Materials
C-reactive protein (CRP), interleukin 6 (IL6) and tumor necrosis factor alpha (Tnf-α) ELISA kits were purchased from Elabscience Biotechnology Co., Ltd (Wuhan, China), while 1,1,3,3-tetramethoxypropane (TMP), thiobarbituric acid, potassium persulphate (K2S2O8), 2,2’-azino-bis [3-ethylbenzothiazoline-6-sulphonic acid] (ABTS) reagent, trolox standard and trichloroacetic acid were purchased from Sigma Aldrich (St. Loius, MO, USA). RNA extraction kit was from RBC Bioscience Corp. (Taipei, Taiwan) and GenomeLab™ GeXP Start Kit was from Beckman Coulter Inc (Miami, FL, USA). Simvastatin, RCL2 solution and lipid profile kits were from Pfizer (New York, NY, USA), Alphelys (Toulouse, France) and Randox Laboratories Ltd (Crumlin, County Antrim, UK), respectively. Cholesterol and Cholic acid were purchased from Amresco (Solon, OH, USA) and Santa Cruz Biotechnology (Santa Cruz, CA, USA), respectively. Standard rat pellet was from Specialty feeds (Glen Forrest, WA, USA), while palm oil was supplied by Yee Lee Edible oils Sdn. Bhd. (Perak, Malaysia). All other solvents were of analytical grade and purchased from Merck (Darmstadt, Germany). EBN supplied by Blossom View Sdn. Bhd (Terrengganu, Malaysia) was cleaned under tap water for 5 mins, dried at room temperature and ground into powder manually using mortar and pestle before incorporating it into rat pellet.
Animal study
Permission for the use of animals was sought from the Animal Care and Use Committee (ACUC) of the Faculty of Medicine and Health Sciences, Universiti Putra Malaysia (Project approval number: UPM/IACUC/AUP-R011/2014), and animals were handled as according to standard guidelines. Sprague dawley rats (10-week old, 230–280 g,
n = 30) were maintained under controlled conditions (25 ± 2 °C, 12/12 h light/dark cycle) and after 2 weeks of acclimatization rats were fed HFD containing 4.5 % cholesterol and 0.5 % cholic acid with or without treatment using Simvastatin or EBN (Table
1), except the normal group (
n = 6). Intervention lasted for another 12 weeks, after which rats were sacrificed and their organs harvested for further studies. During the intervention, food intake was calculated by subtracting the left-over food from what was added the previous day, and weight was recorded weekly. At the end of the intervention, blood samples and liver tissues were collected for further tests.
Table 1
Food composition of rat groups and intake
Normal | 100 | | | | | 215.5 ± 33.5a | 260.4 ± 10.7a | 384 ± 22.9a |
High fat diet | 65 | 5 | 20 | 10 | | 215.0 ± 37.5a | 262.6 ± 17.7a | 395.2 ± 16.8a |
High fat diet + Simvastatin | 65 | 5 | 20 | 10 | Simvastatin (10 mg/kg) | 215.7 ± 36.6a | 267.7 ± 21a | 375.7 ± 53.4a |
High fat diet + 20 % EBN | 45 | 5 | 20 | 10 | 20 % EBN | 216.1 ± 36.8a | 261.7 ± 15.4a | 380.7 ± 25.6a |
High fat diet + 2.5 % EBN | 62.5 | 5 | 20 | 10 | 2.5 % EBN | 216.5 ± 35.8a | 257 ± 20.1a | 368 ± 29.3a |
Liver Thiobarbituric acid reactive species (TBARS)
Liver tissue TBARS was measured as reported previously with some modifications [
9]. Briefly, liver tissue (80 mg) was homogenized in 250 uL of 0.25Hcl and mixed with 250 uL of 0.375 % thiobarbituric acid and 250 uL of 15 % tricholoroacetic acid. Then, the mixture was incubated at 100 °C for 10 min and cooled before centrifuging at 3000 rpm for 15 min. Finally, absorbance of 100 uL of each sample and standard (TMP) were measured on BioTeK Synergy H1 Hybrid Reader (BioTek Instruments Inc., Winooski, VT, USA) at 532 nm, and the results expressed as uM MDA/mg tissue.
