Background
The herpes family of DNA viruses can be divided into neurotropic or alpha Herpes viruses such as HSV and VZV, which latently infect sensory neurons, and lymphotropic Herpes viruses including EBV, KSHV, and CMV, which form latent infections in lymphoid cells, Initial Herpes virus infection begins in epithelial cells before transferring to the cell types which are destined to become latently infected [
1]. Herpes Simplex Virus type I (HSV-1) is a linear double-stranded DNA virus with a large 152 kb genome, coding about 80 genes. It enters productive infection in epithelial cells and can establish latent infection in ganglia sensory neurons as a non-integrated, nucleosome-associated episome to colonize the host nucleus. During lytic infection, HSV-1 assembles its chromatin and synthesizes, sequentially, viral immediate-early protein (IE), early protein (E), and late proteins (L). The resulting productive infection of HSV-1 causes oral herpes, viral keratitis, and genital herpes, a serious condition affecting 18% of the adults in the US.
Cellular RNA polymerase II is responsible for viral gene transcription and the CTD ser5P (C-terminal domain ser5 phosphorylated) modified form is vital in transcriptional regulation [
2‐
4]. Host chromatin assembly factors, host histones, and histone variants are also utilized to assemble HSV-1 chromatin [
5‐
7]. The latent Herpes virus genomes are generally considered to be packed into chromatin in similar ways to the host chromatin [
8,
9], which are composed of closely packed, modified histones including H3K27me3 and H3K9me3.
Cohesin complex comprises SMC1, SMC3, SCC1/Rad21, and SA1/2, and is essential for chromatid cohesion and segregation processes [
10,
11]. Besides its defining activity of mediating sister chromatid cohesion, cohesin is also important for DNA double-strand break repair, transcriptional control, and long-range chromosomal interactions [
10]. Cohesin is also implicated in the interaction between the virus and host cells, where it interacts with or regulates several DNA viruses, including EBV, KSHV, and HPV [
12‐
14]. For example, Rad21 maintains KSHV latency; its deletion or cleavage leads to KSHV lytic infection from latent infection in KSHV-positive pleural effusion lymphoma cells [
15]. Cohesin, but not CTCF, represses KSHV lytic gene activation during latency infection [
16]. During KSHV lytic infection, cohesin and CTCF promote viral transcription initially but subsequently inhibit KSHV lytic transcription. In EBV, CTCF and cohesin are highly enriched in the LMP1 and LMP2A genes and promote their transcription through epigenetic regulation [
17]. However, the function of cohesin in HSV infection has not been explored.
We investigated the role of two core cohesin subunits, SMC1 and Rad21, in HSV-1 lytic infection and found that cohesin is recruited to the HSV-1 replication compartment, its knockdown repressed the formation of the replication compartment, suggesting that cohesin promotes the formation of the HSV-1 replication compartment. Further analyses revealed that cohesin promotes HSV-1 lytic gene transcription, as the knockdown of SMC1 and Rad21 resulted in decreased immediate-early and late gene expression. Consistently, SMC1 and Rad21 knockdown caused a reduction in the viral genome copy number and viral yield. We further demonstrated that cohesin knockdown decreases RNA pol II occupancy at the lytic genes but increases RNA pol II CTD phosphor ser5 occupancy ratio. At chromatin level, SMC1 and Rad21 knockdown induced an elevation of the H3K27me3 enrichment to the HSV-1 genome. These results suggest that cohesin facilitates viral replication and transcription by promoting RNA Pol II recruitment to viral genes.
Discussion
Here we demonstrated that cohesin components SMC1, SMC3, and Rad21 were recruited to the HSV-1 replication compartment. SMC1 and Rad21 could promote HSV-1 replication compartment development at the early infection stage, and the knockdown of SMC1 and Rad21 resulted in a decrease of HSV-1 replication and viral copy number. SMC1 and Rad21 facilitated viral gene transcription by increasing the recruitment of overall level RNA Pol II and by preventing the enrichment of silenced chromatin mark H3K27me3. These results suggest that cohesin promotes HSV-1 lytic infection through facilitating viral replication compartment development and viral transcription.
