Skip to main content
Erschienen in: European Journal of Medical Research 1/2023

Open Access 01.12.2023 | Research

Characterization of genotypes and antimicrobial resistance profiles of clinical isolates of Shigella from patients in the southern region of Iran

verfasst von: Saeed Shoja, Saba Ghasemi, Mahsa Dastranj, Jebreil Shamseddin, Nasim Ebrahimi, Hesam Alizade, Abbas Farahani

Erschienen in: European Journal of Medical Research | Ausgabe 1/2023

Abstract

Background

Shigella spp., which are facultative anaerobic bacilli within the Enterobacteriaceae family, present a significant public health burden due to their role as prominent contributors to diarrheal diseases worldwide. A molecular analysis can facilitate the identification and assessment of outbreaks involving this bacterium. So, we aimed to investigate the antibiotic susceptibility pattern and clonal relatedness of clinical Shigella spp. isolates obtained from patients with diarrhea in Hormozgan province, South of Iran.

Methods

From 2019 to 2021, a cross-sectional investigation was conducted on 448 stool samples obtained from patients who were experiencing diarrhea, in the southern region of Iran. Shigella spp. isolates were identified based on biochemical and serological tests. All Shigella species were verified using species-specific polymerase chain reaction (PCR), followed by susceptibility testing to antimicrobial agents. Subsequently, genotyping of all Shigella species was conducted using ERIC-PCR.

Results

Out of a total of 448 stool samples, the presence of Shigella was detected in 62 cases, accounting for a prevalence rate of 13.84%. Among the identified isolates, the majority were attributed to S. flexneri, representing 53.23% of the cases. This was followed by S. sonnei at 24.19% and S. boydii at 22.58%. Notably, no instances of S. dysenteriae were found. The highest prevalence of Shigella isolates was observed in infants and children under the age of five. A significant proportion of the identified isolates demonstrated resistance to various antibiotics. Specifically, high resistance rates were noted for ampicillin (90.78%), piperacillin–tazobactam (87.1%), cefixime (83.87%), trimethoprim–sulfamethoxazole (83.87%), cefotaxime (82.26%), and ceftriaxone (80.65%). In addition, a substantial number (87.1%) of the isolates exhibited a multidrug-resistant (MDR) phenotype. Using the ERIC-PCR method, a total of 11 clusters and 6 distinct single types were identified among all the Shigella isolates.

Conclusion

A notable occurrence of antibiotic-resistant Shigella species has been noted, with multi-drug resistant (MDR) strains presenting an increasing challenge for treating shigellosis worldwide, and this includes Iran. Techniques such as ERIC-PCR are useful for assessing the genetic variation and connections between Shigella strains, which indirectly contributes to understanding antimicrobial resistance patterns. Further research is needed to explore the specific correlation between resistance genes and ERIC genotyping patterns in Shigella strains.
Hinweise

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Abkürzungen
MDR
Multidrug-resistant
XDR
Extensively drug-resistant
PCR
Polymerase chain reaction
ERIC-PCR
Enterobacterial Repetitive Intergenic Consensus Polymerase Chain Reaction
EPEC
Enteropathogenic E. coli
UPGMA
Unweighted-pair group method
LMIC
Low- and middle-income countries

Background

Shigella spp. the members of Enterobacteriaceae family are rod-shaped, non-spore-forming, non-motile, and facultative anaerobic Gram-negative bacterium that is capable of intracellular infection [1]. Shigella species are a major public health concern as they rank high among the causes of diarrhea across the globe. Ninety-nine percent of the roughly 167 million yearly instances of Shigella infection occur in developing nations [2]. Compared to other enteric pathogens such as Salmonella and Vibrio which typically require a dose of 105–108 organisms, Shigellosis poses a severe public health threat due to its infective dose being as low as 10 to 100 organisms [3]. There are four subgroups of Shigella spp., consisting of group A (Shigella dysenteriae), group B (Shigella flexneri), group C (Shigella boydii), and group D (Shigella sonnei), with each subgroup containing multiple serotypes [4].The use of antibiotics has resulted in benefits for patients infected with Shigella, including reduced duration and severity of diarrheal illness. Based on current guidelines from the World Health Organization (WHO) and a systematic review, the recommended treatment for Shigellosis is the administration of ciprofloxacin and azithromycin, two recommended oral antibiotics, for a duration of 5 days [5, 6]. Typically, shigellosis clears up without intervention or treatment, yet it can be dangerous for people with immunocompromised status those without adequate healthcare. Shigella can impact anyone, with children under five especially at risk because of inadequate hygiene practices, underdeveloped immune systems, and lack of prior exposure.
Antibiotics play a vital role in lowering diseases and death by treating bacterial infections, yet their improper and excessive use in managing diarrhea is a factor in the growing issue of antibiotic resistance. There is an escalating worry about the resistance of intestinal pathogens, including Shigella spp., Enteropathogenic E. coli (EPEC), Vibrio cholerae, and Salmonella spp. [3, 7, 8].
A systematic review and meta-analysis was conducted in Iran between 2008 and 2021, revealing the prevalence rates of resistance to ciprofloxacin, azithromycin, and ceftriaxone among Shigella spp. as 3%, 30%, and 28%, respectively. Drug resistance in Shigella spp. can manifest through diverse mechanisms including active efflux pumps expelling drugs, reduced cellular permeability, increased production of drug-modifying or drug-inactivating enzymes, and target mutation leading to modification [3]. These strains commonly exhibit resistance to multiple antibiotics, leading in increasing of morbidity. Therefore, there is a strong need for the surveillance and control of these strains [3, 9]. Examining both the phenotypic and genotypic antimicrobial resistance profiles of Shigella is of utmost importance for accurately identifying appropriate antibiotics for the treatment of shigellosis, particularly given the ongoing alterations in resistance profiles [10]. Molecular typing techniques have been used with increasing frequency in studies of the epidemiology Shigella spp. and also for a better understanding of the evolutionary relationships among clones. Gaining knowledge about the prevalent strains linked to human infections and their origins within various environments holds significance for enhancing our comprehension of this pathogen's epidemiology and addressing related issues. Consequently, precise and swift epidemiological typing is imperative for tracking the evolution of these bacterium strains [1012]. One of the suitable tools for genetic analysis and genetic relatedness evaluation among bacteria, especially the Enterobacteriaceae family, is the ERIC-PCR method. The objective of this study was to analyze the antibiotic susceptibility patterns and clonal relationships among clinical strains of Shigella spp. isolated from patients with diarrhea in the Hormozgan province, located in the southern region of Iran.

Materials and methods

Sample collection and processing

A cross-sectional study was conducted between March 2019 and November 2021 at Shahid Mohammadi, the principal teaching hospital associated with Hormozgan University of Medical Sciences in Hormozgan, Iran. The study focused on patients presenting with diarrhea who were referred to the hospital. Participants who satisfied the inclusion criteria, which consisted of a history of fever, cramps or abdominal pain, diarrhea, and vomiting, were included in the study. Individuals who had taken antibiotics within 48 h prior to sample collection were excluded. Stool samples were collected using sterile plastic containers and promptly transported to the hospital's microbiology laboratory.
The samples were subsequently directly inoculated onto MacConkey and xylose lysine deoxycholate (XLD) agar (Merck, Germany) using sterile disposable inoculation loops. They were subjected to aerobic incubation at 37 ºC for a duration of 24 h. Shigella spp. were confirmed through the utilization of conventional biochemical assays for identification. Colonies that exhibited characteristics suggestive of Shigella (including colorless and small pale colonies on MacConkey agar, and a red and green appearance on XLD and HE media, respectively) were subjected to inoculation into Sulfide Indole Motility Agar (SIM), Triple Sugar Iron Agar (TSI), and Lysine Decarboxylase Citrate Agar (LDC) (Merck, Germany), and then subjected to the urease production test [13]. Presumptive Shigella isolates were serologically grouped using commercial Shigella polyvalent antisera against the four Shigella species via slide agglutination tests (Baharafshan Institute of Research and Development, Iran). The positive control and reference bacterial strains used in this study were S. sonnei ATCC25931, S. dysenteriae ATCC13313, S. flexneri ATCC29903, and S. boydii ATCC8700.

