Background
Renal carcinoma is among the 10 most common cancers, representing 3.7% of all new cancer cases. The incidence has been kept rising worldwide and the prognosis remains poor. Clear cell renal cell carcinoma (CCRCC), a renal cortical tumor characterized by malignant epithelial cells, is the most common type of renal carcinomas, constituting 80% of all cases. Over 30% of patients present with metastasis at the time of diagnosis [
1‐
3]. Cancer stem cell (CSC) is a critical factor during CCRCC development because it promotes metastatic spread [
4]. CCRCC stem cells (CCRCC-CSCs) express marker gene CD105 and stem cell markers Nestin, Nanog, and Oct-3/4. Despite successful isolation of CSCs in 2008, insufficient progress has been made towards decoding the roles of CSCs governing CCRCC development in the past decade [
5]. It is of paramount importance to understand the molecular mechanisms by which CSCs mediate and accelerate CCRCC metastasis to develop efficient strategies for suppressing metastasis. The study reported by Grange et al. demonstrated that exosomes from CCRCC-CSCs accelerate the metastasis of cancer cells in tumor xenografts mice [
6]. If CSCs derived exosomes is an indispensable approach for distant metastases in CCRCC.
Exosomes (30–150 nm in diameter) can be secreted from multiple types of cells and they participate in intercellular communications by transmitting intracellular cargoes (such as proteins and nucleic acids) into sensitive target cells [
7,
8]. Exosomes have gained considerable attention in patients with urogenital cancers, both as mediators of intercellular signaling and as potential sources for the discovery of novel cancer biomarkers [
9]. Exosomes released into tumor microenvironment and bloodstream known as ubiquitous messengers, have a strong impact to distant tissues [
10]. Exosomes help cancer cells take root in other organs far from primary tumor site, or metastasize, the process that ultimately leads to the overwhelming majority of cancer-associated deaths (about 90%) [
11,
12]. Exosomes derived from gastric cancer [
13] and breast cancer [
14] can initiate the pre-metastatic niche in the liver, lung and brain. Specially, stem cell-exosomes in premetastatic niche formation and biological characteristics of the cancerous stromal elements may offer novel targeting opportunities and have prognostic and predictive values [
15]. Epithelial-mesenchymal transition (EMT) and mesenchymal-epithelial transition (MET) trigger the dissociation of carcinoma cells from primary carcinomas, which subsequently migrate and disseminate to distant sites. As Nicholas Syn and David Lyden introduced EMT/MET is an essential progress of exosome-mediated metastasis [
16‐
18]. Owning to the important contribution of EMT to specific stages during metastatic progression [
19], the regulatory effects of exosomes on metastasis may actually be mediated by their regulation on EMT.
The substances or molecules (such as microRNAs or miRNAs) incorporated [
20] in exosomes and the transmittal destination [
21] of exosomes co-determine their cellular functions. MiRNAs are small noncoding RNAs (18–24 nucleotides) that direct post-transcriptional repression of complementary mRNAs via binding 3′-UTR of miRNAs, initiating a powerful regulatory mechanism controlling a variety of cellular functions in development and metastasis of cancer [
22]. The miRNA incorporated in exosomes can be transported to the pre-metastatic niche enabling wide spread influence on the gene expression of target cells. The exosomes transfer of PTEN-targeting miRNAs to metastatic tumour cells, which increase brain metastasis [
23]. Exosomal transfer of miR-21 confers paclitaxel resistance in ovarian cancer cells [
24]. The metastatic organotropism is one of the cancer’s greatest mysteries. Some findings raise the question of how exosomes are directed to the specific metastatic organs enabling organotropic metastatic growth [
20]. Exosomes released by melanoma cells prepare sentinel lymph nodes for tumor metastasis [
25]; exosomes from breast cancer cells trend to locate to lung in orthotropic nude-mouse models [
26]; exosomes secreted from gastric cancer cells can be delivered into the liver [
13]. The question is why exosomes preferably metastasize to certain organs? Hoshino et al. have revealed that tumour exosome integrins determine organotropic metastasis. Lung-tropic exosomes expressed integrins α6, β4 and β1; liver-tropic exosomes expressed integrins β5 and αv; brain-tropic exosomes expressed integrins β3 and αv [
21,
27]. Emerging evidence supports the notion that exosomal cargo including miRNA regulates development and metastasis of cancer cells. However, the roles of exosomes from CSCs are poorly understood.