Cohesin mediates sister chromatid cohesion by forming a ring structure during mitosis [
25] and regulate gene transcription through forming long-range loops at many loci [
26‐
28]. Cohesin shares many binding sites with a CTCF across the whole genome [
29,
30], and together, they could function as boundary elements and form large chromatin domains [
31]. Cohesin and CTCF co-localize in the latent transcript region within the KSHV genome and regulate lytic K14/ORF74 transcript [
32,
33]. They also bind similar sites in the EBV latency membrane proteins LMP-1 and LMP-2A regions and are important for DNA loop formation with the origin of plasmid replication (OriP) enhancer [
17]. We and others found that CTCF is recruited to the HSV-1 genome at multiple binding sites and localizes to a substructure within the viral replication compartments [
34‐
38]. Here we found that cohesin components SMC1, SMC3, and Rad21 were also recruited to the HSV replication compartment, and this result is consistent with iPOND (Isolation of proteins on nascent DNA) data from others, which showed that cohesin interacted with replicating HSV-1 genome [
39]. In addition to a direct role in transcription, cohesion could indirectly promote viral growth by participating in the DNA repair process and by chromatin organization. Since cohesin participates in DNA repair processes [
40], it could help the virus during replication and resolve replication stress and DNA damage to the viral genome, inhibiting viral transcription and replication. The independent recruitment of CTCF and cohesion to the viral replication compartment supports this possibility. Alternatively, as we found that knockdown of cohesin compromised HSV-1 replication compartment development and the phenotype is similar to what we observed in the HSV-1 replication with CTCF knockdown, cohesin could also exert supportive functions through genome organization during HSV-1 replication.
Importantly, cohesin can directly promote gene expression by regulating RNA polymerase II activity to target genes at the genome-wide scale [
41]. The knockdown of cohesin component Rad21 led to the decreased transition of paused Pol II to elongation [
41]. In KSHV, cohesin represses KSHV lytic gene expression during latency, and Rad21 depletion switched the paused form of RNA pol II to the elongation form of RNA pol II at the promoter of KSHV lytic gene ORF45 [
16]. We previously reported that CTCF could promote HSV-1 transcription by facilitating the binding of CTD Serine 2 phosphorylated form of RNA Pol II and preventing the silencing of chromatin on the viral genome [
34]. In this study, we found that cohesin knockdown resulted in decreased transcription of HSV-1 lytic genes, which is similar to the effect of CTCF on HSV-1 gene expression. We found a reduction in RNA Pol II recruitment and the accumulation of paused form of RNA Pol II, and an increase of silenced chromatin mark H3K27me3 binding to HSV-1 genes. Thus the facilitating role of cohesin in HSV-1 lytic infection differs from its role in KSHV and EBV. The difference could be because HSV-1 usually enters lytic infection in epithelial cells after primary infection, while KSHV tends to establish latent infection in B cells and endothelial cells. HSV-1 replicates rapidly in epithelial cells, so the experiments related to HSV-1 infection were mostly done shortly after infection. The lytic infection of KSHV may take several days, and large-scale chromatin conformation could play a bigger role.
Taken together, our finding that cohesin promotes HSV-1 replication and transcription broadens the understanding of how chromatin organizers play roles in the pathogen's life cycle and demonstrate the diversity of host protein functions in the interactions between virus and host.
Conclusions
In this study, we found that cohesin subunits SMC1 and Rad21 were required for lytic HSV-1 replication. The depletion of cohesin results in decreased viral transcription, maturation of viral replication compartments, and viral reproduction. Cohesin prevents the recruitment of the pausing form of RNA polymerase II and the repressive chromatin marked by H3K27me3 to viral genes. These results suggest that cohesin facilitates HSV-1 lytic transcription by promoting RNA Pol II transcription activity and preventing chromatin's silencing on the viral genome.
Methods
The methods were carried out under the approved guidelines.
Cells and virus
BJ, HeLa, 293T, and Vero cells were originally obtained from American Type Culture Collection. Cells were maintained in DMEM (Gibco) containing 10% fetal bovine serum (FBS), penicillin (100 U/ml), and streptomycin (100 μg/ml) in a humidified 5% CO
2 atmosphere at 37 ℃. HSV-1 17 + was kindly gifted by Dr. Chunfu Zheng from the Fujian Medical University. The virus was grown and titrated on Vero cells, as described previously [
42]. Viral infections were done at indicated MOI. Briefly, the culture medium was replaced with serum-free DMEM, followed by adding the virus and incubating for 1 h, then the medium was replaced by regular DMEM with 10% FBS and 1% antibiotics. All experiments were carried out under the approved guidelines of the ethics committee of Kunming Institute of Zoology, and all experimental protocols were approved by the ethics committee of Kunming Institute of Zoology, Chinese Academy of Sciences.
Antibodies
Monoclonal antibody against ICP4 is a gift from Gerd Maul's laboratory at the Wistar Institute [
43,
44]. Antibodies against SMC1 (ab9262), SMC3 (ab9263), Rad21 (ab992), RNA Pol II (ab5408), RNA Pol II Ser5P (ab5131), H3K27me3 (ab6002) and IgG (ab46540) were from Abcam. CTCF polyclonal antibodies were bought from Abcam (ab70303), CTCF monoclonal antibodies were from Millipore (17-10044). Alexa Fluor 594 Goat Anti-Mouse IgG (H + L) Antibody and Alexa Fluor 488 Goat Anti-Rabbit IgG (H + L) Antibody were from Life Technologies.
