Background
Methods
Bacterial strains and culture conditions
Species | Strain | Source | Real-time PCR specificity |
---|---|---|---|
C. jejuni subsp. jejuni | CCM 6212 | Human blood | + |
C. jejuni subsp. jejuni | NCTC 11168 | Human faeces | + |
C. jejuni subsp. jejuni | 81-176 | Human faeces | + |
C. jejuni
| 1 K | Chicken meat | + |
C. jejuni
| 667/C4 | Human clinical isolate | + |
C. jejuni
| 681/C5 | Human clinical isolate | + |
C. jejuni
| 2517 | Human clinical isolate | + |
C. jejuni
| 3316 | Human clinical isolate | + |
C. jejuni
| 13 | Wastewater treatment plant | + |
C. jejuni
| 53G | Turkey breasts | + |
C. coli
| CCM 6211 | Pig | + |
C. coli
| 549/6 | Wastewater treatment plant | + |
C. coli
| 490/3 | Wastewater treatment plant | + |
C. coli
| C253 | Human clinical isolate | + |
C. coli
| C254 | Human clinical isolate | + |
C. coli
| C226 | Human clinical isolate | + |
C. coli
| 2463 | Human clinical isolate | + |
C. coli
| 2521 | Human clinical isolate | + |
C. coli
| 2530 | Human clinical isolate | + |
C. coli
| 52 | Chicken breasts | + |
C. lari
| CCM 4897 | Herring gull, cloacal swab | + |
C. fetus subsp. fetus | CCM 6213 | Human blood | - |
C. upsaliensis
| ATCC 43954 | Animal faeces | - |
Arcobacter butzleri
| 2013/43 | Chicken thigh | - |
Arcobacter cryaerophilus
| 2012/1 | Wastewater treatment plant | - |
Arcobacter skirrowii
| 2013/34 | Cow teat | - |
Bacillus cereus
| DBM 3035 | Not found | - |
Bacillus megaterium
| CCM 2007 | Not found | - |
Bacillus subtilis subsp. spizizenii | CCM 1999 | Not found | - |
Cronobacter sakazakii
| ATCC 29544 | Child’s throat | - |
Enterobacter cloacae
| CCM 1903 | Plasma | - |
Enterococcus faecalis
| CCM 4224 | Urine | - |
Escherichia coli
| CCM 4517 | Human faeces | - |
Escherichia coli
| 485 | Raw milk | - |
Listeria innocua
| CCM 4030 | Cow brain | - |
Listeria ivanovii subsp. ivanovii | CCM 5884 | Sheep | - |
Listeria monocytogenes
| CCM 5576 | Guinea pig mesenteric lymph node | - |
Listeria monocytogenes EGD-e | ATCC BAA-679 | Animal tissue | - |
Pseudomonas aeruginosa
| CCM 1968 | Not found | - |
Pseudomonas aeruginosa
| 49 | Turkey meat | - |
Rhodococcus equi
| CCM 3429 | Lung abscess of foal | - |
Salmonella enterica subsp. enterica | CCM 7205 | Animal tissue | - |
Staphylococcus aureus subsp. aureus | CCM 3953 | Clinical isolate | - |
Yersinia enterocolytica
| CNCTC 7252 Y41/73 | Human faeces | - |
Yersinia ruckeri
| CCM 6093 | Rainbow trout | - |
Design of qPCR assay
DNA extraction
In silico analyses
Species | Target/GeneBank ID | Primer/probe | DNA sequence 5’→3’ | Position within target | Amplicon (bp) | Reference |
---|---|---|---|---|---|---|
C. jejuni
| hip Oa NC_002163.1 | Forward | TGCACCAGTGACTATGAATAACGA | 809-832 | 124 | |
Reverse | TCCAAAATCCTCACTTGCCATT | 911-932 | He et al., 2010 [28] | |||
Probe | JOE-TTGCAACCTCACTAGCAAAATCCACAGCT-Eclipse | 836-864 | ||||
C. coli
| gly Ab AF136494.1 | Forward | CATATTGTAAAACCAAAGCTTATCGTG | 271-297 | 133 | |
Reverse | AGTCCAGCAATGTGTGCAATG | 384-404 | LaGier et al., 2004* [18] | |||