We proposed based upon the messages presented above that CSC exosomes play an important role in determining the destination or target organ/tissue for distant metastasis of CCRCC by actin of miRNAs for delivery of epigenetic information. The present study was designed to examine our hypothesis with the following specific objectives: to explore the possible role of CSC exosomes from CCRCC patients without metastasis or with lung-metastasis in the development of CCRCC, to discriminate the relative contributions of lung-metastatic and non-metastatic CSC exosomes, elucidate the signaling and cellular/molecular mechanisms underlying the effects of CSC exosomes with a particular focus on a miRNA miR-19b-3p and EMT for remote regulatory properties of CSC exosomes.
Methods
Human tissue and blood samples
All clinical samples were collected with written informed consent from patients in the First/Third/Forth Affiliated Hospital of Harbin Medical University, and the ethical approval was granted by the Committees for Ethical Review of Harbin Medical University. Blood and original tumor specimens from 133 CCRCC patients at stages I and II (located CCRCC) and from 76 patients at stages III and IV (metastatic CCRCC) who underwent surgery. The collected tissues were immediately divided into two parts used for primary cultures and snap-frozen in liquid nitrogen, respectively. This study was approved by the Institutional Review Board of Harbin Medical University, and all subjects provided their informed consent.
Patient-derived CCRCC cells and cancer stem cells (CSCs)
CSCs were identified and isolated from human renal carcinomas as previously described [
5]. Briefly, each CCRCC tissue specimen was minced into 1 mm
3 cube chunks and enzymatically dissociated to single cells. Cells were isolated, using anti-CD105 antibody coupled to magnetic beads. CD105
+ cells were maintained in CCRCC stem cell culture medium. CD105
− renal tumor cells were plated and maintained in DMEM with 10% exosome-depleted FBS. Finally, the cells were placed in an incubator at 37 °C with 5% CO
2 and saturated humidity.
Cell culture
The human renal clear cell carcinoma (CCRCC) ACHN and 786-O cells, and human embryonic kidney (HEK) 293 cells were obtained from the American Type Culture Collection (ATCC). 786-O cells were maintained in RPMI-1640 Medium. ACHN and HEK293 were maintained in DMEM medium. The medium was supplemented with 10% fetal bovine serum (Invitrogen, USA).
Exosomes isolation and application
Exosomes were isolated as described by Liu et al [
12]. Briefly, patient-derived cells were starved for 12 h (without FBS), after which the medium was collected, centrifuged at 300 g for 10 min, and 20,000 g for 20 min at 4 °C to remove cellular debris. Next, the supernatant was filtered using a 0.2 mm filter and centrifuged at 100,000×g for 90 min at 4 °C. The final pellet containing exosomes was re-suspended in PBS and the amount and size of exosomes were determined by NanoSight.
Protein content of exosomes was quantified using BCA Protein Assay. For in vitro application of exosomes, 5 × 105 cells were incubated with 50 μg exosomes, and for in vivo application of exosomes, 5 mg exosomes were intravenously injected into BALB/c nude mice (SLAC Laboratory Animal Company, China) via tail vein.
Transmission electron microscopy
Selected samples were fixed in 2.5% glutaraldehyde in 0.1 mol/L phosphate-buffered saline (PBS; pH 7.4) and fixed at 4 °C overnight. The specimens were then rinsed in buffer, post-fixed in PBS 1% OsO4 for 1–2 h. The samples were embedded in 10% gelatin and fixed in glutaraldehyde at 4 °C. They were then cut into blocks, stained en bloc in uranyl acetate, dehydrated in ethanol, and embedded in epoxy resin by standard procedures. The ultra-thin sections were electron-stained and observed under an electron microscope (JEM-1220, JEOL Ltd., Japan).
Wound healing assay
CCRCC cells were seeded in six-well plates in culture medium, and grown to 70% confluence. They were then rinsed with phosphate-buffered saline (PBS). A sterile 200 μL pipette tip was used to create wounds, and the cells were incubated with exosomes for 48 h before the assessment of cell migration across the wound line.
Invasion assay
CCRCC cells (1 × 105) were seeded into upper chambers. The chambers were then inserted into transwell apparatus (Costar, USA). The upper chambers were coated with Matrigel (BD Biosciences, USA) when cell invasion assay was done. Medium with 10% FBS was added to the lower chamber. After 48 h, cells on the bottom of the inserts were fixed in 4% paraformaldehyde and stained with 0.05% crystal violet. Then cells that invaded into the lower surface were counted. Each experiment was repeated at least three times.
