein levels were significantly increased in EC tissues (Fig. 6A, Additional file 3: Fig. S2A, *P < 0.05). Furthermore, Kaplan–Meier analysis [11] showed the high expression of PARP1 correlated with poor overall survival (Fig. 6B). To verify whether SNORD104 exerts its carcinogenic effect by regulating PARP1, knocked down FBL or PARP1 in the HEC1B cells overexpressing SNORD104 (Fig. 6C, *P < 0.05). As expected, FBL or PARP1-silencing reversed the effects of SNORD104 on the proliferation (Fig. 6D, E, *P < 0.05), colony formation (Fig. 6F, *P < 0.05), and apoptosis of EC cells (Fig. 6G, *P < 0.05).
Fig. 6
Knockdown of FBL or PARP1 reversed the carcinogenic effect of SNORD104. APARP1 RNA levels in the EC tissues in the TGCA dataset. B Correlation between PARP1 expression and 5-year overall survival (OS) of EC patients from the Kaplan–Meier Plotter (P = 0.037). C FBL and PARP1 were knocked down in SNORD104-overexpressing HEC1B cells. The effect of FBL or PARP1 knockdown on the D, E proliferation, F colony formation, and G apoptosis of SNORD104-overexpressing cells. *P < 0.05
×
Discussion
Endometrial cancer (EC) occurrence and progression involve multiple genetic mutations and epigenetic changes, along with long-term stimulation of estrogen [21, 22]. In recent years, various non-coding RNAs, including long non-coding RNAs, circular RNAs, and small non-coding RNAs, such as microRNAs, piwi-interacting RNAs, and snoRNAs, have been identified that regulate tumor epigenetics. snoRNAs are dysregulated in multiple cancer and are associated with tumor cell growth, metastasis, and self-renewal [23]. For example, SNORD42A promotes acute myeloid leukemia cell proliferation by directing 18S rRNA 2'-O-methylation that promotes protein translation [24]. SNORD89 is highly expressed in ovarian cancer stem cells and promotes dryness of ovarian cancer cells by regulating the Notch1-c-Myc pathway [25]. SNORA74A activates PARP1-directed DExD-box helicase 21 (DDX21) ADP-ribosylation and increases the nuclear localization of DDX21 protein, thereby promoting ribosomal biogenesis and cancer cell growth [26]. However, little is known regarding the role of snoRNAs in EC. To identify the regulatory factors that play a role in the development of EC, we screened for the differentially expressed genes in EC tissues relative to the normal endometrial tissues using the Human Genome Map TCGA Database, and found that SNORD104 and its parent gene SNHG25 were significantly upregulated in EC tissues. Although the expression levels of a few snoRNAs correlate with that of their host genes [27], the expression and biological functions of most snoRNAs seem to be independent of their host genes [28, 29]. In this study, we found that SNORD104, rather than its host gene SNHG25, promotes EC progression. SNORD104 increased the malignant potential of the EC cells in vitro and in vivo, and inhibited apoptosis, thus preliminarily confirming its pro-oncogenic effects in EC (Fig. 7).
Fig. 7
The mechanism of SNORD104 regulating PARP1 expression through 2ʹ-O-methylation and promoting EC progression
×
The 2ʹ-O-methylation is a relatively conserved type of post-transcriptional modification that is abundant in rRNAs and tRNAs, and protects them against degradation [30]. High-throughput deep sequencing has revealed that 2ʹ-O-ribose methylation exists in the mRNAs and sncRNAs as well [31, 32]. In the present study, RIP experiments showed that SNORD104 binds to FBL protein without affecting the latter's expression levels, which further suggests that the biological function of SNORD104 may be exerted via the 2ʹ-O-ribose methylation catalyzed by FBL.
To further confirm this hypothesis, we performed NM-seq in HEC1B cells that overexpressed SNORD104 and identified 928 upregulated 2ʹ-O-methylation sites (671 RNAs). Since snoRNA mainly regulates the modification of target RNAs through complementary base pairing, we intersect the two data sets of Nm-seq and SNORD104-Blast. KEGG pathway enrichment analysis of these RNAs identified that the apoptosis pathway was significantly enriched. Then we analyzed the RNAs enriched in the apoptotic pathway through CPTAC database, and showed that the protein level of ITPR3, LMNB1, PARP1, PARP4, and TUBA1C were upregulated in endometrial cancer tissues. Next, RIP assays confirmed that FBL could bind to PARP1 mRNA, but not the other 4 RNAs, and SNORD104 expression was positively correlated with PARP1 expression in the EC tissues. Previous studies have shown that PARP1 has two 2ʹ-O-methylation sites at CHR1: 226561928–226561929 and CHR1: 226549725–226549726 [33]. In contrast, our Nm-seq results showed that the modified site was located at CHR1: 226553726–22655372. Subsequently, we verified that SNORD104 regulates 2ʹ-O-methylation of PARP1 mRNA in EC cells by RTL-P assay. In fact, SNORD104 overexpression or knockdown in EC cells significantly increased or decreased PARP1 RNA and protein levels.