Immunofluorescence
Cells were seeded on glass coverslips in 24-well plates 24 h before infection and used for infections at indicated MOI. At 5.5 hpi, cells were fixed with 4% paraformaldehyde at 4 ℃ for 60 min and extracted with 0.2% Triton X-100 in PBS for 10 min. The nuclei were visualized by staining with Hoechst33342 and indicated proteins were stained by specific antibodies. Images were acquired using Nikon 80i. Images were taken with different channels for different samples. Images were merged and processed by Image J [
45].
SMC1, Rad21, and CTCF knockdown
For HeLa cells, siRNAs were used to knockdown indicated protein. Briefly, siRNAs GCAAUGCCCUUGUCUGUGAUU for SMC1, siRNAs AUACCUUCUUGCAGACUGU for Rad21, siRNAs GUAGAAGUCAGCAAAUUAA for CTCF were transfected into HeLa cells using Lipofectamine 2000 (Life Technologies, 11668019) according to the manufacturer's instructions. For BJ cells, shRNAs delivered by lentivirus were used to knockdown indicated protein. Briefly, shRNA CCGGGCCGGGACTGTATTCAGTATACTCGAGTATACTGAATACAGTCCCGGCTTTTTGAATTC for SMC1, shRNA CCGGGCTAATTGTTGACAGTGTCAACTCGAGTTGACACTGTCAACAATTAGC for ShRad21 were cloned into pLKO.1 vector. Furthermore, lentivirus was packaged by co-transfect pLKO.1 vector and pRSV-Rev, pMD2.G(VSV-G), pMDLg/pRRE package vector into HEK293T cells. Virion was collected from the medium by centrifuge at 48 h and 72 h after transfection and titrated by qPCR. HSV-1 infection was done after knockdown for 48–72 h.
Isolation host and viral genomic DNA and RNA for qPCR and qRT-PCR analyses
Cells were infected with HSV-1 at an MOI of 5 and harvested at various time points. The genomic DNA was purified using the Genomic DNA purification kit (DP304-03, Tiangen). The RNA purification was purified using TRIzol (Ambion, 15596-018). Then, 1 μg RNA was reverse transcribed using Prime ScriptRT Reagent Kit with gDNA Eraser (TaKaRa, DRR047A) and stored at – 20 ℃. Real-time PCR was run in triplicate with 50 ng cDNA or 50 ng genomic DNA using FastStart Universal SYBR Green Master (Roche, 04913914001) ABI7900HT. Sequences of primers used are provided in the Additional file 1: Table
S1. Viral DNA or RNA levels at each time point were quantified relative to the 0 hpi samples by the ΔCt method. To determine the relative DNA or RNA content at various times, average Ct valued for ICP0, ICP4, ICP8, and UL30 genes were subtracted by the average Ct values for 18 s. The calibrator value (HSV sample 0 hpi) was subtracted by the 18 s Ct value. To obtain the ΔΔCt value, the Ct value was subtracted by the Ct value of the input time point. ΔΔCt = (Ct
test − Ct
reference)—(Ct
0 hpi sample − Ct
0 hpi 18 s). The fold enrichment value is 2
−ΔΔCt.
Chromatin immunoprecipitation
ChIP assays were carried out according to the protocol from Chromatin Immunoprecipitation Assay Kit (Millipore) with minor modification. Briefly, cells were infected with HSV-1 at an MOI of 5. At 6 hpi, cells were fixed with formaldehyde (Sigma, final concentration 1% v/v). Then Glycine (125 mM) was added to stop the reaction. Cells were washed 3 times with ice-cold PBS then scraped from culture dishes into microfuge tubes. Cells were collected by centrifugation at 5000×g at 4 ℃ for 10 min. The cells were lysed by Lysis Buffer with protease inhibitors and sonicated to yield DNA fragments of between 200 and 500 bp in length. The samples were clarified by centrifugation at 13,000×g at 4 ℃ for 15 min, and the supernatant was diluted tenfold in IP Dilution Buffer with protease inhibitors. An aliquot (1/20) of each chromatin supernatant was reserved as the input sample. Dynabeads Protein G from INVITROGEN with a magnetic stand was used for immunoprecipitation. The chromatin supernatant was incubated with 5 μg antibody specific for total RNA pol II or RNA pol II ser 5 or H3K27me3 overnight at 4 ℃ with rotation. An aliquot was incubated with IgG (Abcam, ab2410) as a control to determine background binding. The beads were washed for 5 min at 4 ℃ with rotation, twice with Low-salt Buffer, once with High-salt Buffer, once with LiCl Buffer, twice with TE Buffer. Immunocomplexes were eluted by adding 210 μl of Elution Buffer incubating for 15 min at 65 ℃. Spin the beads at 13,000 rpm for 1 min and take 200 μl of the eluted solution and transfer to a new tube. Crosslinks were reversed by incubation for 7 h at 65 ℃ with a final concentration of 200 mM NaCl. The samples were then treated with RNase A and digested with proteinase K. DNA was purified by QIA quick PCR Purification Kit (QIAGEN, Cat. No 28104) and used as a template for real-time PCR.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit
http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.