Molecular confirmation of Shigella spp. by species‑specific PCR

DNA extraction was performed utilizing the QIAamp DNA Mini Kit, in accordance with the guidelines provided by the manufacturer (Qiagen NV, Venlo, the Netherlands). DNA concentrations and quality were evaluated using the NanoDrop Spectrophotometer PROMO (Thermo Fisher Scientific, Waltham, MA, USA).
The identification of all Shigella species was achieved through DNA sequencing of putative integrase for Shigella genus, hypothetical protein for S. boydii, wbgZ for S. sonnei, rfpB for S. dysenteriae, and rfc for S. flexneri as previously described [14, 15].
The PCR reactions were prepared with a total reaction volume of 20 µL as follows: 0.5 µL of each 10 pM primer, 10 µL of 2 × Master Mix (SinaClon, Iran), 3 µL (50 ng) of extracted DNA, and sterile deionized water to reach a final volume of 20 µL.
Amplifications were performed using a thermocycler (C1000 Touch, Bio-Rad) following this protocol: initial denaturation at 95 °C for 5 min, followed by 35 cycles of denaturation at 95 °C for 60 s, annealing for 30 s (temperature dependent on primer nucleotide sequences in Table 1), and extension at 72 °C for 30 s, with a final extension at 72 °C for 5 min. Finally, 5 µL of the PCR products were run to a 1.5% agarose gel (Merck Co, Germany), then subjected to staining with SYBR Safe DNA gel stain (Invitrogen), and DNA bands were observed and documented utilizing a UV transilluminator device (Uvidoc, Gel documentation system, Cambridge, UK).
Table 1
The primers used in this investigation
Target gene (primers)
Forward sequence
Reverse sequence
Annealing temperature (0C)
Expected size (pb)
References
Putative integrase
TCGCATTTCTCTCCCCACCACG
CCGGATGTGTCTCGGGCAATC
63
159
[15]
Hypothetical protein
GAGCACGGAAACAGAGAGCGCC
GGTGCGTTCTTCCGGTGTTCTG
63
240
rfpB
TCTCAATAATAGGGAACACAGC
CATAAATCACCAGCAAGGTT
59
211
[14]
wbgZ
TCTGAATATGCCCTCTACGCT
GACAGAGCCCGAAGAACCG
60
430
rfc
TTTATGGCTTCTTTGTCGGC
CTGCGTGATCCGACCATG
60
537
ERIC
ATGTAAGCTC CTGGGGATTCAC
AAGTAAGTGACTG GGGTGAGCG
55
[18]

Antimicrobial susceptibility tests

The antimicrobial susceptibility of Shigella species was evaluated using the disk diffusion method (Kirby–Bauer test) on Mueller Hinton agar (Merck, Germany), in accordance with the recommendations provided by Clinical and Laboratory Standards Institute (CLSI 2022) guidelines [16]. Following antibiotic disks were used: amikacin (AN/30 μg), chloramphenicol (C/30 μg), trimethoprim–sulfamethoxazole (SXT/1.25/23.75 μg), nalidixic acid (NA/30 μg), norfloxacin (NOR/10 μg), ofloxacin (OFX/5 μg), ceftriaxone (CRO/30 μg), cefotaxime (CTX/30 μg), ceftazidime (CAZ/30 μg), ceftizoxime (CT/30 μg), cefixime (CFM/5 μg), azithromycin (AZM/15 μg), cefoxitin (FOX/30 μg), Amoxicillin (AMX/25), piperacillin–tazobactam (100/10 μg) (Mast Diagnostics, Merseyside, UK).
The phenotype(s) of Shigella isolates were classified as MDR (multidrug-resistant) when they displayed “non-susceptibility to at least one agent in three or more antimicrobial categories” [17].

Molecular typing of Shigella spp. isolates

ERIC-PCR typing of the clinical isolates using two oligonucleotide primers was done as described previously [18]. PCR amplification was performed using an initial denaturation step at 95 °C for 10 min, followed by 4 cycles at 94 °C for 5 min, 5 min at 40 °C, and 5 min at 72 and then followed by 30 cycles of denaturation at 94 °C for 1 min, annealing at 55 °C for 1 min, extension at 72 °C for 2 min and the last extension at 72 °C for 10 min. Comparison of ERIC-PCR banding patterns was performed using GelJ software version 2.0 [19].

Clustering analyses

The DNA patterns obtained were analyzed and compared following the methods described previously [20]. To identify ERIC-PCR polymorphism, the TIFF images of each gel photograph were inverted and normalized using a 100-bp DNA ladder as a size marker. Clustering analyses of the ERIC-PCR band patterns were conducted using GelJ software version 2.0, with the unweighted-pair group method (UPGMA) and average linkage Pearson coefficient at a 2% tolerance. Genotypes were clustered together if their similarity coefficient was equal to or exceeded 90%. Escherichia coli (ATCC 25922) was used as an outgroup for phylogenetic analysis.

Result

Description of sample population

In this cross-sectional descriptive study, out of the 448 individuals experiencing acute diarrhea, 62 (13.84%) received a shigellosis diagnosis by assessing clinical manifestations and laboratory results.
Among the 62 Shigella isolates, a total of 35 (56.5%) were detected in males, whereas 27 (43.5%) were identified in females. The percentages of clinical symptoms are shown in Table 2.
Table 2
The results of clinical symptoms among Shigella spp. in this study
Clinical characteristic
Shigella spp. (%)
Fever
93.54
Vomiting
82.25
Bloody diarrhea
56.45
Abdominal pain
80.64
Hospitalization
3.22
Furthermore, after amplifying the genes specific to each genus, it became apparent that the majority of isolates belonged to S. flexneri (53.2%), followed by S. sonnei (24.2%) and S. boydii (22.6%). Notably, no S. dysenteriae was detected. The season distribution of Shigella isolates is shown in Table 3.
Table 3
The season distribution of Shigella isolates
 
Season
Total
 
Spring
Summer
Autumn
Winter
 
Species
 S. flexneri
0 (0)
0 (0)
16 (48.49)
17 (51.51)
33 (53.23)
 S. sonnei
3 (20)
0 (0)
9 (60)
3 (20)
15 (24.19)
 S. boydii
1 (7.14)
0 (0)
7 (50)
6 (42.86)
14 (22.58)
Total
4 (6.45)
0 (0)
32 (51.62)
26 (41.93)
62 (100)
The most prevalent of Shigella isolates was observed in infants and children under 5 years old (16.13 and 40.32, respectively) with S. flexneri (50% and 44%, respectively) and S. sonnei (30% and 36%, respectively) being the most frequent species (Table 4). Furthermore, S. flexneri exhibited the most occurrence among children aged 5 to 10 years.
Table 4
Incidence of Shigella spp. according to different age groups within the examined population
Shigella spp.
S. flexneri
S. sonnei
S. boydii
Total isolates (%)
Age group
0–1
5
3
2
10 (16.13)
1–5
11
9
5
25 (40.32)
5–10
9
1
4
14 (22.58)
10–20
3
2
2
7 (11.29)
20–30
0
0
0
0
30–40
0
0
0
0
40–50
3
0
1
4 (6.45)
50–60
0
0
0
0
60–70
2
0
0
2 (3.23)
> 70
0
0
0
0
Total (%)
33 (53.23)
15 (24.19)
14 (22.58)
62 (100)