Probe | FAM-TAAGCTCCAACTTCATCCGCAATCTCTCTAAATTT- Eclipse | 337-371 | ||||
C. lari
| pep Tc NC_012039.1 | Forward | TTAGATTGTTGTGAAATAGGCGAGTT | 519-544 | 86 | |
Reverse | TGAGCTGATTTGCCTATAAATTCG | 581-604 | He et al., 2010* [28] | |||
Probe | CY5-TGAAAATTGGAAdC GdC AGGTG-BHQ | 551-570 |
Bacterial strain | NCBI genome accession number |
---|---|
Campylobacter jejuni 81 - 176 | NC_008787.1 |
Campylobacter jejuni 81116 | NC_009839.1 |
Campylobacter jejuni NCTC 11168 | NC_002163.1 |
Campylobacter coli JV20 | AEER01000001.1 |
Campylobacter lari RM2100 | NC_012039.1 |
Campylobacter concisus 13826 | NC_009802.1 |
Campylobacter curvus 525.92 | NC_009715.1 |
Campylobacter fetus subsp. fetus 82-40 | NC_008599.1 |
Campylobacter hominis ATCC BAA-381 | NC_009714.1 |
Arcobacter butzleri RM4018 | NC_009850.1 |
Arcobacter nitrofigilis DSM 7299 | NC_014166.1 |
Bacillus cereus ATCC 10987 | NC_003909.8 |
Bacillus subtilis subsp. subtilis str. 168 | NC_000964.3 |
Cronobacter sakazakii ATCC BAA-894 | NC_009778.1 |
Enterobacter aerogenes KCTC 2190 | NC_015663.1 |
Enterobacter cloacae subsp. cloacae ATCC 13047 | NC_014121.1 |
Escherichia coli ATCC 8739 | CP000946.1 |
Escherichia coli BW2952 | NC_012759.1 |
Helicobacter pylori 26695 | NC_000915.1 |
Listeria monocytogenes 08-5578 | NC_013766.1 |
Listeria monocytogenes EGD-e | NC_003210.1 |
Pseudomonas aeruginosa UCBPP-PA14 | NC_008463.1 |
Salmonella bongori NCTC 12419 | NC_015761.1 |
Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 | NC_003197.1 |
Shigella boydii CDC 3083-94 | NC_010658.1 |
Shigella dysenteriae Sd197 | NC_007606.1 |
Shigella flexneri 2002017 | CP001383.1 |
Shigella sonnei Ss046 | NC_007384.1 |
Staphylococcus aureus subsp. aureus NCTC 8325 | NC_007795.1 |
Yersinia enterocolitica subsp. enterocolitica 8081 | NC_008800.1 |
Empirical primers’ specificity screen
Singleplex qPCR
Multiplex PCR
Data analysis
Assay validation on food samples
Sample collection and processing
Artificial contamination of food samples
DNA extraction and qPCR
Results and discussion
qPCR assay
Singleplex qPCR
Platform | Singleplex | Multiplex | ||||||
---|---|---|---|---|---|---|---|---|
Strain | Efficiency (%) | Slope | y-intercept | R2 | Efficiency (%) | Slope | y-intercept | R2 |
C. jejuni CCM 6212 | 84.560 | −3.757 | 41.308 | 0.999 | 90.848 | −3.565 | 42.227 | 0.998 |
C. coli CCM 6211 | 89.235 | −3.610 | 37.393 | 1.000 | 96.973 | −3.399 | 40.040 | 0.998 |
C. lari CCM 4897 | 77.930 | −3.996 | 40.234 | 0.993 | 92.888 | −3.506 | 39.548 | 0.998 |
Multiplex qPCR
Food sample analyses
Food sample | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Wing rinse A | Wing rinse B | Wing rinse C | Chicken juice | Fried strips homogenate | |||||||||||
CFU/ml | 101 | 102 | qPCR | 101 | 102 | qPCR | 101 | 102 | qPCR | 101 | 102 | qPCR | 101 | 102 | qPCR |
C. jejuni
| - | - | - | - | - | - | - | - | - | - | - | 7.1×102 ± 1.6×102 | - | - | - |
C. coli
| - | + | - | + | + | - | - | + | +* | - | + | - | + | + | - |
C. lari
| + | + | - | - | + | - | + | + | - | + | + | - | - | + | - |