Background
Mesothelin is a glycosylphosphatidylinositol (GPI)-anchored cell-surface glycoprotein expressed at low levels by a restricted set of normal adult tissues but aberrantly expressed by ~70% of human ovarian epithelial tumors including up to 100% of serous papillary ovarian cancers, as well as by significant proportions of pancreatic adenocarcinomas, endometrioid uterine adenocarcinomas, mesotheliomas, and squamous cell carcinomas of the esophagus, lung and cervix [
1‐
7]. Full length mesothelin (~69 kD) can be proteolytically cleaved to release a ~33 kD soluble protein corresponding to megakaryocyte potentiating factor (MPF) [
8,
9]. The biologic functions of mesothelin and MPF remain speculative. Mutant mice with targeted mesothelin gene inactivation are normal, exhibiting no apparent anatomic, hematologic or reproductive abnormalities [
10]. Analysis of the mesothelin protein sequence yields no strong homologies to known protein functional domains, beyond a C-terminal GPI-anchor motif. Mesothelin has been very recently reported to bind to CA125/MUC16 also commonly expressed on the surface of ovarian tumor cells [
11], suggesting that mesothelin might play a role in heterotypic cell adhesion and metastatic spread of ovarian cancer, but data to support this idea are lacking for most human tumors.
Despite limited understanding of mesothelin's biological function, its restricted expression by normal tissues combined with frequent abundant expression by tumors has suggested several applications in clinical oncology. Circulating mesothelin/MPF may have diagnostic potential in mesothelin-positive malignancies [
12], and tumor cell-associated mesothelin is being used as a target in ongoing clinical trials of passive immunotherapy using immunotoxins [
13,
14]. Mesothelin may also be a viable antigen for tumor vaccine therapies (unpublished data presented by E. Jaffee, 10th Annual SPORE Investigators Workshop, July 15, 2002). Further, mesothelin appears to be an important target in the evolving arena of cancer genetic profiling for several major tumor types [
4,
5,
15‐
17]. Rational design and development of these potential clinical applications would be facilitated by a clear understanding of mesothelin gene and protein expression by both normal cells and tumors.
To date, three variants of human mesothelin transcripts have been reported: variant 1 (GenBank accession NM_005823) encoding MPF [
8,
9]; variant 2 (NM_013404) encoding mesothelin [
18]; and variant 3 (AF180951), a partial alternatively spliced cDNA with a disrupted GPI-anchor motif [
19]. Of note, each transcript variant has regions of unique oligonucleotide sequences that could result in differential results in genetic-based expression studies and further encode proteins with unique peptides. It is of particular relevance for the present study that all three mesothelin transcript variants have been reported to be expressed by human cancer cells. Nevertheless, there is a remarkable lack of studies directly investigating relative expression levels of mesothelin transcript variants in normal and malignant tissues, even though multiple gene expression studies of tumor expression profiles conducted to date have included putative mesothelin-specific cDNA or oligonucleotide probes [
4,
5,
15‐
17]. The present study provides evidence for expression of human mesothelin transcript variants 1 and 3, but not variant 2, in a variety of human tissues and cell lines. Moreover, variant 1 appears to be the predominant mature mesothelin transcript in all studied specimens, including ovarian and pancreatic adenocarcinomas.
Methods
Cell lines
The human ovarian (SKOV-3, Caov-4, OVCAR-3), pancreatic (PANC-1, AsPC-1) and cervical (HeLa) tumor cell lines were obtained from the American Type Culture Collection (Rockville, MD). UCI 101 human ovarian adenocarcinoma cell line was kindly provided by Dr. David T. Curiel (Gene Therapy Center, University of Alabama at Birmingham). SKOV-3 cells were grown in McCoy's 5A medium with 2 mM L-glutamine and 10% FBS. Caov-4, PANC-1 and HeLa were grown in DMEM with 4.5 g/L glucose, 2 mM L-glutamine and 10% FBS. OVCAR-3 were grown in RPMI-1640 medium with 2 mM L-glutamine, 1.5 g/L sodium bicarbonate, 4.5 g/L glucose, 10 mM HEPES, 1 mM sodium pyruvate, 0.01 mg/ml bovine insulin and 20% FBS. AsPC-1 and UCI 101 were grown in RPMI-1640 medium with 2 mM L-glutamine, 1.5 g/L sodium bicarbonate, 10 mM HEPES, 1 mM sodium pyruvate and 10% FBS. Certified FBS was from HyClone (Logan, UT), insulin was from Sigma (St. Louis, MO), and all other cell culture media components were from Mediatech (Herndon, VA).