Antimicrobial resistance profiles

The current investigation displays the sensitivity and resistance levels of the samples to antibiotics, presented in Table 5 through percentages and numerical counts. The antimicrobial susceptibility testing (AST) results demonstrated that ampicillin resistance was observed in 90.78% of the isolated Shigella spp., followed by piperacillin–tazobactam (87.1%), cefixime (83.87%), trimethoprim–sulfamethoxazole (83.87%), cefotaxime (82.26%), and ceftriaxone (80.65%). Furthermore, Shigella isolates exhibited sensitivity to norfloxacin, cefoxitin, ofloxacin, and chloramphenicol.
Table 5
The results of antimicrobial susceptibility profile of 62 Shigella isolates
Antibiotics
S. flexneri (n = 33)
S. sonnei (n = 15)
S. boydii (n = 14)
Total isolates (n = 62)
Sensitive (%)
Intermediate (%)
Resistant (%)
Sensitive (%)
Intermediate (%)
Resistant (%)
Sensitive (%)
Intermediate (%)
Resistant (%)
Sensitive (%)
Intermediate (%)
Resistant (%)
Amikacin (AN/30 μg)
5 (15.15)
18 (54.55)
10 (30.30)
6 (40)
7 (46.67)
2 (13.33)
8 (57.14)
2 (14.29)
4 (28.57)
19 (30.64)
27 (43.55)
16 (25.81)
Ampicillin (AMX/25 μg)
0 (0.0)
0 (0.0)
33 (100.0)
1 (6.67)
0 (0.0)
14 (93.33)
1 (1.14)
0 (0.0)
13 (92.86)
2 (3.22)
0 (0.0)
60 (90.78)
Azithromycin (AZM/15 μg)
22 (66.67)
2 (6.06)
9 (27.27)
8 (53.34)
2 (13.33)
5 (33.33)
6 (42.86)
4 (28.57)
4 (28.57)
36 (58.06)
8 (12.9)
18 (29.04)
Ceftriaxone (CRO/30 μg)
8 (24.24)
0 (0.0)
25 (75.76)
1 (6.67)
0 (0.0)
14 (93.33)
3 (21.43)
0 (0.0)
11 (78.57)
12 (19.35)
0 (0.0)
50 (80.65)
Cefotaxime (CTX/30 μg)
3 (9.09)
4 (12.12)
26 (78.79)
1 (6.67)
0 (0.0)
14 (93.33)
3 (21.43)
0 (0.0)
11 (78.57)
7 (11.29)
4 (6.45)
51 (82.26)
Ceftazidime (CAZ/30 μg)
14 (42.42)
5 (15.15)
14 (42.43)
5 (33.33)
8 (53.34)
2 (13.33)
4 (28.57)
4 (28.57)
6 (42.86)
23 (37.1)
17 (27.42)
22 (35.48)
Ceftizoxime (CT/30 μg)
6 (18.18)
5 (15.15)
22 (66.67)
4 (26.66)
4 (26.66)
7 (46.67)
4 (28.57)
1 (7.14)
9 (64.29)
14 (22.58)
10 (16.13)
38 (61.29)
Cefixime (CFM/5 μg)
8 (24.24)
0 (0.0)
25 (75.76)
1 (6.67)
0 (0.0)
14 (93.33)
1 (1.14)
0 (0.0)
13 (92.86)
10 (16.13)
0 (0.0)
52 (83.87)
Cefoxitin (FOX/30 μg)
33 (100)
0 (0.0)
0 (0.0)
14 (93.33)
0 (0.0)
1 (6.67)
8 (57.14)
1 (7.14)
5 (35.72)
55 (88.71)
1 (1.61)
6 (9.68)
Chloramphenicol (C/30 μg)
24 (72.73)
1 (3.03)
8 (24.24)
14 (93.33)
1 (6.67)
0 (0.0)
12 (85.72)
1 (7.14)
1 (7.14)
50 (80.64)
3 (4.84)
9 (14.52)
Ciprofloxacin (CP/5 μg)
4 (12.12)
12 (36.36)
17 (51.52)
3 (20.0)
5 (33.33)
7 (46.67)
2 (14.29)
1 (7.14)
11 (78.57)
9 (14.52)
18 (29.04)
35 (56.45)
Nalidixic acid (NA/30 μg)
14 (42.43)
13 (39.39)
6 (18.18)
6 (40)
1 (6.67)
8 (53.34)
2 (14.29)
4 (28.57)
8 (57.14)
22 (35.48)
18 (29.04)
22 (35.48)
Norfloxacin (NOR/10 μg)
33 (100)
0 (0.0)
0 (0.0)
14 (93.33)
0 (0.0)
1 (6.67)
11 (78.57)
0 (0.0)
3 (21.43)
58 (93.55)
0 (0.0)
4 (6.45)
Ofloxacin (OFX/5 μg)
30 (90.91)
3 (9.09)
0 (0.0)
11 (73.33)
3 (20.0)
1 (6.67)
11 (78.57)
1 (7.14)
2 (14.29)
52 (83.87)
7 (11.29)
3 (4.84)
Piperacillin–tazobactam (100/10 μg)
3 (9.09)
1 (3.03)
29 (87.88)
0 (0.0)
1 (6.67)
14 (93.33)
2 (14.29)
1 (7.14)
11 (78.57)
5 (8.06)
3 (4.84)
54 (87.1)
Trimethoprim–sulfamethoxazole (SXT/1.25/23.75 μg)
2 (6.06)
4 (12.12)
27 (81.82)
1 (6.67)
1 (6.67)
13 (86.66)
2 (14.29)
0 (0.0)
12 (85.71)
5 (8.06)
5 (8.06)
52 (83.87)
Among the strains of S. sonnei, a significant proportion of 93.33% exhibited resistance to ceftriaxone, cefotaxime, cefixime, and piperacillin–tazobactam. Notably, all strains belonging to S. flexneri demonstrated resistance to ampicillin. For further insight into the antibiotic resistance patterns within the three Shigella stereotypes, please refer to Table 5.
Out of the 62 isolates, 54 (87.1%) strains exhibited a multidrug-resistant (MDR) phenotype. Out of the 54 isolates exhibiting multidrug resistance (MDR), 30 were classified as S. flexneri, 13 as S. boydii, and 11 as S. sonnei.

