Clinical significance of protocadherin 8 (PCDH8) promoter methylation in non-muscle invasive bladder cancer

A total of 233 patients with bladder cancer who had a transurethral resection of bladder tumor between January 2004 and January 2008 at the Third Hospital of Hebei Medical University were recruited. All patients were histopathologically diagnosed as non-muscle invasive bladder transitional cell carcinoma for the first time, and they did not receive preoperative anti-cancer therapy. In addition, the normal bladder epithelial tissues obtained from 43 inpatients with bladder stone were also collected as controls; these samples were examined pathologically to exclude the possibility of incidental tumors. The tissue samples were immediately frozen in liquid nitrogen after resection and stored at -80°C until examined. The bladder cancers were graded and staged according to 1973 WHO grading system and 2002 TNM classification [22],[23]. Tumor therapy and follow up strategies were performed according to international guidelines [22]-[24] Recurrence was defined as a new tumor observed in the bladder after initial curative resection and progression was defined as a disease with a higher TNM stage when relapsed [25]. Follow-up continued until the death of the patient or to 60 months if the patient remained alive. This study was approved by the ethics committee of Third Hospital of Hebei Medical University, and written informed consent was obtained from all of the participants.

Genomic DNA from the tissue samples was extracted using DNeasy Tissue Kit (Qiagen, Valencia, CA) following the manufacture’s instructions. The quality of extracted DNA was assessed using NanoDrop ND-1000 (Thermo Fisher Scientific, Waltham, USA). The extracted DNA was treated with bisulfite using EpiTect Bisulfite Kit (Qiagen, Valencia, CA) according to the manufacture’s protocol. The bisufite modifited DNA was then used for MSP. The methylation status of PCDH8 was detected using primers specific for PCDH8 unmethylated and methylated sequences respectively, as our reported previously [18]. The following primers were used: unmethylated: forward 5’- GGTGGTTATTGGTTATTTGGTTT-3’ and reverse 5’- CCAACAAACTCTAAAAACACACA-3’; methylated: forward 5’- CGGTTATTGGTTATTCGGTTCC-3’ and reverse 5’- ACGAACTCTAAAAACGCGCG -3’. The PCR amplification of the modified DNA consisted of one cycle of 95°C for 5 min, 40 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s, and 1 cycle of 72°C for 5 min. Water blanks were included with each assay, in vitro methylated DNA and unmethylated DNA (New England Biolabs, Beverly, MA, USA) was used as methylation and unmethylation positive control. PCR products were separated in 2% agarose gel, stained with ethidium bromide, and visualized under ultraviolet illumination for analysis. Samples were scored as methylation positive when methylated alleles were present in the methylated DNA lane and methylation negative when bands were present only in the unmethylated DNA lane [18].

Statistical analysis was conducted using SAS version 8.0 (SAS Institute, Cary, N.C., USA). Fisher’s exact test was used to assess the difference of PCDH8 methylation status between NMIBC patients and controls. Chi-square test was used to assess the relationship between PCDH8 methylation and clinicopathologic features. Kaplan-Meier survival analysis and log-rank test were used to assess the differences of recurrence-free survival, progression-free survival and five-year overall survival between patients with PCDH8 methylated and unmethylated. Multivariate Cox proportional hazard model analysis was used to assess the independent prognostic effect of PCDH8 methylation. A two-sided p value < 0.05 was considered statistically significant.

In the current study, the methylation status of PCDH8 in NMIBC and normal bladder epithelial tissues was examined by MSP. We found that PCDH8 methylation occurred in 128 (54.9%) patients with NMIBC (Figure 1). However, no methylation was detected in controls, and the difference between these two groups was statistically significant. The result is shown in Table 1.

The main purpose of this study was to investigate the clinical significance of PCDH8 methylation in NMIBC, so we investigated the relationships between PCDH8 methylation and clinicopathological features in bladder cancer. The association of PCDH8 methylation with the clinicopathological features is summarized in Table 2. The promoter methylation of PCDH8 in NMIBC tissues was correlated with, advanced stage (P = 0.0138), high grade (P = 0.0010), larger tumor size (P = 0.0482), tumor recurrence (P < 0.0001) and tumor progression (P < 0.0001) significantly. However, the promoter methylation of PCDH8 was not correlated with age, gender, and tumor number.

To examine if PCDH8 promoter methylation is a potential predictor of the prognosis in NMIBC, the recurrence-free survival, progression-free survival and five-year overall survival was analyzed, and the NMIBC patients was divided into two subgroup according to PCDH8 methylation status. Kaplan-Meier survival analysis and log-rank test suggested that NMIBC patients with PCDH8 methylated had significantly shorter recurrence-free survival (P < 0.0001; Figure 2), progression-free survival (P < 0.0001; Figure 3) and five-year overall survival (P = 0.0262; Figure 4) than patients with PCDH8 unmethylaed respectively. Moreover, multivariate Cox proportional hazard model analysis indicated that PCDH8 promoter methylation in tissues was an independent predictor of shorter recurrence-free survival (P < 0.0001; Table 3), progression-free survival (P =0.0036; Table 4) and five-year overall survival (P = 0.0015; Table 5).