Tumor specimens
Ovarian surgical specimens were obtained after informed consent under protocols approved by the Institutional Review Board for Human Experimentation of the University of Alabama at Birmingham. Normal ovary was collected at the time of hysterectomy and bilateral salpingo-oophorectomy. All tissues were collected under sterile conditions and immediately frozen at -70°C. The 7 ovarian tumor samples used in the present study included 6 designated as endometroid/papillary serous and 1 as papillary serous.
RNA isolation
Total RNA was isolated from frozen tissues and cultured cell lines by RNA STAT-60 reagent (TEL-Test, Friendswood, TX) according to the manufacturer's protocol. Contaminating DNA was removed with RQ RNase-free DNase I (Promega, Madison, WI) and RNA concentration measured spectrophotometrically (GeneQuant II RNA/DNA Calculator, Pharmacia Biotech Ltd., Cambridge, United Kingdom). RNA integrity and quality was analyzed by electrophoresis on a 1.2% denaturing agarose gel. For some experiments, nuclear and cytoplasmic RNA were isolated separately. Briefly, cultured cells were suspended in TKM buffer (10 mM Tris-HCl pH 7.4, 1 mM KCl, 1 mM MgCl2). After 5 min on ice, 10% Triton-X 100 was added and the suspension mixed gently. Nuclear and cytoplasmic fractions were separated by centrifugation. The nuclear pellet was lysed by suspension in RNA STAT-60 and processed as above. Cytoplasmic RNA was isolated from the supernatant fraction by phenol/chloroform extraction and ethanol precipitation.
Oligonucleotides and RT-PCR
RT-PCR was performed using the Gene Amp PCR kit (Roche Molecular Systems, Branchburg, NJ) as described in the manufacturer's protocol, using 1 μg of total RNA as template with random hexamers for RT priming. Negative controls without the addition of RT enzyme were performed for each RNA samples. For PCR, oligonucleotide primers were added at a concentration of 0.3 μM each and amplification carried out for 35 cycles with an annealing temperature of 65°C. Negative controls without template were performed for each PCR amplification. RT-PCR products were analyzed by electrophoresis on a 1.5% NuSieve GTG (Cambrex Bio Science Rockland, Rockland, ME) plus 1% agarose gel, and products visualized by ethidium bromide staining. PCR primers (Table
1) were synthesized by Invitrogen Life Technologies (Carlsbad, CA).
Table 1
RT-PCR primer pairs used for mesothelin transcript amplification
full length (tr1 & 2) | ACCCACGGTGCCTCCCTCCC TCAGGCCAGGGTGGAGGCTAG | exon 1 exon 17 | 1906 bp (tr1) 1924 bp (tr 2) |
24 bp insert region (tr1 & 2) | CTACCTCTTCCTCAAGATGAG GTGTCTAGGGTGTCTTTGTCT | exon 12 exon 13 | 177 bp (tr1) 201 bp (tr2) |
82 bp insert region (tr1 & 3) | ATGAAGCTGCGGACGGATGCG TGAGAACAGGTCCAGGTCCTA | exon 15 exon 17 | 262 bp (tr 1) 344 bp (tr 3) |
tr3-specific | ACCCACGGTGCCTCCCTCCC ACCTCCACGCCCCCAGCTCTG | exon 1 intron 16 | 1873 bp |
DNA sequencing
Amplified PCR products were either directly sequenced or first cloned into the pCR4-TOPO vector (Invitrogen) and subjected to automated dideoxy nucleotide sequencing in the UAB Center for AIDS Research Sequencing Core Facility, using fluoresence-based cycle sequencing and the ABI BigDye Terminator V 3.1 Cycle Sequencing kit with the ABI Prism 3100 Genetic Analyzer (Applied Biosystems, Foster City, California, USA). T3 and T7 primers were used for sequencing genes cloned into pCR4-TOPO: 5'-ATTAACCCTCACTAAAGGGA-3' and 5'-TAATACGACTCACTATAGGG-3'. Sequence data were analyzed by BLAST nucleotide-nucleotide search (National Center Biotechnology Information,
http://www.ncbi.nlm.nih.gov/) against non-redundant and expressed sequence tag (EST) databases.