Molecular characterization using ERIC-PCR

The ERIC-PCR typing was performed to determine the genetic relatedness among Shigella isolates from stool samples in the South of Iran. All isolates were typed using the ERIC-PCR method. Among 62 Shigella isolates that were selected for molecular analysis, we identified 11 clusters, 2 sub clusters, and 6 distinct single types (Fig. 1).
Cluster A6 was found to be the predominant and pervasive cluster in our region, with a similarity rate of approximately 90–100%. Through the application of computer-assisted clustering, the strains demonstrated a substantial level of similarity, with similarity indices ranging from 85% for the most distinctive isolates to 100% for the indistinguishable ones. Interestingly, cluster A1, A2 and A5 contain only S. boydii isolates, whereas cluster A8 and A9 is relatively diverse. Clusters A4, A6, A10 and A11 only include strains S. flexneri and cluster A3 includes strains of S. sonnei.
The clusters A1, A3, A4, A6, A8, and A9 showed the highest prevalence of antibiotic-resistant isolates. For more information, please refer to Table 6.
Table 6
Frequency of antibiotic resistance profiles among different clusters
Clusters
A1
A2
A3
A4
A5
A6-1
A6-2
A8
A9
A10
A11
Antibiotics
Ampicillin
2 (100)
3 (100)
5 (100)
2 (100)
4 (80)
8 (100)
6 (100)
9 (90)
2 (100)
3 (100)
7 (100)
Azithromycin
0 (0.0)
0 (0.0)
0 (0.0)
1 (50)
1 (20)
3 (37.5)
1 (16.7)
6 (60)
0 (0.0)
1 (33.3)
0 (0.0)
Ceftriaxone
2 (100)
2 (66.6)
5 (100)
2 (100)
3 (60)
8 (100)
5 (83.3)
9 (90)
2 (100)
1 (33.3)
3 (42.9)
Cefotaxime
2 (100)
2 (66.6)
5 (100)
2 (100)
3 (60)
8 (100)
5 (83.3)
9 (90)
2 (100)
2 (66.6)
3 (42.9)
Ceftazidime
1 (50)
2 (66.6)
1 (20)
1 (50)
2 (40)
6 (75)
3 (50)
0 (0.0)
2 (100)
0 (0.0)
2 (28.6)
Ceftizoxime
1 (50)
2 (66.6)
4 (80)
1 (50)
2 (40)
7 (87.5)
6 (100)
2 (20)
2 (100)
1 (33.3)
3 (42.9)
Cefixime
2 (100)
3 (100)
5 (100)
2 (100)
4 (80)
8 (100)
5 (83.3)
9 (90)
2 (100)
1 (33.3)
3 (42.9)
Cefoxitin
1 (50)
1 (33.3)
0 (0.0)
0 (0.0)
2 (40)
0 (0.0)
0 (0.0)
1 (10)
0 (0.0)
0 (0.0)
0 (0.0)
Chloramphenicol
0 (0.0)
0 (0.0)
0 (0.0)
1 (50)
0 (0.0)
3 (37.5)
2 (33.3)
0 (0.0)
0 (0.0)
1 (33.3)
1 (14.3)
Ciprofloxacin
2 (100)
3 (100)
4 (80)
0 (0.0)
4 (80)
3 (37.5)
2 (33.3)
3 (30)
1 (50)
1 (33.3)
6 (85.7)
Nalidixic acid
1 (50)
1 (33.3)
1 (20)
0 (0.0)
3 (60)
1 (12.5)
0 (0.0)
8 (80)
0 (0.0)
1 (33.3)
1 (14.3)
Norfloxacin
1 (50)
0 (0.0)
1 (20)
0 (0.0)
2 (40)
0 (0.0)
0 (0.0)
0 (0.0)
0 (0.0)
0 (0.0)
0 (0.0)
Ofloxacin
0 (0.0)
0 (0.0)
1 (20)
0 (0.0)
2 (40)
0 (0.0)
0 (0.0)
0 (0.0)
0 (0.0)
0 (0.0)
0 (0.0)
Piperacillin–tazobactam
2 (100)
3 (100)
5 (100)
2 (100)
4 (80)
8 (100)
5 (83.3)
9 (90)
1 (50)
3 (100)
5 (71.4)
Trimethoprim–sulfamethoxazole
2 (100)
3 (100)
3 (60)
2 (100)
3 (60)
7 (87.5)
3 (50)
10 (100)
2 (100)
2 (66.6)
7 (100)
Total
2 (100)
3 (100)
5 (100)
2 (100)
5 (100)
8 (100)
6 (100)
10 (100)
2 (100)
3 (100)
7 (100)
Individual analyses were conducted for each species, revealing that the S. flexneri isolates were categorized into seven clusters (F1 to F7) and two unique types (Fig. 2). The ERIC-PCR pattern analysis results for Shigella sonnei revealed the presence of two major clusters with 100% similarity among their isolates (Fig. 3). However, indicates that there is greater diversity among S. boydii isolates (Fig. 4).
Clusters A4 and A10 are exclusively present in the male population, while cluster A1 is exclusive to the female population (Fig. 5).