Serum total Antioxidant status
ABTS radical scavenging activity was used as a marker of total antioxidant status [
10]. Briefly, 6.62 mg of potassium persulphate, K
2S
2O
8 was dissolved in 10 mL of distilled water to prepare a solution of 2.45 mM. Then, 7 mM ABTS was prepared by dissolving 38.4 mg in 10 mL distilled water. The two solutions were mixed and incubated in the dark for 16 h prior to use, and diluted with distilled water until a spectrophotometric absorbance of 0.700 ± 0.005 at 735 nm was obtained. Serum samples (100 μL) were reacted with 900 μL of the diluted ABTS solution and vortexed. The absorbance was read at 734 nm. ABTS radical cation scavenging activity was calculated as the percentage reduction in absorbance.
Serum C-reactive protein, Interleukin-6 and Tumor necrosis factor-alpha
Serum from blood collected in plain tubes was used for measurements of CRP, IL6 and Tnf-α using the respective ELISA kits according to the manufacturers’ instructions. Absorbances were read on BioTeK Synergy H1 Hybrid Reader (BioTek Instruments Inc., Winooski, VT, USA) at the 450 nm. The results were finally expressed as fold change in comparison to normal group:
Fold change = absorbance for the intervention group/absorbance for the normal group
Gene expression study
Primers for the gene expression study (Table
2) were designed using the
Rattus norvegicus gene sequences from the National Center for Biotechnology Information website (
http://www.ncbi.nlm.nih.gov/nucleotide/), and tagged with an 18-nucleotide universal forward and 19-nucleotide universal reverse sequence, respectively. Primers were supplied by Integrated DNA Technologies (Singapore) and reconstituted in RNAse free water. Extracted hepatic RNA (20 ng) was reverse transcribed and used for PCR according to the GenomeLab™ GeXP Start Kit protocol (Beckman Coulter, USA), using the conditions stated on Table
2. PCR products (1 uL) were analyzed on GeXP genomelab genetic analysis system (Beckman Coulter, Inc, Miami, FL, USA) after mixing with sample loading solution and DNA size standard 400 as recommended by the manufacturer. Results were analyzed with the Fragment Analysis module of the GeXP system software and normalized on the eXpress Profiler software.
Table 2
Names, accession number and primer sequences used in the study
nfkb1 | AGGTGACACTATAGAATACACTCCATATTTAATGCAGA | GTACGACTCACTATAGGGAGAAATCCTCTCTGTTTCG |
B2ma | AGGTGACACTATAGAATAATGCTTGCAGAGTTAAACA | GTACGACTCACTATAGGGATGCATAAAATATTTAAGGTAAGA |
Hprt1a,b | AGGTGACACTATAGAATATCCTCATGGACTGATTATG | GTACGACTCACTATAGGGACTGGTCATTACAGTAGCTCTT |
Rpl13aa | AGGTGACACTATAGAATAATGGGATCCCTCCAC | GTACGACTCACTATAGGGAATTTTCTTCTCCACATTCTT |
Kan(r)c | | |
Sod1 | AGGTGACACTATAGAATAATATGGGGACAATACACAA | GTACGACTCACTATAGGGATCCAACATGCCTCTCT |
Sod2 | AGGTGACACTATAGAATACAGGTTGCTCTTCAGC | GTACGACTCACTATAGGGAAACTCTCCTTTGGGTTCT |
Tnf | AGGTGACACTATAGAATACCCAACAAGGAGGAGA | GTACGACTCACTATAGGGATGGTGGTTTGCTACGA |
CcL2 | AGGTGACACTATAGAATAATAAAATTGCATCAACCCTA | GTACGACTCACTATAGGGAATCACATTCCAAATCACACT |
IL6 | AGGTGACACTATAGAATAATTGTATGAACAGCGATGA | GTACGACTCACTATAGGGAAGTTGTTCTTCACAAACTCC |
Gpx1 | AGGTGACACTATAGAATATTGAGAAGTTCCTGGTAGGT | GTACGACTCACTATAGGGATTTTCTGGAAATCAGGTGT |
IL10 | AGGTGACACTATAGAATAAGGACTTTAAGGGTTACTTG | GTACGACTCACTATAGGGAGAAGATGTCAAACTCATTCA |
Gsr | AGGTGACACTATAGAATAAATAAACTGGGGATTCAGAC | GTACGACTCACTATAGGGAAGTAGATTTTCACATTGTCTTTG |
CRP | AGGTGACACTATAGAATACTAAACAGGCCTTCGTATT | GTACGACTCACTATAGGGACAAGCCAAAGCTCTACAAT |
Data analysis
The means ± standard deviation (n = 6) of the groups were used for the analyses. One-way analysis of variance (ANOVA) was performed using SPSS 17.0 software (SPSS Inc., Chicago, IL, USA) to assess the level of significance of differences between means with a cutoff of p < 0.05.