Discussion
Mesothelin is a promising target for cancer diagnostics and therapy [
12‐
14,
19]. In normal cells, expression is primarily restricted to mesothelial cells in the pleural, pericardial, and peritoneal membranes. Limited mesothelin immunoreactivity has also been reported in trachea, tonsil, fallopian tube and kidney [
1]. In contrast, mesothelin is abundantly expressed in certain tumors, including up to 100% of serous papillary ovarian tumors [
5] and up to 100% of pancreatic tumors [
4]. Frequent and high level expression by tumors suggests that mesothelin might play a role in tumorigenesis. Immunohistochemical studies demonstrate that mesothelin expression is directly correlated with progressive development of metastatic pancreatic cancer [
20]. Recent evidence that mesothelin may promote cell-cell adhesion in ovarian cancer through heterotypic binding to CA125/MUC16 further supports a role in tumor progression [
11]. Circulating mesothelin may serve as a serum marker for early detection and monitoring of mesothelin-positive tumors [
12]. However, in order to fully exploit mesothelin as a target for clinical applications, it is important to understand mesothelin expression with regard to the transcript variants that have been reported to date.
Various investigators have referred to this gene and its products as mesothelin [
18], MPF [
8,
9], soluble mesothelin [
19], mesothelin family members or soluble mesothelin related proteins (SMR) [
12]. The
in silico and
in vitro studies reported here support mesothelin variant 1 as the major transcript expressed by both normal and malignant cells. Mesothelin variant 2 (NM_013404) was not detected. While it remains possible that nucleotide differences in variant 2 are the result of allelic variation, alignment of the transcript variant 2 sequence with available genomic sequences suggests that the differences in amino acids 4–56 between variants 1 and 2 may be due to sequencing errors. Another feature of variant 2, a 24 bp insertion after base pair 1313 (transcript 2 NM_013404), appears to arise from use of an alternative splice acceptor site upstream of the usual splice acceptor site, and was very rare in our studies. The third reported mesothelin transcript variant, encoding an alternative C-terminus, appears to be largely restricted to the nuclear fraction of RNA and to be infrequent in the cytoplasmic pool of mature mRNA, suggesting that this variant may represent incompletely processed hnRNA. Although definitive studies to detect the soluble isoform of mesothelin protein predicted to be encoded by variant 3 will be needed to rule out the possibility of low level expression, data presented here suggests that variant 1 represents the predominant form of mesothelin expressed by both normal and tumor cells.
Despite the presence of a single major transcript for mesothelin in the samples evaluated here, immunohistochemical studies of mesothelin protein have reported distinct expression patterns in tumor samples. In human pancreatic tumors, some samples exhibited focal staining, and mesothelin was commonly detected in single tumor cells surrounded on all sides by stroma; malignant glands were generally less well stained, but expression was accentuated at luminal borders and luminal contents were frequently positive, suggesting secretion or shedding of mesothelin from tumor cells [
4]. Other analyses of a variety of tumors, including ovarian cancer, report mesothelin staining at the cell membrane, in the cytoplasm, or both, depending on the sample; staining was sometimes accentuated at apical cell surfaces and in intracytoplasmic lumens, with extracellular luminal contents again noted to be frequently labeled [
5,
6,
19]. Our own immunohistochemical studies of ovarian tumors (unpublished data) are consistent with the available literature and are notable in that the pattern of localization of mesothelin is consistent within a tumor specimen, with some showing apical localization and apparent secretion of mesothelin, while cytoplasmic staining is prominent in others.
Given that mesothelin transcript variant 1 is widely and highly expressed, the basis for differential localization of mesothelin protein in different tumor samples is most likely a consequence of post-translational processing. Mesothelin variant 1 encodes a GPI anchor motif, and proteins attached to cell plasma membranes by GPI anchors can be readily released
in vivo. A relevant example is carcinoembryonic antigen (CEA), a tumor-associated GPI-anchored glycoprotein that is commonly shed by CEA-positive malignant cells [
21]. A furin-like protease cleavage site within mesothelin that is probably responsible for the release of the N-terminal MPF portion [
9] could conceivably contribute to mesothelin-immunoreactive extracellular contents observed in tumor tissue samples and in serum from tumor patients, but evidence to date suggests that mesothelin-specific antibodies used for both types of studies react with epitopes in the membrane-proximal C-terminal portion of mesothelin. Additional studies delineating the post-translational processing and secretion of mesothelin are warranted.
The basis of the reported cross-reactivity of mesothelin antibodies with other proteins in serum or ascites [
19] is not clear, but is not likely to be due to cross-reactivity with endogenous homologous proteins. Current databases contain only one vertebrate gene with significant homology to mesothelin, otoancorin (NM_170664), which has been implicated in autosomal recessive deafness and has 21–22% amino acid identity to mesothelin in the C-terminal region [
22]. Interestingly, otoancorin is also located on human chromosome 16p, but its specific function is unknown and its expression is apparently limited to the inner ear.
Authors' contributions
ZEM performed the experiments, interpreted the data, and contributed to writing the manuscript. TVS and DRS conceived the study, designed the experiments, supervised the work, interpreted the data, and wrote the manuscript. All authors read and approved the final manuscript.