Discussion

Throughout the duration of our study, S. flexneri continued to maintain its dominance as the primary serogroup, consistent with previous records [3]. This research has confirmed the prevalence of S. flexneri in low- and middle-income countries (LMIC), while S. sonnei demonstrated a higher prevalence in high-income countries [21]. Therefore, the findings of this study validate the aforementioned assumption.
Over the past few decades in Iran, the predominant causative agent of shigellosis has been identified as S. flexneri. However, contemporary studies have revealed a notable surge in shigellosis cases associated with S. sonnei [2224]. In this study, it was found that 40.3% of S. flexneri strains were isolated from children under 10 years of age, indicating a significant prevalence within this particular age group. The observed variations in the occurrence of Shigella spp. could potentially be attributed to factors such as age, economic development level, geographical location, climate, and numerous other environmental conditions [23].
Shigella boydii has been reported in Iran in less than 3% of the total shigellosis cases [9], whereas in our study, S. boydii accounted for 22.58%. In line with our study, research conducted in Iran in 2018 revealed that the occurrence rate of S. boydii among Shigella strains was 23.8% [25]. Similar to other studies in Iran, S. dysenteriae was not detected in stool samples [3, 23]. Shigella dysenteriae exhibits a higher frequency in outbreak scenarios linked to civil unrest and refugee crises [26].
In previous studies, it has been demonstrated that fever was the predominant presenting symptom [27, 28]. Our cases had a low rate of hospitalization and death was not observed. In contrast to previous research findings [29, 30], our study observed a high occurrence of bloody diarrhea (56.43%).
Various mechanisms contribute to the development of drug resistance in Shigella isolates. One example is the interference with DNA replication through the inhibition of DNA topoisomerase IV and gyrase by quinolone antibacterial agents, such as nalidixic acid, ofloxacin, and ciprofloxacin [3]. The emergence of antimicrobial resistance poses a critical challenge to public health. The results of antibiotic susceptibility testing revealed high resistance rates among Shigella isolates, particularly against ampicillin (90.78%), piperacillin–tazobactam (87.1%), cefixime (83.87%), trimethoprim–sulfamethoxazole(co-trimoxazole) (83.87%), cefotaxime (82.26%), and ceftriaxone (80.65%). These rates were in line with previous studies from Iran and various countries [3, 23, 31]. However, the resistance rates for different Shigella species exhibited the expected variations.
There are three subgroups of Shigella spp. isolates: S. flexneri, S. sonnei, and S. boydii. These subgroups have shown higher rates of resistance against ampicillin (64.9%) and co-trimoxazole. The data indicate a significant increase in resistance to various classes of antibiotics among the Shigella isolates. Based on our study findings, and considering that co-trimoxazole and ampicillin are commonly used as first-line treatments for Shigella-induced diarrhea, we discourage the use of these antibiotics for empirical therapy due to their high resistance rates [3]. In line with our findings, a significant resistance rate to different antibiotics had been previously reported in the southwestern and central regions of Iran [23, 32].
The resistance to ciprofloxacin has significantly risen (by 56.45%) when compared to previous studies [30, 33]. The occurrence of drug resistance in Shigella spp. is a significant risk, particularly in developing nations with health and nutritional challenges.
The findings of our study revealed a concerning trend with the high prevalence of MDR-Shigella isolates and their emergence within the respective hospitals. Similar to our results, a study conducted in Cambodia found that 91% of Shigella spp. isolates were multidrug-resistant [34].
In line with our study, a study conducted by Shahin et al. during 2015–2016 on 70 Shigella spp. isolates revealed that at least 50 percent of the S. sonnei strains were resistant to ceftazidime, cefotaxime, cefuroxime, ampicillin, tetracycline, nalidixic acid, and ciprofloxacin, according to the results of the antimicrobial [35].
A study conducted on S. flexneri and S. sonnei strains isolated from bacillary dysentery cases in Southeast Brazil found that 90% of them exhibited multiple drug resistance phenotypes [36].
Furthermore, across Iran, 11 studies identified a total of 667 clinical isolates as species producing both MDR and ESBLs [9]. There have been reports of the emergence of extensively drug-resistant (XDR) and multidrug-resistant (MDR) S. flexneri serotypes in England [37].
Similar to the isolates isolated from human sources, unfortunately, the isolates isolated from water sources have also shown high antibiotic resistance. For example, Shahin et al. from Iran showed that all Shigella isolates collected from water samples were MDR [38].
In a study with a wide range of food samples demonstrated that the incidence of Shigella spp. is more frequent in raw vegetables and also multidrug resistance phenotypes were noticeably frequent and observed in 17 isolates (89.5%) out of 19 isolates.
A study conducted on various food samples reveals a high prevalence of Shigella spp. in raw vegetables, with a remarkable prevalence of multidrug resistance phenotypes detected in 17 out of 19 isolates (89.5%). The spread of Shigella is notably affected by suboptimal health standards, limited personal hygiene awareness, and water quality of lower quality. Although most cases of Shigella-induced foodborne illnesses are typically mild and resolve independently, the emergence of severe cases raises significant concerns, particularly in high-risk patient populations [39].
In this current investigation, ERIC-PCR was utilized for the molecular characterization of Shigella spp. isolates, offering a swift and cost-effective approach that has demonstrated its worth as a valuable genotyping method for Enterobacteriaceae [40]. It is a powerful method for molecular typing of Shigella strains and has been shown to be a plausible alternative strategy to PFGE [41]. This study aimed to understand the molecular epidemiology of Shigella spp. in hospitals. The objective was to identify the main clonal lineages that are currently circulating in this region.
Isolates in this study with ERIC profiles A3, A5, A6, A8 and A11 were believed to be endemic in our study region. All isolates belonging to the same genotype exhibited consistent resistance patterns. They demonstrated co-resistance to antimicrobial agents, including ampicillin, piperacillin–tazobactam, trimethoprim–sulfamethoxazole, cefixime, and ceftriaxone (Table 6). This remarkably similar pattern suggests that the same species might be circulating within the communities. Also, based on the ERIC profile results of all isolates presented in Fig. 1, clusters A2, A4, and sub cluster A6-1 (87.5%) were prevalent in the winter season, while clusters A1, A3, A9, A10 and sub cluster A6-2 were prevalent in the autumn season. Maybe this reason is one of the factors contributing to the high similarity of these isolates.
Wei et al. documented a strong correlation between antimicrobial resistance patterns and PFGE genotypes in clinically derived Shigella isolates [42]. Shigella isolates with the same antimicrobial resistance patterns, as well as similar PFGE genotypes, have contributed to the shigellosis that has been circulating in an area for a longer period.
In another study conducted by Zhu et al., a notable correlation was observed between the antimicrobial resistance phenotypes and genotyping of Shigella spp. isolates obtained from clinical samples [43].
In our research, groups A1 and A9 showed complete resistance to seven different antibiotics, as detailed in Table 6. Corresponding with our results, another investigation used RAPD-PCR to group Shigella strains into five main clusters and found that those in cluster R4 exhibited the most antibiotic resistance. This study also suggested a connection between the clusters and their resistance to antimicrobials [44]. Therefore, molecular genotyping patterns can be used to predict antimicrobial resistance in Shigella strains.
In the last 20 years, numerous studies have applied the ERIC-PCR assay as a quick genetic typing technique to evaluate genetic connections between bacterial species from various origins such as the environment, food products, and humans [20, 45, 46]. In this study, ERIC-PCR showed remarkable differentiation among unrelated Shigella spp., making it a valuable DNA fingerprinting approach for discerning Shigella species isolated from diverse samples. It can provide genotyping profiles and contribute to understanding the genetic diversity and relatedness of Shigella strains.

Conclusion

There has been a notable increase in Shigella strains resistant to antibiotics. The rise of multi-drug resistant Shigella is alarming for treating shigellosis worldwide, Iran included. This complicates the management of Shigella infections and underscores the urgency for measures to tackle antibiotic resistance. On the other hand, while there is limited specific information on the correlation between antimicrobial resistance and ERIC genotyping patterns in clinically derived Shigella strains, genotyping methods like ERIC-PCR can provide valuable information about the genetic diversity and relatedness of Shigella strains, which indirectly contributes to understanding antimicrobial resistance patterns. Further research is needed to explore the specific correlation between resistance genes and ERIC genotyping patterns in Shigella strains.

Limitation

Our study possesses certain limitations. Firstly, we have not examined the resistance genes among isolates that are resistant to multiple drugs. Furthermore, information regarding the severity of the disease is lacking. Consequently, the association between disease severity and antibiotic resistance remains unexplored. Moreover, it is important to note that our study is restricted to a single-center design.

Acknowledgements

We thank the Hormozgan University of Medical Sciences for their assistance during this study. We would like to thank all members of the microbiology laboratory of Hormozgan University of Medical Sciences.

Declarations

Ethical consideration was earned from the Hormozgan Health Institute, Hormozgan University of Medical Sciences, Bandar Abbas, Iran (Ethical code: IR.HUMS.REC.1398.368). Informed consent was obtained from all subjects and/or their legal guardian(s).
Not applicable.