RNA methylation can regulate target genes [34] by influencing variable splicing [35], increasing RNA stability [36], and regulating RNA transport [37]. To determine the mechanism by which SNORD104-mediated 2ʹ-O-methylation upregulates PARP1 protein, we assessed PARP1 mRNA stability after treatment with actinomycin D. SNORD104 overexpression or repression significantly enhanced or reduced PARP1 mRNA stability, respectively. In addition, in HEC1B cells overexpressing SNORD104, FBL knockdown reduced the PARP1 protein levels. This suggested that SNORD104 formed a complex with FBL to target and regulate 2ʹ-O-methylation of PARP1, thereby increasing its protein level and enhancing its biological function. Finally, to verify that SNORD104 exerts its carcinogenic role by regulating the expression of PARP1, we knocked down FBL and PARP1, respectively, in SNORD104-overexpressing HEC1B cells, which expectedly reversed the oncogenic effects of SNORD104 in EC.
PARP1, the first member of the PARP gene family, is located on chromosome 1 1q42.12, and encodes the chromatin-related enzyme, poly (ADP ribosyl) transferase. PARP1 participates in the poly (ADP-ribosylation) modification induced by DNA damage [38‐40]. In addition, PARP1 is an important factor in nucleolar biogenesis. Under non-stress conditions, about 40% of PARP1 molecules are located in the nucleolus [41], where it mediates ribosomal biosynthesis by controlling pre-rRNA processing, post-transcriptional modification, and assembly of pre-ribosomal subunits [42]. Recent studies reported that PARP1 plays a very extensive role in regulating the occurrence and development of tumors, not only participating in cancer cell proliferation, but also participating in metastasis. For instance, it catalyzes poly ADP-ribosylation of STAT3 (encoding signal transducer and activator of transcription 3) in various cancer cells and subsequently promotes STAT3 dephosphorylation, resulting in decreased transcription of STAT3 and its target gene PDL1 (encoding programmed cell death 1 ligand 1) [43]. In breast cancer cells, PARP1 competes with histone H1 to maintain transcription of the oncogene CCND1 (encoding cyclin D1), and also acts as a transcriptional coactivator of GATA binding protein 3 (GATA3), thus promoting the transcription of CCND1 [44]. In prostate cancer and kidney cancer, PARP1 is closely related to the metastasis of tumor cells [45, 46]. Thus, PARP1 participates in the occurrence and development of cancer through complex regulatory mechanisms.
Conclusions
SNORD104 is upregulated in EC and promotes tumor growth by inducing 2ʹ-O-methylation of PARP1, which enhances the latter’s expression and biological function. Our findings provide new insights into the mechanisms underlying the development and progression of EC and identify novel therapeutic targets for individualized treatment.
Acknowledgements
Not applicable.
Declarations
Ethics approval and consent to participate
The Ethics Committee of the third affiliated Hospital of Guangzhou Medical University approved the use of human tissue and experimental animals in this study (No: B202108-1). Informed consent was obtained from all patients.
Consent for publication
All authors agree to publication of the article.
Competing interests
The authors declare that no conflict of interests.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Die Therapie von Echinokokkosen sollte immer in spezialisierten Zentren erfolgen. Eine symptomlose Echinokokkose kann – egal ob von Hunde- oder Fuchsbandwurm ausgelöst – konservativ erfolgen. Wenn eine Op. nötig ist, kann es sinnvoll sein, vorher Zysten zu leeren und zu desinfizieren.
Seit November 2023 gibt es evidenzbasierte Empfehlungen zum perioperativen Management bei gastrointestinalen Tumoren (POMGAT) auf S3-Niveau. Vieles wird schon entsprechend der Empfehlungen durchgeführt. Wo es im Alltag noch hapert, zeigt eine Umfrage in einem Klinikverbund.
Mit dem demographischen Wandel versorgt auch die Chirurgie immer mehr betagte Menschen. Von Entwicklungen wie Fast-Track können auch ältere Menschen profitieren und bei proximaler Humerusfraktur können selbst manche 100-Jährige noch sicher operiert werden.
Worauf kommt es beim Management von Personen mit infektiöser Endokarditis an? Eine Kardiologin und ein Kardiologe fassen die zehn wichtigsten Punkte der neuen ESC-Leitlinie zusammen.
Update Innere Medizin
Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.