RNA extraction and quantitative real-time polymerase chain reaction
Total RNA was extracted and purified using a miRNeasy Mini Kit (Qiagen, USA). Quantitative real-time polymerase chain reaction (qRT-PCR) was performed in triplicate in the ABI 7500 fast real-time PCR System (Applied Biosystems, USA). The relative expression level of miR-19b-3p was calculated through normalization to U6 internal controls, and mRNAs were normalized with Actin. The following primers were used for PCR detection:
miR-19b-3p:
5′-GTGCAAATCCATGCAAAACTGA-3′(F),
5′-GTGCAGGGTCCGAGGTGCT-3′ (R)
E-cadherin:
5′-AGAACGCATTGCCACATACACTC -3′ (F),
5′-CATTCTGATCGGTTACCGTGATC -3′ (R)
N-cadherin:
5′-ACAGTGGCCACCTACAAAGG -3′ (F),
5′-CCGAGATGGGGTTGATAATG -3′ (R)
Vimentin:
5′-GAGAACTTTGCCGTTGAAGC -3′ (F),
5′-GCTTCCTGTAGGTGGCAATC -3′ (R)
Twist:
5′- GGAGTCCGCAGTCTTACGAG -3′ (F),
5′-TCTGGAGGACCTGGTAGAGG -3′ (R)
Protein extraction and western blot
Exosomes or cells were lysed with RIPA buffer containing a complete protease inhibitor tablet (Roche, Switzerland). Lysate was separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis, and the gel was blotted onto polyvinylidene fluoride (PVDF) membrane (Millipore, USA). The membrane was blocked in 5% nonfatmilk, and then incubated with either rabbit anti-human E-cadherin (3195, Cell Signaling Technologies, USA), N-cadherin (14,215, Cell Signaling Technologies, USA), Vimentin (5741, Cell Signaling Technologies), Twist (ab49254, Abcam, USA), PTEN (ab32199, Abcam, USA), CD103 (GTX64393, Genetex, USA), CD9 (20597–1-AP; Proteintech, USA), or Actin (3700, Cell Signaling Technology, USA). After washing, the membrane was incubated with the fluorescence-conjugated anti-mouse or anti-rabbit IgG (Invitrogen, USA). The bound secondary antibody was quantified using the Odyssey v1.2 software (LI-COR, USA) by measuring the band intensity (area × optical density) for each group and then normalized with Actin. The final results are expressed as fold changes by normalizing the data to control values.
Animal studies
CCRCC cells (1 × 106) suspension was subcutaneously injected into the flank of 5-week-old female athymic BALB/c nude mice (SLAC Laboratory Animal Company, China). Meanwhile, a dosage of 5 mg exosomes administered into mice via tail vein injection once every 3 days for 2 weeks. Growth rate of tumors was determined by measuring tumor size at fixed time points as to be specified. Tumor size was measured with calipers after the tumor cell injection once every 7 days for a total period of 4 weeks. Tumor volume was determined using the formula: volume = length × width2/2.
To evaluate metastasis, cells (stable luciferase transfected CCRCC cells) were injected into nude mice through tail vein. Tumors derived from stable luciferase-transfected cells were imaged to observe luciferase expression on day 28 after tumor cell injection. Briefly, the animals were anesthetized and then injected (i.p.) with luciferin at 150 mg/kg in a volume of 100 μL. Images were captured at a peak time of 15–20 min after injection using an IVIS-200 Imaging System (Xenogen Corporation, USA).
For in vivo exosome-tracking experiments, purified exosomes were fluorescently labeled with PKH26 membrane dye (Sigma, USA). Labeled exosomes (1 mg) were intravenously injected into mice. Organs were collected at 12 h after exosome injection and analyzed using Living Image software (Xenogen Corporation, USA).
All animal experiments were undertaken in accordance with the NIH Guide for the Care and Use of Laboratory Animals, with the approval of the Institutional Animal Care and Use Committee of Harbin Medical University.
Statistical analysis
Statistical analysis was performed with SPSS13.0 software. Student t test, ANOVA, or chi-square analysis was applied, where appropriate. Survival rates were estimated using the Kaplan-Meier method, and survival curves were compared using the log-rank test. A probability of < 0.05 (*) or < 0.01 (**) was considered significant.