Competing interests

The authors declare that they have no competing interests.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creativecommons.​org/​licenses/​by/​4.​0/​. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Literatur
2.
Zurück zum Zitat Wang Y, Ma Q, Hao R, Zhang Q, Yao S, Han J, et al. Antimicrobial resistance and genetic characterization of Shigella spp. in Shanxi Province, China, during 2006–2016. BMC Microbiol. 2019;19:1–11.CrossRef Wang Y, Ma Q, Hao R, Zhang Q, Yao S, Han J, et al. Antimicrobial resistance and genetic characterization of Shigella spp. in Shanxi Province, China, during 2006–2016. BMC Microbiol. 2019;19:1–11.CrossRef
3.
4.
Zurück zum Zitat Kahsay AG, Muthupandian S. A review on Sero diversity and antimicrobial resistance patterns of Shigella species in Africa, Asia and South America, 2001–2014. BMC Res Notes. 2016;9(1):1–6.CrossRef Kahsay AG, Muthupandian S. A review on Sero diversity and antimicrobial resistance patterns of Shigella species in Africa, Asia and South America, 2001–2014. BMC Res Notes. 2016;9(1):1–6.CrossRef
5.
Zurück zum Zitat Ayele B, Beyene G, Alemayehu M, Dekebo A, Mekonnen Z, Nigussie G. Prevalence and antimicrobial-resistant features of Shigella species in East Africa from 2015–2022: a systematic review and meta-analysis. Interdiscip Perspect Infect Dis. 2023;2023:1–10.CrossRef Ayele B, Beyene G, Alemayehu M, Dekebo A, Mekonnen Z, Nigussie G. Prevalence and antimicrobial-resistant features of Shigella species in East Africa from 2015–2022: a systematic review and meta-analysis. Interdiscip Perspect Infect Dis. 2023;2023:1–10.CrossRef
6.
Zurück zum Zitat World Health Organization. Antimicrobial resistance: global report on surveillance. Geneva: World Health Organization; 2023. World Health Organization. Antimicrobial resistance: global report on surveillance. Geneva: World Health Organization; 2023.
7.
Zurück zum Zitat Tosisa W, Mihret A, Ararsa A, Eguale T, Abebe T. Prevalence and antimicrobial susceptibility of Salmonella and Shigella species isolated from diarrheic children in Ambo town. BMC Pediatr. 2020;20(1):1–8.CrossRef Tosisa W, Mihret A, Ararsa A, Eguale T, Abebe T. Prevalence and antimicrobial susceptibility of Salmonella and Shigella species isolated from diarrheic children in Ambo town. BMC Pediatr. 2020;20(1):1–8.CrossRef
10.
Zurück zum Zitat Pakbin B, Didban A, Brück WM, Alizadeh M. Phylogenetic analysis and antibiotic resistance of Shigella sonnei isolates. FEMS Microbiol Lett. 2022;369(1):fnac042.PubMedCrossRef Pakbin B, Didban A, Brück WM, Alizadeh M. Phylogenetic analysis and antibiotic resistance of Shigella sonnei isolates. FEMS Microbiol Lett. 2022;369(1):fnac042.PubMedCrossRef
12.
Zurück zum Zitat Karmoker J, Islam S, Liton Rana M, Ullah A, Neloy FH, Oishy NM, et al. Molecular detection and multidrug resistance of Shigella spp. isolated from wild waterfowl and migratory birds in Bangladesh. Vet Med Int. 2023;2023:1–9.CrossRef Karmoker J, Islam S, Liton Rana M, Ullah A, Neloy FH, Oishy NM, et al. Molecular detection and multidrug resistance of Shigella spp. isolated from wild waterfowl and migratory birds in Bangladesh. Vet Med Int. 2023;2023:1–9.CrossRef
13.
Zurück zum Zitat Taneja N, Mewara A, Kumar A, Verma G, Sharma M. Cephalosporin-resistant Shigella flexneri over 9 years (2001–09) in India. J Antimicrob Chemother. 2012;67(6):1347–53.PubMedCrossRef Taneja N, Mewara A, Kumar A, Verma G, Sharma M. Cephalosporin-resistant Shigella flexneri over 9 years (2001–09) in India. J Antimicrob Chemother. 2012;67(6):1347–53.PubMedCrossRef
14.
Zurück zum Zitat Ojha SC, Yean Yean C, Ismail A, Banga Singh K-K. A pentaplex PCR assay for the detection and differentiation of Shigella species. BioMed Res Int. 2013;2013:1–9.CrossRef Ojha SC, Yean Yean C, Ismail A, Banga Singh K-K. A pentaplex PCR assay for the detection and differentiation of Shigella species. BioMed Res Int. 2013;2013:1–9.CrossRef
15.
Zurück zum Zitat Kim H-J, Ryu J-O, Song J-Y, Kim H-Y. Multiplex polymerase chain reaction for identification of Shigellae and four Shigella species using novel genetic markers screened by comparative genomics. Foodborne Pathog Dis. 2017;14(7):400–6.PubMedCrossRef Kim H-J, Ryu J-O, Song J-Y, Kim H-Y. Multiplex polymerase chain reaction for identification of Shigellae and four Shigella species using novel genetic markers screened by comparative genomics. Foodborne Pathog Dis. 2017;14(7):400–6.PubMedCrossRef
16.
Zurück zum Zitat M100: Performance Standards for Antimicrobial Susceptibility Testing, 32nd edition. Wayne, Pennsylvania: Clinical and Laboratory Standards Institute; 2022. Performance Standards for Antimicrobial Susceptibility Testing, 32nd ed. CLSI Supplement M100. M100: Performance Standards for Antimicrobial Susceptibility Testing, 32nd edition. Wayne, Pennsylvania: Clinical and Laboratory Standards Institute; 2022. Performance Standards for Antimicrobial Susceptibility Testing, 32nd ed. CLSI Supplement M100.
17.
Zurück zum Zitat Ranjbar R, Farahani A. Study of genetic diversity, biofilm formation, and detection of Carbapenemase, MBL, ESBL, and tetracycline resistance genes in multidrug-resistant Acinetobacter baumannii isolated from burn wound infections in Iran. Antimicrob Resist Infect Control. 2019;8:1–11.CrossRef Ranjbar R, Farahani A. Study of genetic diversity, biofilm formation, and detection of Carbapenemase, MBL, ESBL, and tetracycline resistance genes in multidrug-resistant Acinetobacter baumannii isolated from burn wound infections in Iran. Antimicrob Resist Infect Control. 2019;8:1–11.CrossRef
18.
Zurück zum Zitat Fendri I, Ben Hassena A, Grosset N, Barkallah M, Khannous L, Chuat V, et al. Genetic diversity of food-isolated Salmonella strains through pulsed field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus (ERIC-PCR). PLoS ONE. 2013;8(12):e81315.PubMedPubMedCentralCrossRef Fendri I, Ben Hassena A, Grosset N, Barkallah M, Khannous L, Chuat V, et al. Genetic diversity of food-isolated Salmonella strains through pulsed field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus (ERIC-PCR). PLoS ONE. 2013;8(12):e81315.PubMedPubMedCentralCrossRef
19.
Zurück zum Zitat Heras J, Domínguez C, Mata E, Pascual V, Lozano C, Torres C, et al. GelJ–a tool for analyzing DNA fingerprint gel images. BMC Bioinf. 2015;16(1):1–8.CrossRef Heras J, Domínguez C, Mata E, Pascual V, Lozano C, Torres C, et al. GelJ–a tool for analyzing DNA fingerprint gel images. BMC Bioinf. 2015;16(1):1–8.CrossRef
20.
Zurück zum Zitat Khosravi AD, Hoveizavi H, Mohammadian A, Farahani A, Jenabi A. Genotyping of multidrug-resistant strains of Pseudomonas aeruginosa isolated from burn and wound infections by ERIC-PCR. Acta Cir Bras. 2016;31:206–11.PubMedCrossRef Khosravi AD, Hoveizavi H, Mohammadian A, Farahani A, Jenabi A. Genotyping of multidrug-resistant strains of Pseudomonas aeruginosa isolated from burn and wound infections by ERIC-PCR. Acta Cir Bras. 2016;31:206–11.PubMedCrossRef
21.
Zurück zum Zitat Sati HF, Bruinsma N, Galas M, Hsieh J, Sanhueza A, Ramon Pardo P, et al. Characterizing Shigella species distribution and antimicrobial susceptibility to ciprofloxacin and nalidixic acid in Latin America between 2000–2015. PLoS ONE. 2019;14(8):e0220445.PubMedPubMedCentralCrossRef Sati HF, Bruinsma N, Galas M, Hsieh J, Sanhueza A, Ramon Pardo P, et al. Characterizing Shigella species distribution and antimicrobial susceptibility to ciprofloxacin and nalidixic acid in Latin America between 2000–2015. PLoS ONE. 2019;14(8):e0220445.PubMedPubMedCentralCrossRef
22.
Zurück zum Zitat Alizadeh-Hesar M, Bakhshi B, Najar-Peerayeh S. Clonal dissemination of a single Shigella sonnei strain among Iranian children during Fall 2012 in Tehran, IR Iran. Infect Genet Evol. 2015;34:260–6.PubMedCrossRef Alizadeh-Hesar M, Bakhshi B, Najar-Peerayeh S. Clonal dissemination of a single Shigella sonnei strain among Iranian children during Fall 2012 in Tehran, IR Iran. Infect Genet Evol. 2015;34:260–6.PubMedCrossRef
23.
Zurück zum Zitat Abbasi E, Abtahi H, van Belkum A, Ghaznavi-Rad E. Multidrug-resistant Shigella infection in pediatric patients with diarrhea from central Iran. Infect Drug Resist. 2019;12:1535–44.PubMedPubMedCentralCrossRef Abbasi E, Abtahi H, van Belkum A, Ghaznavi-Rad E. Multidrug-resistant Shigella infection in pediatric patients with diarrhea from central Iran. Infect Drug Resist. 2019;12:1535–44.PubMedPubMedCentralCrossRef
24.
Zurück zum Zitat Bakhshi B, Bayat B, Lari AR. Multiple-locus variable-number tandem-repeat analysis (MLVA) of Shigella sonnei isolates of 2012 outbreak IR Iran. Microb Pathog. 2017;102:69–73.PubMedCrossRef Bakhshi B, Bayat B, Lari AR. Multiple-locus variable-number tandem-repeat analysis (MLVA) of Shigella sonnei isolates of 2012 outbreak IR Iran. Microb Pathog. 2017;102:69–73.PubMedCrossRef
26.
Zurück zum Zitat Kerneis S, Guerin PJ, von Seidlein L, Legros D, Grais RF. A look back at an ongoing problem: Shigella dysenteriae type 1 epidemics in refugee settings in Central Africa (1993–1995). PLoS ONE. 2009;4(2):e4494.PubMedPubMedCentralCrossRef Kerneis S, Guerin PJ, von Seidlein L, Legros D, Grais RF. A look back at an ongoing problem: Shigella dysenteriae type 1 epidemics in refugee settings in Central Africa (1993–1995). PLoS ONE. 2009;4(2):e4494.PubMedPubMedCentralCrossRef
27.
Zurück zum Zitat Shamsizadeh A, Nikfar R, Bavarsadian E. Neurological manifestations of shigellosis in children in southwestern Iran. Pediatr Int. 2012;54(1):127–30.PubMedCrossRef Shamsizadeh A, Nikfar R, Bavarsadian E. Neurological manifestations of shigellosis in children in southwestern Iran. Pediatr Int. 2012;54(1):127–30.PubMedCrossRef
28.
Zurück zum Zitat Özmert EN, Ince OT, Örün E, Yalçın S, Yurdakök K, Gür D. Clinical characteristics and antibiotic resistance of Shigella gastroenteritis in Ankara, Turkey between 2003 and 2009, and comparison with previous reports. Int J Infect Dis. 2011;15(12):e849–53.PubMedCrossRef Özmert EN, Ince OT, Örün E, Yalçın S, Yurdakök K, Gür D. Clinical characteristics and antibiotic resistance of Shigella gastroenteritis in Ankara, Turkey between 2003 and 2009, and comparison with previous reports. Int J Infect Dis. 2011;15(12):e849–53.PubMedCrossRef
29.
Zurück zum Zitat Bhattacharya D, Bhattacharya H, Thamizhmani R, Sayi D, Reesu R, Anwesh M, et al. Shigellosis in Bay of Bengal Islands, India: clinical and seasonal patterns, surveillance of antibiotic susceptibility patterns, and molecular characterization of multidrug-resistant Shigella strains isolated during a 6-year period from 2006 to 2011. Eur J Clin Microbiol Infect Dis. 2014;33:157–70.PubMedCrossRef Bhattacharya D, Bhattacharya H, Thamizhmani R, Sayi D, Reesu R, Anwesh M, et al. Shigellosis in Bay of Bengal Islands, India: clinical and seasonal patterns, surveillance of antibiotic susceptibility patterns, and molecular characterization of multidrug-resistant Shigella strains isolated during a 6-year period from 2006 to 2011. Eur J Clin Microbiol Infect Dis. 2014;33:157–70.PubMedCrossRef
30.
Zurück zum Zitat Gebrekidan A, Dejene TA, Kahsay G, Wasihun AG. Prevalence and antimicrobial susceptibility patterns of Shigella among acute diarrheal outpatients in Mekelle hospital, Northern Ethiopia. BMC Res Notes. 2015;8:1–7.CrossRef Gebrekidan A, Dejene TA, Kahsay G, Wasihun AG. Prevalence and antimicrobial susceptibility patterns of Shigella among acute diarrheal outpatients in Mekelle hospital, Northern Ethiopia. BMC Res Notes. 2015;8:1–7.CrossRef
31.
Zurück zum Zitat Teimourpour R, Babapour B, Esmaelizad M, Arzanlou M, Peeri-Doghaheh H. Molecular characterization of quinolone resistant Shigella spp. isolates from patients in Ardabil, Iran. Iran J Microbiol. 2019;11(6):496.PubMedPubMedCentral Teimourpour R, Babapour B, Esmaelizad M, Arzanlou M, Peeri-Doghaheh H. Molecular characterization of quinolone resistant Shigella spp. isolates from patients in Ardabil, Iran. Iran J Microbiol. 2019;11(6):496.PubMedPubMedCentral
32.
Zurück zum Zitat Farajzadeh Sheikh A, Moradi Bandbal M, Saki M. Emergence of multidrug-resistant Shigella species harboring extended-spectrum beta-lactamase genes in pediatric patients with diarrhea from southwest of Iran. Mol Biol Rep. 2020;47(9):7097–106.PubMedCrossRef Farajzadeh Sheikh A, Moradi Bandbal M, Saki M. Emergence of multidrug-resistant Shigella species harboring extended-spectrum beta-lactamase genes in pediatric patients with diarrhea from southwest of Iran. Mol Biol Rep. 2020;47(9):7097–106.PubMedCrossRef
33.
Zurück zum Zitat Nikfar R, Shamsizadeh A, Darbor M, Khaghani S, Moghaddam M. A study of prevalence of Shigella species and antimicrobial resistance patterns in paediatric medical center, Ahvaz, Iran. Iran J Microbiol. 2017;9(5):277.PubMedPubMedCentral Nikfar R, Shamsizadeh A, Darbor M, Khaghani S, Moghaddam M. A study of prevalence of Shigella species and antimicrobial resistance patterns in paediatric medical center, Ahvaz, Iran. Iran J Microbiol. 2017;9(5):277.PubMedPubMedCentral
34.
Zurück zum Zitat Poramathikul K, Bodhidatta L, Chiek S, Oransathid W, Ruekit S, Nobthai P, et al. Multidrug-resistant Shigella infections in patients with diarrhea, Cambodia, 2014–2015. Emerg Infect Dis. 2016;22(9):1640.PubMedPubMedCentralCrossRef Poramathikul K, Bodhidatta L, Chiek S, Oransathid W, Ruekit S, Nobthai P, et al. Multidrug-resistant Shigella infections in patients with diarrhea, Cambodia, 2014–2015. Emerg Infect Dis. 2016;22(9):1640.PubMedPubMedCentralCrossRef