Discussion
It was reported up to 30% of all renal cell carcinomas have distant metastases at the time of diagnosis. Lung metastases in renal cell carcinoma is the most common among various sites, accounting for 52% of the total [
1‐
3]. More frustratingly, CCRCC patients with metastasis are facing with rather limited therapeutic approaches in the clinic at present. Therefore, it is necessary to uncover the intertwined mechanisms behind of metastatic initiation and occurrence of CCRCC and identify efficient therapeutic targets for metastatic CCRCC. In this study, we collected the CSC and cancer exosomes respectively derived from metastatic and non-metastatic CCRCC patients and investigated their relative strengths in conferring the malignancy to tumors. The main findings of the present study can be summarized as following. (1) CSC exosomes were significantly more malignant than cancer exosomes. (2) CSC exosomes strongly promoted EMT thereby the migration and invasion capacities. (3) MiR-19b-3p incorporated into CSC exosomes and transferred by CSC exosomes to cancer cells played the key role in EMT via targeting PTEN. (4) An integrin CD103 enriched in CSC exosomes was a critical determinant of organotropic metastasis of CSC exosomes thereby miR-9b-3p. The larger proportion of CD103
+ exosomes over total exosomes in CSCs of metastatic patients seemed to be a crucial factor in directing metastatic sites of exosomes (Additional file
2: Figure S1). Present reports proved that cancer cell population can obtain some properties of CSCs during the EMT process [
30,
31]. In our study, CCRCC cells obtained high ability of metastasis via EMT promotion induced by CSCs-derived exosomes, which similarly act as CSCs.
CSCs play a key role in tumorigenesis and progression of tumors, and published studies have unraveled the evolving process from CSCs to cancer cells [
4]. It is believed that CSCs to drive tumor relapse by re-initiating and repopulating new tumors as a cellular and molecular mechanism for the metastasis of cancer [
4,
32]. However, there is still little compelling evidence for CSCs to cause metastasis of cancers via exosomes. The present study shed light on the molecular mechanisms for CCRCC metastasis based on exosomes secreted by CSCs. We found that miR-19b-3p enriched in CSC exosomes relative to cancer exosomes mediated the metastatic capacity of CCRCC. Consistently, previous studies have demonstrated that miR-19 family promotes proliferation, invasion, and metastasis of colorectal and breast cancer [
33,
34]. It has also been reported that miR-19b mediates EMT in lung cancer [
35]. Our results demonstrated that CSC exosomes accelerated EMT via transmitting miR-19b-3p to recipient or target cells. Such malignant effects of miR-19b-3p could be reversed by its antisense inhibitor to knockdown this miRNA.
Exosomes, as a widespread carrier cells, load a variety of cargo including protein, lipids, DNAs, mRNAs, in addition to miRNAs, and function in intercellular communications between cancer cells and their microenvironment through horizontal transfer of information [
11,
36]. Studies have highlighted the epigenetic changes such as resistance to cytotoxic drug and angiogenic properties conferred by exosomes in the recipient cells through this cargo-delivery process [
37]. It is widely believed that the tumor-derived exosomes with distinct integrin expression patterns up-taken by organ-specific cells prepare the pre-metastatic niche. Lyden et al found that exosomes from highly metastatic melanoma cells develops more metastatic lesions by permanently ‘educating’ bone marrow progenitors through the receptor tyrosine kinase MET [
21,
38]. Exosomes serve as mediators to relay bystander effects of secreting CSCs into recipient cells for priming a tumor permissive environment and played a role in tumor progression [
39]. Likewise, we found CSC exosomes from metastatic CCRCC patients cells promoted tumor growth, and gathered in cancer cells and lung with the greatest efficacies among various exosomes (CSC exosomes from non-metastatic CCRC patients, cancer exosomes from metastatic and non-metastatic CCRCC patients). To explain the results, we delineated for the first time that CD103
+ CSC exosomes possess much stronger organotropic property than CD103
− CSC exosomes. Our exosome proteomics analysis and bio-informatics database mining showed that only CD103/
ITGAE was enriched in CSC exosomes. More importantly, we verified the circulating CD103
+ exosomes as a biomarker for the progression and metastasis of CCRCC.
In conclusion, our findings suggest that CSC exosomes promotes EMT of CCRCC via transport of miR-19b-3p. Furthermore, M-S-Exo derived from CSCs of metastatic CCRCC patients has stronger fusion and contains a high proportion of CD103+ exosomes, which presents a strong EMT regulatory effect. miR-19b-3p in CSC exosomes might be considered a therapeutic target to the development of new approaches for preventing metastasis of CCRCC. In addition, the pivotal effect of CD103 in guiding organotropism suggest that depleting CD103+ CSC exosomes might represent another novel strategy for the treatment of metastatic CCRCC patients.