35.
Zurück zum Zitat Shahin K, Bouzari M, Komijani M, Wang R. A new phage cocktail against multidrug, ESBL-producer isolates of Shigella sonnei and Shigella flexneri with highly efficient bacteriolytic activity. Microb Drug Resist. 2020;26(7):831–41.PubMedCrossRef Shahin K, Bouzari M, Komijani M, Wang R. A new phage cocktail against multidrug, ESBL-producer isolates of Shigella sonnei and Shigella flexneri with highly efficient bacteriolytic activity. Microb Drug Resist. 2020;26(7):831–41.PubMedCrossRef
36.
Zurück zum Zitat Penatti M, Hollanda L, Nakazato G, Campos T, Lancellotti M, Angellini M, et al. Epidemiological characterization of resistance and PCR typing of Shigella flexneri and Shigella sonnei strains isolated from bacillary dysentery cases in Southeast Brazil. Braz J Med Biol Res. 2007;40:249–58.PubMedCrossRef Penatti M, Hollanda L, Nakazato G, Campos T, Lancellotti M, Angellini M, et al. Epidemiological characterization of resistance and PCR typing of Shigella flexneri and Shigella sonnei strains isolated from bacillary dysentery cases in Southeast Brazil. Braz J Med Biol Res. 2007;40:249–58.PubMedCrossRef
37.
Zurück zum Zitat Thorley K, Charles H, Greig DR, Prochazka M, Mason LC, Baker KS, et al. Emergence of extensively drug-resistant and multidrug-resistant Shigella flexneri serotype 2a associated with sexual transmission among gay, bisexual, and other men who have sex with men, in England: a descriptive epidemiological study. Lancet Infect Dis. 2023;23(6):732–9.PubMedCrossRef Thorley K, Charles H, Greig DR, Prochazka M, Mason LC, Baker KS, et al. Emergence of extensively drug-resistant and multidrug-resistant Shigella flexneri serotype 2a associated with sexual transmission among gay, bisexual, and other men who have sex with men, in England: a descriptive epidemiological study. Lancet Infect Dis. 2023;23(6):732–9.PubMedCrossRef
38.
Zurück zum Zitat Shahin K, Bouzari M, Wang R, Khorasgani MR. Distribution of antimicrobial resistance genes and integrons among Shigella spp. isolated from water sources. J Glob Antimicrob Resist. 2019;19:122–8.PubMedCrossRef Shahin K, Bouzari M, Wang R, Khorasgani MR. Distribution of antimicrobial resistance genes and integrons among Shigella spp. isolated from water sources. J Glob Antimicrob Resist. 2019;19:122–8.PubMedCrossRef
39.
Zurück zum Zitat Shahin K, Bouzari M, Wang R, Yazdi M. Prevalence and molecular characterization of multidrug-resistant Shigella species of food origins and their inactivation by specific lytic bacteriophages. Int J Food Microbiol. 2019;305:108252.PubMedCrossRef Shahin K, Bouzari M, Wang R, Yazdi M. Prevalence and molecular characterization of multidrug-resistant Shigella species of food origins and their inactivation by specific lytic bacteriophages. Int J Food Microbiol. 2019;305:108252.PubMedCrossRef
40.
Zurück zum Zitat Bakhshi B, Afshari N, Fallah F. Enterobacterial repetitive intergenic consensus (ERIC)-PCR analysis as a reliable evidence for suspected Shigella spp. outbreaks. Braz J Microbiol. 2018;49:529–33.PubMedPubMedCentralCrossRef Bakhshi B, Afshari N, Fallah F. Enterobacterial repetitive intergenic consensus (ERIC)-PCR analysis as a reliable evidence for suspected Shigella spp. outbreaks. Braz J Microbiol. 2018;49:529–33.PubMedPubMedCentralCrossRef
41.
Zurück zum Zitat Kosek M, Yori PP, Gilman RH, Vela H, Olortegui MP, Chavez CB, et al. Facilitated molecular typing of Shigella isolates using ERIC-PCR. Am J Trop Med Hyg. 2012;86(6):1018.PubMedPubMedCentralCrossRef Kosek M, Yori PP, Gilman RH, Vela H, Olortegui MP, Chavez CB, et al. Facilitated molecular typing of Shigella isolates using ERIC-PCR. Am J Trop Med Hyg. 2012;86(6):1018.PubMedPubMedCentralCrossRef
42.
Zurück zum Zitat Wei H-L, Wang Y-W, Li C-C, Tung SK, Chiou C-S. Epidemiology and evolution of genotype and antimicrobial resistance of an imported Shigella sonnei clone circulating in central Taiwan. Diagn Microbiol Infect Dis. 2007;58(4):469–75.PubMedCrossRef Wei H-L, Wang Y-W, Li C-C, Tung SK, Chiou C-S. Epidemiology and evolution of genotype and antimicrobial resistance of an imported Shigella sonnei clone circulating in central Taiwan. Diagn Microbiol Infect Dis. 2007;58(4):469–75.PubMedCrossRef
43.
Zurück zum Zitat Zhu Z, Cao M, Zhou X, Li B, Zhang J. Epidemic characterization and molecular genotyping of Shigella flexneri isolated from calves with diarrhea in Northwest China. Antimicrob Resist Infect Control. 2017;6(1):1–11.CrossRef Zhu Z, Cao M, Zhou X, Li B, Zhang J. Epidemic characterization and molecular genotyping of Shigella flexneri isolated from calves with diarrhea in Northwest China. Antimicrob Resist Infect Control. 2017;6(1):1–11.CrossRef
44.
Zurück zum Zitat Pakbin B, Amani Z, Allahyari S, Mousavi S, Mahmoudi R, Brück WM, et al. Genetic diversity and antibiotic resistance of Shigella spp. isolates from food products. Food Sci Nutr. 2021;9(11):6362–71.PubMedPubMedCentralCrossRef Pakbin B, Amani Z, Allahyari S, Mousavi S, Mahmoudi R, Brück WM, et al. Genetic diversity and antibiotic resistance of Shigella spp. isolates from food products. Food Sci Nutr. 2021;9(11):6362–71.PubMedPubMedCentralCrossRef
45.
Zurück zum Zitat Gautam H, Maheshwari B, Mohapatra S, Sood S, Dhawan B, Kapil A, et al. Clonal relationship among Acinetobacter baumannii isolates from different clinical specimens by ERIC-PCR. Int J Infect Dis. 2022;116:S18–9.CrossRef Gautam H, Maheshwari B, Mohapatra S, Sood S, Dhawan B, Kapil A, et al. Clonal relationship among Acinetobacter baumannii isolates from different clinical specimens by ERIC-PCR. Int J Infect Dis. 2022;116:S18–9.CrossRef
46.
Zurück zum Zitat Alsultan A, Elhadi N. Evaluation of ERIC-PCR method for determining genetic diversity among Escherichia coli isolated from human and retail imported frozen shrimp and beef. Int J Food Contam. 2022;9(1):12.CrossRef Alsultan A, Elhadi N. Evaluation of ERIC-PCR method for determining genetic diversity among Escherichia coli isolated from human and retail imported frozen shrimp and beef. Int J Food Contam. 2022;9(1):12.CrossRef
Metadaten
Titel
Characterization of genotypes and antimicrobial resistance profiles of clinical isolates of Shigella from patients in the southern region of Iran
verfasst von
Saeed Shoja
Saba Ghasemi
Mahsa Dastranj
Jebreil Shamseddin
Nasim Ebrahimi
Hesam Alizade
Abbas Farahani
Publikationsdatum
01.12.2023
Verlag
BioMed Central
Erschienen in
European Journal of Medical Research / Ausgabe 1/2023
Elektronische ISSN: 2047-783X
DOI
https://doi.org/10.1186/s40001-023-01570-0

Weitere Artikel der Ausgabe 1/2023

European Journal of Medical Research 1/2023 Zur Ausgabe